ID: 1077008676

View in Genome Browser
Species Human (GRCh38)
Location 11:370493-370515
Sequence CGTAGGGATGGGGCCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008669_1077008676 -2 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008664_1077008676 14 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008662_1077008676 27 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008663_1077008676 26 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008676 Original CRISPR CGTAGGGATGGGGCCCAGCT TGG Intronic
900629723 1:3627926-3627948 GGTGGGGAAGGGCCCCAGCTGGG + Intronic
901812469 1:11775780-11775802 CATAGGGATGTGGCTCAGCTGGG - Intronic
902410460 1:16208760-16208782 CGGGGGGATGCGGCCCAGCAGGG - Exonic
903172202 1:21561208-21561230 CTTGGGGATGGGGCTCACCTTGG - Exonic
904355255 1:29934466-29934488 AGTAGGGATCAGCCCCAGCTGGG + Intergenic
904884360 1:33725242-33725264 CATGGGGATGGGGCCAAGCAGGG + Intronic
905800234 1:40838289-40838311 CCTGGGGACGGGGCGCAGCTGGG - Exonic
906749366 1:48245348-48245370 CCTTGGCATGGGGACCAGCTGGG - Intronic
908330627 1:63067534-63067556 GGTAGGTATGAGGCCCAGATGGG - Intergenic
909800142 1:79796689-79796711 TGTAGGGAAGGGGGCTAGCTTGG + Intergenic
911132287 1:94401289-94401311 CGTAGGCCTGGTGCCCAGCGTGG + Intergenic
912457265 1:109806458-109806480 AGAAGGGACAGGGCCCAGCTGGG - Intergenic
912508709 1:110174099-110174121 GGCAAGTATGGGGCCCAGCTGGG + Exonic
913255585 1:116950340-116950362 AGGAGGGATGGGGTCAAGCTGGG + Intronic
915363586 1:155300948-155300970 CAGAGGCATGAGGCCCAGCTGGG + Intronic
916188034 1:162152144-162152166 GATAGGGATGGGTCCCATCTGGG + Intronic
920444166 1:206003024-206003046 CGAAGAGCTGAGGCCCAGCTCGG - Intronic
922721848 1:227903596-227903618 CTTAGGGATGTGGCCCCCCTGGG + Intergenic
1063269980 10:4497426-4497448 AGTGGGGATGGGGCCCAGCTTGG - Intergenic
1063432047 10:5999516-5999538 TGTGGGGAGGGGGCCCGGCTTGG + Intergenic
1064301105 10:14123578-14123600 GGTAGTGAAGGGGCCCAGGTTGG + Intronic
1065136610 10:22677165-22677187 AGAAGGTATTGGGCCCAGCTGGG + Intronic
1067739818 10:48886949-48886971 CTTAGGGATGGAGCCCTCCTAGG + Intronic
1070987545 10:80701314-80701336 ACTAGGGCTGGGGCCCAGCCGGG - Intergenic
1072706826 10:97687090-97687112 CGTAGGTCGGCGGCCCAGCTCGG - Exonic
1073444833 10:103574444-103574466 TGTAGGGATGTGGCAGAGCTGGG + Intronic
1073512522 10:104051673-104051695 CTTAGGGAGGGGGTGCAGCTGGG + Intronic
1076383906 10:130043932-130043954 CTTAGGGTTGGGGCTCAGCCTGG + Intergenic
1076549218 10:131267294-131267316 AGTAGGGTTGGGGCCAAGCCTGG - Intronic
1076983550 11:218920-218942 AGCAGGGACGTGGCCCAGCTGGG - Exonic
1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG + Intronic
1077303729 11:1858674-1858696 CCTGGGGAAGGGGCCCTGCTGGG - Intronic
1077532271 11:3102973-3102995 GGTGGGGAAGGGGTCCAGCTTGG + Intronic
1077555907 11:3225944-3225966 CGTGGGGATGGGGCCAGGGTTGG + Intergenic
1078374276 11:10780402-10780424 TGTAGAGATGGGGCCTTGCTAGG - Intergenic
1081911077 11:46700461-46700483 CGAAGGGATGGGGTCCGGATGGG - Intronic
