ID: 1077008677

View in Genome Browser
Species Human (GRCh38)
Location 11:370494-370516
Sequence GTAGGGATGGGGCCCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008669_1077008677 -1 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008662_1077008677 28 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008663_1077008677 27 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008664_1077008677 15 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008677 Original CRISPR GTAGGGATGGGGCCCAGCTT GGG Intronic
900196787 1:1380731-1380753 GCAGGGCTGGGGCCCTGCATGGG - Intergenic
901812468 1:11775779-11775801 ATAGGGATGTGGCTCAGCTGGGG - Intronic
902429942 1:16354999-16355021 GTAGGGATGGGGTCTTGCTATGG - Intronic
902626205 1:17677894-17677916 GCAGTGATGGCGCCCAGCCTGGG - Intronic
904765675 1:32844653-32844675 GTAGAGATGGTCTCCAGCTTTGG + Intronic
906493459 1:46286025-46286047 CTCGGGATGGGGCCCGGCCTCGG + Exonic
908330626 1:63067533-63067555 GTAGGTATGAGGCCCAGATGGGG - Intergenic
909472497 1:76044040-76044062 ATAGGCATGGGGCGCAGCTCTGG + Intergenic
911132288 1:94401290-94401312 GTAGGCCTGGTGCCCAGCGTGGG + Intergenic
912508710 1:110174100-110174122 GCAAGTATGGGGCCCAGCTGGGG + Intronic
912829351 1:112937996-112938018 GCAGGTATGGAGCACAGCTTCGG - Intronic
913674877 1:121131219-121131241 GTAGGCAAGGGGTACAGCTTAGG + Intergenic
915013649 1:152713236-152713258 GAAGGGAAGGGACCCAGATTTGG + Intergenic
915367127 1:155322901-155322923 GCGGGGCTGGGGCCCGGCTTCGG - Exonic
916704748 1:167337652-167337674 GTAGAGATGGGGTCCAGCTATGG - Intronic
916730032 1:167557872-167557894 GTGGGGATGGGGACCAGTGTAGG - Intergenic
917295234 1:173511835-173511857 GTAAGGAAGGGGTCCAGTTTTGG + Intronic
917772364 1:178293667-178293689 GTAGAGATGGGGGCCATTTTAGG - Intronic
918447888 1:184632937-184632959 CTGGGCATGGGGCCCAGCATTGG + Intergenic
921800332 1:219395801-219395823 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
922363526 1:224843838-224843860 GTACAGATGGGACACAGCTTAGG + Intergenic
922753490 1:228082038-228082060 GTGGGGGTGGGGCCCAGGGTTGG - Intergenic
922815599 1:228446687-228446709 GGTGGGTTGGGGCCCAGCGTTGG + Intergenic
1062907527 10:1188951-1188973 GGAGGGCTGGGCCCCAGCGTGGG - Intronic
1065136611 10:22677166-22677188 GAAGGTATTGGGCCCAGCTGGGG + Intronic
1067721894 10:48733678-48733700 CTGGGGATGGGACCCAGCATGGG + Intronic
1067808936 10:49412231-49412253 GGAGGTATGGGGGCCAGCTTAGG - Intergenic
1067898709 10:50215251-50215273 GTAAGGAAGGGGTCCAGTTTCGG + Intronic
1068404246 10:56569734-56569756 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
1069821854 10:71233372-71233394 CTAGGGATGCGGCTCAGCATTGG - Intronic
1071576485 10:86730373-86730395 GCTGGCATGGGTCCCAGCTTAGG - Intronic
