ID: 1077008674

View in Genome Browser
Species Human (GRCh38)
Location 11:370483-370505
Sequence GGGGTCCATGCGTAGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008664_1077008674 4 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136
1077008663_1077008674 16 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136
1077008662_1077008674 17 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008674 Original CRISPR GGGGTCCATGCGTAGGGATG GGG Intronic
900135512 1:1115615-1115637 GGGGTCCCTGGGGAGGGAGGGGG - Intronic
902975457 1:20085060-20085082 GCAGTCCATGCGTAAGGCTGTGG + Intronic
903699560 1:25236482-25236504 GGCTACCATGCGTAGAGATGAGG - Intergenic
904773881 1:32895211-32895233 GGGGCCCATACATAGGGGTGGGG + Intronic
905244209 1:36601557-36601579 GGTGTGCATGTGTGGGGATGGGG + Intergenic
905657116 1:39692126-39692148 GGGGTCCATGAGAAAGGAGGAGG - Intergenic
910194025 1:84622121-84622143 TGGGTCCAGGGGTTGGGATGGGG - Intergenic
915013877 1:152715052-152715074 GGGGTAAATGAGGAGGGATGTGG - Intergenic
917805445 1:178609002-178609024 GGGGGCCATTCTCAGGGATGGGG - Intergenic
919755584 1:201064181-201064203 GGGGGCCAGGCAAAGGGATGAGG + Intronic
919855484 1:201703548-201703570 GTGGTCCATGCGGAGGACTGTGG - Intronic
920761077 1:208784179-208784201 GGGGTGTGTACGTAGGGATGGGG + Intergenic
922606051 1:226890583-226890605 GGGGTCAATGTGTAGAGATTTGG + Intronic
1064135668 10:12748413-12748435 GGGGCCCACGGGCAGGGATGGGG + Intronic
1067409422 10:46051653-46051675 GGGGTCCCTGGGAAGGAATGGGG - Intergenic
1070768440 10:79069338-79069360 GGGGTGCAAGCGTGGGGATTGGG + Intronic
1070815397 10:79319623-79319645 GGGGTGCATGTGTGGGGATAGGG - Intergenic
1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG + Intronic
1081632804 11:44701181-44701203 GGGCTCCAGGTGTAGGGCTGGGG - Intergenic
1084586376 11:70065173-70065195 TGGCTCCAAGCCTAGGGATGGGG + Intergenic
1085252926 11:75155363-75155385 GGTGTGCATGAGTTGGGATGGGG - Intronic
1090967164 11:131609065-131609087 GGGGTGCATGGGTCAGGATGTGG + Intronic
1095449820 12:42318577-42318599 GGCCTCCATGACTAGGGATGTGG - Intronic
1095979174 12:47961166-47961188 GGGGTCCATGCAGATGGCTGGGG + Intergenic
1099748838 12:86744716-86744738 GGAGTCTATGAGTATGGATGTGG + Intronic
1104736429 12:131138425-131138447 GGGGTCAAGGGGTAGGGCTGTGG - Intronic
1111685759 13:91499012-91499034 GTGATCCATGATTAGGGATGGGG + Intronic
1113372544 13:109736434-109736456 GGGGTCCCTGAGTAGAGAAGTGG + Intergenic
1115506376 14:34097868-34097890 GGGTCGCCTGCGTAGGGATGAGG + Intronic
1118474164 14:66101581-66101603 GGGGTGCAAGCATAGGGGTGTGG - Intergenic
1122640917 14:103158788-103158810 GGGGTCCATTCTGATGGATGGGG - Intergenic
1122791506 14:104185822-104185844 GGGGTACAGGTGAAGGGATGGGG + Intergenic
1126110505 15:45172200-45172222 GGGCTCCATGCTTAGGGGTTTGG + Exonic
1128211877 15:65908949-65908971 GGGGTCAAGGTGCAGGGATGGGG + Intronic
1131755783 15:95559611-95559633 GGGGTGGATGCAGAGGGATGGGG - Intergenic
1133001953 16:2856311-2856333 GGGGTGCAGGCCTAGGGATTGGG - Intronic
1134441265 16:14301158-14301180 GGGGTCCCTGGGCAGGGGTGTGG + Intergenic
1138311442 16:56026935-56026957 GGGCTGCATGAGTAGGGTTGGGG + Intergenic
1139081798 16:63530789-63530811 GGGGGCCAGGAGTAGGGAAGAGG - Intergenic
1139700159 16:68703283-68703305 GAGGTCCATGCCTAGAAATGGGG - Intronic
1139937633 16:70582866-70582888 TGGCTCCATGCTTAAGGATGAGG + Intronic