1081990809 11:47336659-47336681 CCCAGGGATGGGGCACAGCTTGG - Intronic
1086092687 11:83020322-83020344 AGCAGGGTTGGGGCCAAGCTCGG + Intronic
1089137917 11:116264237-116264259 GGGAGAGATGGGCCCCAGCTTGG + Intergenic
1090635744 11:128689673-128689695 CGTTGGGATGGGGCCAAGGTGGG - Intronic
1090902240 11:131043339-131043361 CTCAGGGATGGGGCACACCTGGG + Intergenic
1092057082 12:5516547-5516569 CCAGGGGATGGGGCCCGGCTGGG - Intronic
1092257905 12:6937163-6937185 CGTACGGTGGGGGCCCAGGTGGG - Exonic
1092280909 12:7097034-7097056 CGTGGGGGCGGGGCCCTGCTGGG - Exonic
1095925192 12:47571228-47571250 CTTAGGGCTGGGGCCTAGGTAGG - Intergenic
1096598631 12:52714231-52714253 CGGAGGGAAGGGGCCCCGCGGGG + Intergenic
1102561367 12:113764600-113764622 GGCAAGGATGGTGCCCAGCTGGG + Intergenic
1112586293 13:100721651-100721673 GGCAGCAATGGGGCCCAGCTGGG + Intergenic
1113789067 13:113017746-113017768 CATGGGGCTGGGGTCCAGCTGGG + Intronic
1114271166 14:21101142-21101164 CAAAGGGATGGGACCCAGCTGGG - Exonic
1119430984 14:74567832-74567854 CTGAGGAATGGGGCCCAGCTAGG - Intronic
1119565405 14:75624638-75624660 CTCAGGGATTGGGCCCTGCTGGG - Exonic
1121113086 14:91325754-91325776 CGTAGAGATGGGGCCTCGCTAGG + Intronic
1121351450 14:93176594-93176616 AGTAGTGGTGGGGCCCAACTGGG - Intergenic
1121581634 14:95036501-95036523 CATTGGGAAGGGGCCCAGCATGG - Intergenic
1122548543 14:102538171-102538193 CACAGGGAAGGGGCCCAGCCGGG + Intergenic
1125697804 15:41653521-41653543 CGTAGAGATGGGGTCTTGCTAGG - Intronic
1127382392 15:58441116-58441138 GGCAGGGGTGGGGCCCAGCAGGG + Intronic
1129267790 15:74403311-74403333 GGGAGGGACGGGTCCCAGCTGGG + Intergenic
1131360019 15:91782417-91782439 CGTTGGCATTGGGCCCATCTTGG - Intergenic
1132462251 16:61384-61406 CTTCTGGATCGGGCCCAGCTCGG - Exonic
1132574107 16:656879-656901 CGTGGGGCTGGTGGCCAGCTGGG - Intronic
1132620990 16:868245-868267 GGCAGGGATGGGGCCCCGCTGGG - Intronic
1133038879 16:3049481-3049503 ACTGGGGATGGAGCCCAGCTGGG + Intronic
1133271172 16:4611485-4611507 CGCTGGGATGGAGCCCTGCTGGG - Intronic
1134340001 16:13336053-13336075 TGAAGGGATGGGGTCCAGCGTGG + Intergenic
1135156831 16:20059860-20059882 TTTAGGGATGGGGCACACCTGGG - Intronic
1135282811 16:21167317-21167339 CGTAGGGATGAGGCTCAGGAAGG + Intronic
1136568836 16:31084978-31085000 CGTAGGGCTGGGGACCAGACCGG - Exonic
1138607325 16:58097441-58097463 GCTGGAGATGGGGCCCAGCTGGG + Intergenic
1141344918 16:83235478-83235500 GGTAGGAGTGGGGCCCGGCTAGG - Intronic
1141568230 16:84917913-84917935 GGCAGAGATGGGTCCCAGCTTGG + Intronic
1141881954 16:86866117-86866139 CGTGGGCATGGGGCCCAGGCTGG - Intergenic
1141982848 16:87560805-87560827 CCTGGGGATGGGGCCAAGCCTGG + Intergenic
1143306558 17:5952168-5952190 AGTCTGGATGTGGCCCAGCTGGG + Intronic
1144618685 17:16800604-16800626 TGTAGAGATGGGGCCCAGGCTGG - Intronic
1144735883 17:17555251-17555273 CGGAGGGATGGGGCCGAATTAGG + Intronic
1144770616 17:17757442-17757464 CGTAGGGGTGGGGGACAGCCTGG + Intronic
1144894020 17:18515091-18515113 TGTAGAGATGGGGCCCAGGCTGG + Intergenic