1074138725 10:110651778-110651800 GGAAGCATGAGGCCCAGCTTTGG - Intronic
1075761940 10:124863878-124863900 GTAGGGCTGGGGCCCATCCCCGG + Intergenic
1076383907 10:130043933-130043955 TTAGGGTTGGGGCTCAGCCTGGG + Intergenic
1076452568 10:130566962-130566984 GTAGGGAGGGGTCACAGATTTGG - Intergenic
1076549217 10:131267293-131267315 GTAGGGTTGGGGCCAAGCCTGGG - Intronic
1076983549 11:218919-218941 GCAGGGACGTGGCCCAGCTGGGG - Exonic
1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG + Intronic
1077496562 11:2889601-2889623 GTAGGGATTGGGCCTAACCTAGG - Intronic
1077532272 11:3102974-3102996 GTGGGGAAGGGGTCCAGCTTGGG + Intronic
1077555908 11:3225945-3225967 GTGGGGATGGGGCCAGGGTTGGG + Intergenic
1077600068 11:3568482-3568504 GTAGAGATCAGGCCCAGCTTTGG - Intergenic
1079502825 11:21121075-21121097 CTGGGGTTGGGACCCAGCTTTGG + Intronic
1081674359 11:44960002-44960024 CGAGGGATGTGGCCCAACTTCGG - Intergenic
1081990807 11:47336658-47336680 CCAGGGATGGGGCACAGCTTGGG - Intronic
1083326638 11:61876329-61876351 GCAGGGGTGGGGCCCATCCTGGG - Intronic
1084681368 11:70668388-70668410 GGAGTGATGTGGCCCAGCTGAGG + Intronic
1084863253 11:72036239-72036261 GTAGGGTTGAAGGCCAGCTTTGG - Intronic
1085483553 11:76842644-76842666 GTGGGGAAGGGTGCCAGCTTGGG + Intergenic
1085527946 11:77174941-77174963 GGAGGGGAGGGTCCCAGCTTTGG + Intronic
1086092688 11:83020323-83020345 GCAGGGTTGGGGCCAAGCTCGGG + Intronic
1088802401 11:113318251-113318273 GTAGGGATCTAACCCAGCTTTGG + Intronic
1089364738 11:117914784-117914806 GTGGAGATGGGGACCACCTTGGG + Intronic
1089375008 11:117987995-117988017 GTGTGGATGGGGCCAAGCCTAGG + Intronic
1091391005 12:125944-125966 GTGGTGAAGGGGCCCTGCTTTGG + Intronic
1091435503 12:469620-469642 TTAGGGGTGGGGGCCAGGTTAGG + Intronic
1092210042 12:6640023-6640045 GTAGGGATGGGGCTGAGCTTTGG + Intronic
1092614928 12:10208263-10208285 GAAGTAATGGGGCTCAGCTTTGG - Intergenic
1092911494 12:13148993-13149015 GAATTGATGGGGCACAGCTTGGG - Intergenic
1092945566 12:13450908-13450930 GTAGGGAGGGCATCCAGCTTAGG - Intergenic
1094759454 12:33513750-33513772 GTAGGGAAGGAGTCCAGCTTCGG + Intergenic
1095747382 12:45674922-45674944 TGAGGGATGGGGCCCAGCTTAGG + Intergenic
1097222638 12:57460056-57460078 GGAGGGCTGGGGGCCAGGTTGGG + Intergenic
1097688833 12:62715260-62715282 GGGAGGATGGGCCCCAGCTTGGG + Intronic
1105604338 13:21914349-21914371 GTGGGGATGGGGTCCAGGTGAGG + Intergenic
1107219376 13:37963241-37963263 ATAGGGATGGGTGCCATCTTTGG - Intergenic
1108099725 13:46942037-46942059 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
1111843009 13:93473399-93473421 GTGGGGTTGGGGCCAAGCATGGG - Intronic
1112586294 13:100721652-100721674 GCAGCAATGGGGCCCAGCTGGGG + Intergenic
1112812689 13:103236462-103236484 GTGGAGATGGGCCCCAGCTCTGG + Intergenic
1113224477 13:108144339-108144361 GTAGGGTAGGAGCCCAACTTAGG + Intergenic