1141119078 16:81336846-81336868 GCTGTGCATGGGTAGGGATGGGG - Intronic
1141529865 16:84638584-84638606 GGGGTCCAGAACTAGGGATGTGG + Intergenic
1145263274 17:21367183-21367205 GGGGTCCGTGCGTGGGAACGGGG - Intergenic
1147767657 17:42847604-42847626 GGGGACCATGGGAAGGGATTGGG + Intronic
1147769910 17:42860340-42860362 GGGCTCCATGAGTAGGTAGGGGG - Intergenic
1151880911 17:76893877-76893899 GGGGTCCATGCACAGGGTGGGGG - Intronic
1152187564 17:78867503-78867525 GGTGTCCTTGCCTATGGATGGGG - Intronic
1154151052 18:11906976-11906998 GGGGTCCATGCAGATGGTTGAGG - Intronic
1157700984 18:49761548-49761570 GGGGTGCATGTGGGGGGATGGGG - Intergenic
1158868616 18:61662252-61662274 GGGGTGCAATCGTAGGGGTGTGG - Intergenic
1160367035 18:78335377-78335399 GGGGTCTATGGGGAGGGAGGAGG + Intergenic
1160607048 18:80059157-80059179 GGGGTCCATGCACAGGGCCGAGG - Intronic
1161846069 19:6712676-6712698 GGGGTCCATTCTGAGGGAGGAGG - Intronic
1166869998 19:45865206-45865228 GAGGGTCATGGGTAGGGATGGGG - Intronic
1168721236 19:58556004-58556026 GGGGGCCATGGGTAGGGGTTTGG - Exonic
930640936 2:53853975-53853997 GGGGTCCCTGTGCAGGGAGGTGG - Exonic
935688960 2:105713195-105713217 GGGGTCACTCCGTAGGGCTGGGG + Intergenic
937973224 2:127565785-127565807 GGGGGCCATGGGGATGGATGTGG + Intronic
937980195 2:127610128-127610150 GGGTTCCATGGGTAAGGCTGAGG - Intronic
938691888 2:133799560-133799582 GGGGACCATGAGGAGGAATGAGG - Intergenic
946933453 2:224695089-224695111 GGGGAGCATGTGTAGGGATTGGG + Intergenic
948620284 2:239230244-239230266 GGGGTCCATTCATTGGGTTGGGG + Intronic
948949339 2:241238927-241238949 GGGCTCCAGGCGCAGGGAGGAGG + Intronic
1169306182 20:4492484-4492506 GGGGGGCATGTGTAGGAATGGGG + Intergenic
1169384348 20:5135627-5135649 GGGGACCATACGTGGGGGTGGGG - Intronic
1173863126 20:46297225-46297247 GGGCTCTGTGAGTAGGGATGCGG + Intronic
1175251544 20:57613078-57613100 GGGGGCAAAGGGTAGGGATGGGG - Intronic
1175300023 20:57936143-57936165 GGGGTGCAATCATAGGGATGTGG - Intergenic
1175790500 20:61737449-61737471 GGGGTCCCTGGGGTGGGATGGGG - Intronic
1175922313 20:62455925-62455947 GGGGTCCTGGCGTGGGGCTGGGG + Intergenic
1177833252 21:26163509-26163531 AGGGTTCATGAGCAGGGATGAGG - Intronic
1179600729 21:42475873-42475895 GAGGTCCCTGCGCAGGGAAGTGG - Intronic
1179625978 21:42650029-42650051 GGGGACCTTGGGTGGGGATGAGG - Intergenic
1181441109 22:22935597-22935619 GGGGGCCAGGCCAAGGGATGGGG + Intergenic
1181545085 22:23598094-23598116 GGGGGCCAGGCCAAGGGATGGGG - Intergenic
1181815226 22:25431788-25431810 GGGGGCCAGGCCAAGGGATGGGG + Intergenic
1185104510 22:48859654-48859676 GGGCTTCATGGGTAGAGATGTGG - Intergenic
950781691 3:15398001-15398023 GGGGTGCAATCATAGGGATGTGG - Intronic
954246927 3:49339672-49339694 GGGGGCCAGGAGGAGGGATGTGG - Intronic
954293568 3:49662293-49662315 GTGGGCCATACTTAGGGATGAGG - Exonic
963298579 3:143574477-143574499 GGGGTGCATCCCAAGGGATGAGG - Intronic
963454100 3:145522073-145522095 GGGGTCCATTCATATGGCTGGGG + Intergenic
968190918 3:196666500-196666522 GGAGTCCATGCGTGGACATGAGG + Intronic
968763527 4:2455952-2455974 GGTGCCCATGCGTCGGGTTGTGG - Intronic
969538981 4:7774070-7774092 GGAGGCCATGCGTAGGTAAGCGG + Intronic
969613968 4:8241756-8241778 GGGGTACATGGGGAGGGCTGAGG - Intronic
971766080 4:30833603-30833625 AGGGTACATGGGTAAGGATGTGG + Intronic
978199092 4:106004306-106004328 GGGGTCAAAGCGGTGGGATGCGG - Intergenic
978490807 4:109310078-109310100 GGGGTCCATGCAGTTGGATGGGG - Intergenic