1145138211 17:20429170-20429192 TGTAGAGATGGGGCCCAGGCTGG - Intergenic
1146924547 17:36735320-36735342 GGGAGGAATGGAGCCCAGCTAGG - Intergenic
1147249419 17:39144133-39144155 GACAGGGAGGGGGCCCAGCTGGG + Intronic
1147778865 17:42925043-42925065 TGCAGGGATGGGCCACAGCTTGG - Intergenic
1151349073 17:73520860-73520882 CATAGAGATGGGGCTCAGATTGG + Intronic
1153139449 18:1954808-1954830 AGCAAGGATGGGGCCAAGCTAGG - Intergenic
1154334059 18:13452100-13452122 AGTAGGGACTGGGCCTAGCTAGG + Intronic
1162886350 19:13700274-13700296 CCTGGAGTTGGGGCCCAGCTGGG + Intergenic
1163245002 19:16087987-16088009 GGTGGGGATCGGGCTCAGCTGGG + Intronic
1163262093 19:16197617-16197639 CATAGGGCTGGGCCCCAGGTCGG + Intronic
1163421495 19:17215923-17215945 CTCAGGGAAGGGTCCCAGCTGGG - Intronic
1163496571 19:17649404-17649426 CCTGGGGTTGGGGGCCAGCTAGG - Intronic
1168145186 19:54416384-54416406 CCTGGGGAAGGGGCCCGGCTCGG + Intronic
925639594 2:5974716-5974738 ACTAGAGATTGGGCCCAGCTCGG + Intergenic
926308863 2:11659994-11660016 CACAGGGAGGGGGCCCAACTGGG - Intronic
927226104 2:20767377-20767399 AGTAGGGTTGGGGCCAAGCCTGG + Intronic
928942104 2:36736705-36736727 GATAGGGATTGGGCCCAGCAAGG - Intronic
930700951 2:54457110-54457132 CGCAGGGATGGGGCGGAGGTGGG - Intronic
930717112 2:54603555-54603577 CTTAGGAGTGGGTCCCAGCTGGG + Intronic
933901502 2:86853601-86853623 CCTAGAGATGGGGTTCAGCTTGG + Intronic
935268432 2:101413884-101413906 TGGGAGGATGGGGCCCAGCTCGG + Intronic
935326810 2:101945105-101945127 GGTGGGGAAGAGGCCCAGCTAGG - Intergenic
935622646 2:105143463-105143485 CGTGGGGATGGGTCCAGGCTGGG - Intergenic
940396346 2:153196427-153196449 AGTAGGAATGGGGCCAAGCCTGG - Intergenic
941508428 2:166376096-166376118 CGCAGGGCGGGGACCCAGCTAGG + Intergenic
1170740195 20:19049424-19049446 CGTAGACACGGGGCCCAGCCAGG + Intergenic
1172481680 20:35275235-35275257 GGCAGGGCTGTGGCCCAGCTGGG + Exonic
1173930167 20:46811420-46811442 CGCTTGAATGGGGCCCAGCTAGG + Intergenic
1176304661 21:5117078-5117100 CGCATGGACGGGGCCCAGCTAGG - Exonic
1179852393 21:44144952-44144974 CGCATGGACGGGGCCCAGCTAGG + Exonic
1180844314 22:18973084-18973106 GGCAGGGATGCTGCCCAGCTTGG + Intergenic
1180871586 22:19149941-19149963 CGCGGGGCTGGGGCCAAGCTCGG + Intronic
1181057157 22:20265627-20265649 GGCAGGGATGCTGCCCAGCTTGG - Intronic
1182964782 22:34510772-34510794 GGAAGGCATGGGGCTCAGCTTGG + Intergenic
1185333730 22:50262478-50262500 AGCAGGGATGGGGACCTGCTGGG + Intergenic
1185372385 22:50466932-50466954 GGTAGGGATGGGGCCTAGGTGGG + Intronic
949559355 3:5187877-5187899 CTTCGGGCTGGGGCCCAGCATGG + Exonic
950638431 3:14332575-14332597 TGTGGGGATGGGGCCCAGGGTGG + Intergenic
950679310 3:14574021-14574043 CTTCTGGATCGGGCCCAGCTCGG - Intergenic
950916082 3:16646630-16646652 CGTGGGGATGGGGCCAAGAGGGG + Intronic
953647994 3:44773321-44773343 CCTAGCCAAGGGGCCCAGCTAGG - Intronic
953801969 3:46031372-46031394 AGTAAGGTTGGGGCCAAGCTTGG + Intergenic
955346376 3:58164921-58164943 CTTAGAGAGGGGGCCAAGCTCGG - Intronic