1114059423 14:19006102-19006124 GTAAGGAAGTGGCCCAGTTTCGG - Intergenic
1114103125 14:19395649-19395671 GTAAGGAAGTGGCCCAGTTTCGG + Intergenic
1117252363 14:53950452-53950474 GTGGGAATTGGGCCCAGCTCCGG - Exonic
1119430983 14:74567831-74567853 TGAGGAATGGGGCCCAGCTAGGG - Intronic
1121249582 14:92489629-92489651 GTGGGTCTGGGGCACAGCTTGGG - Intronic
1121315655 14:92959610-92959632 GCAGGGTGGGGGCCCAGCCTCGG - Intronic
1121899424 14:97679660-97679682 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
1122427569 14:101620666-101620688 GTGGGGGTGGGGACCAGCCTGGG + Intergenic
1123122644 14:105925124-105925146 CTAGGGATGGAGCAGAGCTTGGG + Intronic
1123488174 15:20759517-20759539 GGAGGGATGGAGTCCAGCTCAGG + Intergenic
1123544673 15:21328590-21328612 GGAGGGATGGAGTCCAGCTCAGG + Intergenic
1125728613 15:41880710-41880732 GTAGGAAGGGGGCCCAGCGGAGG - Intronic
1129035482 15:72646237-72646259 TAAGGGATGGGAACCAGCTTGGG + Intergenic
1129154669 15:73710422-73710444 GTAAGCTGGGGGCCCAGCTTGGG + Intronic
1129214402 15:74090979-74091001 TAAGGGATGGGAACCAGCTTGGG - Intergenic
1129452025 15:75656463-75656485 CTAGGAAAGGTGCCCAGCTTGGG + Intronic
1129473301 15:75766927-75766949 TGAGGGATGGGAACCAGCTTGGG - Intergenic
1130332443 15:82932902-82932924 GGTGGGAGGGAGCCCAGCTTTGG - Intronic
1132028012 15:98419426-98419448 GCATGGGTGGGGACCAGCTTGGG + Intergenic
1132287505 15:100674750-100674772 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
1202953015 15_KI270727v1_random:55861-55883 GGAGGGATGGAGTCCAGCTCAGG + Intergenic
1132620989 16:868244-868266 GCAGGGATGGGGCCCCGCTGGGG - Intronic
1132742697 16:1423244-1423266 GTAGGGTAGAGGCCCAACTTAGG - Intergenic
1132786406 16:1659071-1659093 GCAGGGATGAAGCCCAACTTTGG - Intronic
1132885864 16:2181676-2181698 CTGGGCTTGGGGCCCAGCTTGGG + Intronic
1135413853 16:22254282-22254304 GTAGGGATGGGACCAGCCTTTGG + Intronic
1136315036 16:29449443-29449465 CTAGGGATGGGGCTCAGCAGAGG + Intronic
1136429613 16:30188782-30188804 CTAGGGATGGGGCTCAGCAGAGG + Intronic
1139938769 16:70590188-70590210 GCCGTGATGGGGCCCTGCTTGGG + Intronic
1140595193 16:76400722-76400744 GTAAGGAAGGGGTCCAGTTTCGG + Intronic
1141138611 16:81482791-81482813 GTTGGGAACGGGCTCAGCTTAGG - Intronic
1141881953 16:86866116-86866138 GTGGGCATGGGGCCCAGGCTGGG - Intergenic
1142020978 16:87782383-87782405 GTAGGAGTGGGCCCCAGCATAGG - Intergenic
1142145180 16:88489935-88489957 GGAGGGAGGGGGCCCAGCAGAGG + Intronic
1142748092 17:1970554-1970576 GGAGGGATGGGGGCCATCTTTGG + Intronic
1146095402 17:29925537-29925559 GTAGAGATGGGGACTTGCTTGGG - Intronic
1146309778 17:31758790-31758812 ACAGAGATGGGGCCCAACTTGGG - Intergenic
1146891305 17:36508099-36508121 GTAGAGATGGGAGCCACCTTGGG - Intronic