982868336 4:160545569-160545591 GGGGTGCAATCGTAGGAATGTGG + Intergenic
984201208 4:176723482-176723504 GGGGTCCATGTGCAGGTTTGTGG + Intronic
985533577 5:448408-448430 GGGGACCAAGGGGAGGGATGAGG - Intronic
988445983 5:31286616-31286638 GGAGGCCATGCGAAGGGGTGGGG + Intronic
991620287 5:68538648-68538670 GGGGTGGATGGGCAGGGATGGGG - Intergenic
998163805 5:139828892-139828914 AGGGTCCAGGCCTTGGGATGGGG + Intronic
998389559 5:141778772-141778794 GGGCTCCCTGCTTAGGGAGGAGG - Intergenic
998389794 5:141780176-141780198 GGGCTCCATGCTTCGGGAGGAGG - Intergenic
999416074 5:151397266-151397288 GGGCTCCATGTGTATGCATGGGG - Intergenic
1002459952 5:179368390-179368412 GGGGACCCTGCCTGGGGATGTGG - Intergenic
1007368971 6:41413732-41413754 GGAGTCCATGCCTATTGATGGGG - Intergenic
1013369074 6:109454967-109454989 GGGGGCCGTGGGTAGGGCTGGGG + Intronic
1017437618 6:154431662-154431684 GGGGTTCATGGTGAGGGATGGGG - Intronic
1019310677 7:359185-359207 GGTGTCCCTGCCTGGGGATGTGG + Intergenic
1020360284 7:7320375-7320397 AGGGTCTATGAGTAGGGAAGAGG - Intergenic
1021244493 7:18245109-18245131 GGGCTCCTTGCTTAGGCATGTGG + Intronic
1023839057 7:44085739-44085761 GGGGTCCCTGCTTGAGGATGTGG + Intergenic
1025280390 7:57622777-57622799 GGCTTCAATGCATAGGGATGTGG - Intergenic
1025304343 7:57842730-57842752 GGCTTCAATGCATAGGGATGTGG + Intergenic
1025709990 7:63900131-63900153 GTAGTCCCTGCGTAGGAATGGGG - Intergenic
1028877946 7:95844633-95844655 GGGGTGCAATCGTAGGGGTGTGG + Intronic
1029467703 7:100736650-100736672 GGGGACCATGAGCAGGGAGGTGG + Intronic
1030648436 7:112090925-112090947 GGGGTCCCTGCCTAGGAATCTGG - Intronic
1033741071 7:144276311-144276333 GGAGTTCATGGGCAGGGATGGGG + Intergenic
1033752835 7:144373303-144373325 GGAGTTCATGGGCAGGGATGGGG - Intronic
1035582292 8:747757-747779 GGGGTCTCTGCGGTGGGATGGGG + Intergenic
1038879716 8:31595364-31595386 GTGGTCCGTGTGTAGGCATGAGG + Intergenic
1043489976 8:80739653-80739675 GGAGTCTATAAGTAGGGATGTGG - Intronic
1045337940 8:101224781-101224803 GGGGTCCAGGAGTAGGGGTTGGG - Intergenic
1047673488 8:127173998-127174020 AAGGTCCATGCTTAGGGTTGTGG - Intergenic
1050200061 9:3135196-3135218 GCTATGCATGCGTAGGGATGGGG + Intergenic
1051053408 9:12956201-12956223 GGGGTCCTTGAGTGGGGATGGGG - Intergenic
1057692953 9:97302723-97302745 GGGTTCTATACGTTGGGATGGGG - Intergenic
1061009564 9:127946950-127946972 GGGGGCCCTGCTTAGGGTTGAGG + Intronic
1061509656 9:131052782-131052804 GGGTACCATGCCTGGGGATGGGG - Intronic
1061926035 9:133806519-133806541 GGGGTCCCGGGGTGGGGATGGGG - Intronic
1062157686 9:135062554-135062576 AAGGTCCATGCGCTGGGATGTGG - Intergenic
1062709993 9:137970189-137970211 GGGGTCCCTGTGTGAGGATGTGG - Intronic
1185823420 X:3226408-3226430 GAGGGCTATGAGTAGGGATGTGG + Intergenic
1187364032 X:18651940-18651962 GGGGGCCAGGCGGAGGGGTGTGG - Intronic
1195010937 X:100731787-100731809 GGAGTCCAAGCCTGGGGATGCGG + Intronic
1197198430 X:123727025-123727047 CGGGTGTATGAGTAGGGATGGGG - Intronic
1197766629 X:130063558-130063580 GGGGTCCTGGAATAGGGATGGGG - Intergenic
1198542475 X:137654369-137654391 GGGGTCCATGTGTATGCTTGGGG + Intergenic
1201255994 Y:12108746-12108768 GAGGGCCATGAGTAGGAATGTGG - Intergenic
1201270423 Y:12248716-12248738 GGAGTCCAAACCTAGGGATGAGG - Intergenic
1202343689 Y:23897099-23897121 GTGGTCCATGCTTATGGATTGGG - Intergenic
1202527079 Y:25772986-25773008 GTGGTCCATGCTTATGGATTGGG + Intergenic