968054272 3:195679234-195679256 TGTAGGGTTGGAGGCCAGCTGGG + Intergenic
968101615 3:195969912-195969934 TGTAGGGTTGGAGGCCAGCTGGG - Intergenic
969368716 4:6716691-6716713 CCTGGGGAAGGTGCCCAGCTCGG - Exonic
970477666 4:16440034-16440056 CGAAGGGGTGGGGCTCAGCTGGG - Intergenic
970671344 4:18400051-18400073 CCTAGGGGTGGGGCACAGCCGGG + Intergenic
975833072 4:78390593-78390615 AGAAGGCTTGGGGCCCAGCTTGG - Intronic
976815915 4:89148523-89148545 AGTAGGGTTGGGGCCAAGCCTGG - Intergenic
985500575 5:241896-241918 TGTAGGGTTGGAGGCCAGCTGGG + Intronic
985608132 5:870047-870069 GGTACGGATGGGCCCCAGGTGGG + Intronic
985667191 5:1187345-1187367 GGTGGGGAGGGGGCCCACCTCGG - Intergenic
985727831 5:1524981-1525003 GCTGAGGATGGGGCCCAGCTGGG - Intergenic
986376311 5:7135608-7135630 CTTTGGCATGGGGCCCAGTTTGG - Intergenic
992199053 5:74366464-74366486 CTCAGGAATGGGGTCCAGCTAGG - Intergenic
998106976 5:139474956-139474978 GGGAGGGAAGGAGCCCAGCTTGG + Intergenic
998383546 5:141742747-141742769 TGGAGGGATGAGGCCCAGCAGGG + Intergenic
1002414344 5:179111589-179111611 CTTTGGGAAGAGGCCCAGCTGGG - Exonic
1003525572 6:6894016-6894038 CGTGGGGGTGGGGCCCAGCAAGG - Intergenic
1003985175 6:11428031-11428053 CGTGGGAATGGGGCCCACCCGGG + Intergenic
1004121045 6:12822426-12822448 AGGAGGGCTGGGGCCCAGCCAGG + Intronic
1005928628 6:30464691-30464713 CGCAGGGTTGGGGCCCAGGAGGG + Intergenic
1006400405 6:33814127-33814149 TGGTGGGATGGGGCACAGCTGGG - Intergenic
1006667932 6:35710980-35711002 GGTAGGGATGGGCCCTTGCTTGG + Intronic
1007336262 6:41157194-41157216 GGCAGGGTTGGGGCACAGCTGGG + Intergenic
1012052358 6:94361653-94361675 AGCAGGGTTGGGGCCGAGCTTGG - Intergenic
1017559052 6:155607080-155607102 CGTAGAGATGGAGTCCTGCTAGG - Intergenic
1019486727 7:1292833-1292855 AGTAGGGATGGGGCTCTGCCAGG + Intergenic
1026716660 7:72795150-72795172 CGTAGGGTTTGGGAGCAGCTGGG - Intronic
1027461253 7:78456708-78456730 CGTAGGGATGGGAGCAAGCCAGG + Intronic
1028838051 7:95396424-95396446 CGTACGGATTGGGGCCCGCTCGG + Intergenic
1028985681 7:97006590-97006612 CGGCGGGAAGGGGCCCGGCTGGG - Intronic
1034451259 7:151138424-151138446 CCAAGGGGTGGGGCCCAGCTGGG + Intronic
1036455620 8:8904155-8904177 CCTAGGTGTGGGGCACAGCTTGG - Intergenic
1039301585 8:36215020-36215042 CGTAGGGAGAGGGTCCAGGTGGG - Intergenic
1039579335 8:38651114-38651136 CCGAGGCTTGGGGCCCAGCTCGG - Intergenic
1040676524 8:49757276-49757298 CATAGGGCTGTGGCTCAGCTAGG + Intergenic
1041873406 8:62660884-62660906 CCAAGGGATGGTCCCCAGCTGGG - Intronic
1043743147 8:83839644-83839666 ATTAGGGATGGGACCCAGCCGGG + Intergenic
1044983856 8:97741096-97741118 TGTAGAGATGGTGCCCAGGTTGG + Intergenic
1049680502 8:143915882-143915904 GGGTGGGCTGGGGCCCAGCTTGG + Exonic
1059161736 9:112041338-112041360 TCCAGGAATGGGGCCCAGCTGGG + Exonic
1061008453 9:127941741-127941763 AGCAGCGCTGGGGCCCAGCTGGG - Exonic
1062282202 9:135757095-135757117 GGTGGGGGTGGGGCCCAGCAGGG - Intronic
1187452016 X:19406551-19406573 CCTAGGGCTGGGGCCAAGATGGG + Intronic
1190732499 X:53234762-53234784 CGGTGGAATGGAGCCCAGCTGGG + Exonic