1146924546 17:36735319-36735341 GGAGGAATGGAGCCCAGCTAGGG - Intergenic
1147249420 17:39144134-39144156 ACAGGGAGGGGGCCCAGCTGGGG + Intronic
1147778864 17:42925042-42925064 GCAGGGATGGGCCACAGCTTGGG - Intergenic
1148524604 17:48319339-48319361 ATAGGGATTGGGACCAGCCTGGG + Intronic
1149566128 17:57641960-57641982 GTAGGGCTGGGGGCCAGCGTCGG + Intronic
1150500298 17:65644120-65644142 GCAGTGATGGGGCCAAGATTGGG - Intronic
1151540628 17:74763057-74763079 GCCGGGGTGGGGCCCAGCCTGGG - Intronic
1152760804 17:82106136-82106158 GCTGGGATGGGGCCCACATTGGG - Intronic
1152938621 17:83154328-83154350 GTCAGGAAGGGCCCCAGCTTGGG + Intergenic
1153139448 18:1954807-1954829 GCAAGGATGGGGCCAAGCTAGGG - Intergenic
1153678767 18:7480341-7480363 GTAGGCTTTGGGCCCAGTTTGGG + Intergenic
1153686755 18:7553870-7553892 GTAAGGAAGGGGTCCAGTTTCGG + Intergenic
1154381799 18:13858473-13858495 GTAAGGAAGGGGTCCAGTTTCGG + Intergenic
1157280875 18:46345511-46345533 GCAGGGATGGGGCCTGACTTAGG - Intronic
1160523587 18:79522706-79522728 GAAGGGACGGGGGCCAGATTTGG + Intronic
1160976682 19:1796269-1796291 GTAGGGAGGGGGGCCATTTTGGG + Intronic
1161605744 19:5214004-5214026 GCAGGGCTGGGGCCCTGCTGAGG + Intronic
1161679569 19:5673127-5673149 GTAAGGATGGGGACCAGATTTGG - Intergenic
1161707634 19:5829519-5829541 GAGGGGAGGGGGCCCAGCTAAGG - Intergenic
1162968117 19:14165337-14165359 GTGGGGGTGGGGACCGGCTTGGG - Intronic
1163144225 19:15369886-15369908 GTGGGGATGGGGGGCAGCCTTGG - Intronic
1164580083 19:29429558-29429580 GCAGGCATGGGGCCCAGGTCTGG - Intergenic
1165893945 19:39130398-39130420 GGAGGCATGTGGCCCAGCGTGGG + Intronic
925102694 2:1262335-1262357 GGAAGGATGGAGCCCAGCCTTGG - Intronic
926958925 2:18332640-18332662 GTGGGGCTGGGGCCAAGCTCAGG - Intronic
928716481 2:34066838-34066860 GTAGCAATGGGGCCCAGAGTTGG + Intergenic
928964945 2:36966718-36966740 GTAGGGCTGTGCCTCAGCTTGGG + Intergenic
929241194 2:39655407-39655429 GTAAGGAAGGGGTCCAGTTTTGG - Intergenic
930035027 2:47079968-47079990 GTGGGGATGGGCCCCACCTCAGG - Intronic
934042346 2:88138231-88138253 GTAGGGATGGGTCCATGCTCTGG - Intergenic
934885421 2:98020503-98020525 GTTGGAATGAGGGCCAGCTTGGG - Intergenic
935268433 2:101413885-101413907 GGGAGGATGGGGCCCAGCTCGGG + Intronic
935327834 2:101954015-101954037 GTAGGGATGGGGCCCAGGCATGG + Intergenic
935397809 2:102626379-102626401 GTAAGGAAGGGATCCAGCTTTGG - Intronic
936993129 2:118387012-118387034 GGTGGGGTGGGGCCCAGCATCGG - Intergenic
938741453 2:134236308-134236330 GAAGGGATGAGACCCAGTTTAGG + Intronic
942097571 2:172548099-172548121 GGGGGGCTGGGGCCCAGCCTGGG + Intergenic
943466679 2:188237031-188237053 GTAGGTGTGGGGCCTAGCCTAGG - Intergenic
943814729 2:192238168-192238190 GTAAGGAAGGGACCCAGTTTTGG + Intergenic
944841678 2:203629897-203629919 GTAAGGCTGGGACCCAGCCTGGG + Intergenic
