ID: 1077008676

View in Genome Browser
Species Human (GRCh38)
Location 11:370493-370515
Sequence CGTAGGGATGGGGCCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008676 27 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008663_1077008676 26 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008664_1077008676 14 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008669_1077008676 -2 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008676 Original CRISPR CGTAGGGATGGGGCCCAGCT TGG Intronic