ID: 1077008675 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:370488-370510 |
| Sequence | CTGGGCCCCATCCCTACGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 143 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 135} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077008675_1077008679 | -9 | Left | 1077008675 | 11:370488-370510 | CCATGCGTAGGGATGGGGCCCAG | 0: 1 1: 0 2: 0 3: 7 4: 135 |
||
| Right | 1077008679 | 11:370502-370524 | GGGGCCCAGCTTGGGGAGCCTGG | 0: 1 1: 0 2: 2 3: 47 4: 435 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077008675 | Original CRISPR | CTGGGCCCCATCCCTACGCA TGG (reversed) | Intronic | ||