945845474 2:214939146-214939168 GTAAGGAAGGGGTCCAGTTTCGG + Intronic
946374374 2:219299259-219299281 GTGGGGCTGGGGCCAAGCCTGGG + Intronic
948473017 2:238197674-238197696 CTGGGGATGGGGCTCAGTTTGGG - Intronic
1169136389 20:3200312-3200334 GGAGGGATGGGGTGCAGCTCTGG - Intronic
1173154991 20:40601125-40601147 TGAGGGCTGGGCCCCAGCTTGGG + Intergenic
1174873669 20:54206163-54206185 GGAGGGGTGGGGGCCAGCTCTGG - Intergenic
1175271387 20:57736556-57736578 GTGGGGATGGAGCCAAGCTTAGG + Intergenic
1175701485 20:61140827-61140849 GTCGGCAGGGGGGCCAGCTTGGG + Intergenic
1175785459 20:61709026-61709048 GTGGGGCTGCGGCCCAGCTCAGG + Intronic
1175915127 20:62422606-62422628 GTGGGGATGGGGCCCGGAGTGGG + Intronic
1175915138 20:62422624-62422646 GTGGGGATGGGGCCCGGGGTGGG + Intronic
1175986460 20:62766291-62766313 GCAGGGCTGGGGCGCAGGTTGGG + Intergenic
1176177485 20:63735565-63735587 GTACGTGTGGGGCCCAGCTCAGG + Intronic
1176804364 21:13464940-13464962 CTAGGCAGGGGTCCCAGCTTGGG + Intergenic
1177062995 21:16396714-16396736 GCAGAGATGGGACGCAGCTTAGG + Intergenic
1180048538 21:45320870-45320892 GCTGGGGTGGGGCTCAGCTTGGG + Intergenic
1180477903 22:15728717-15728739 GTAAGGAAGTGGCCCAGTTTCGG - Intergenic
1180844315 22:18973085-18973107 GCAGGGATGCTGCCCAGCTTGGG + Intergenic
1181057156 22:20265626-20265648 GCAGGGATGCTGCCCAGCTTGGG - Intronic
1182204974 22:28614751-28614773 GTAAGGAAGGGGTCCAGTTTCGG - Intronic
1182403261 22:30100392-30100414 GTAAGGAAGGGGTCCAGTTTCGG - Intronic
1182964783 22:34510773-34510795 GAAGGCATGGGGCTCAGCTTGGG + Intergenic
1183575871 22:38688718-38688740 GTAGGGAAGATGCCCAGCCTGGG - Intronic
1184892087 22:47386314-47386336 GTAGGGACGGAGCCCCGTTTTGG + Intergenic
1184892317 22:47387572-47387594 GTAGGGACGGAGCCCCGTTTTGG + Intergenic
1185099291 22:48828901-48828923 GTGGGGATGGGGCCCACTCTGGG + Intronic
1185333731 22:50262479-50262501 GCAGGGATGGGGACCTGCTGGGG + Intergenic
949559356 3:5187878-5187900 TTCGGGCTGGGGCCCAGCATGGG + Exonic
951137682 3:19122857-19122879 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
953801970 3:46031373-46031395 GTAAGGTTGGGGCCAAGCTTGGG + Intergenic
954495058 3:50950575-50950597 CTAGGTATGGGTCTCAGCTTGGG - Intronic
954753658 3:52827518-52827540 GTGGGAATGTGGGCCAGCTTCGG - Intronic
957698665 3:83680063-83680085 GTAAGGAAGGGGTCCAGTTTTGG - Intergenic
960177750 3:114536946-114536968 GTAAGGAAGGGGTCCAGTTTCGG - Intronic
965058728 3:163754864-163754886 GTAAGGAAGGGGTCCAACTTCGG - Intergenic
966140772 3:176753161-176753183 GTAGGGATGCGCCACACCTTTGG + Intergenic
966781361 3:183587151-183587173 GTAGAGATGGGGCCTTGCTATGG - Intergenic
969703726 4:8781180-8781202 GATGGGCTGGGGCCCAGCTCAGG - Intergenic
969739456 4:9013606-9013628 GTAGAAATCAGGCCCAGCTTTGG + Intergenic
969763128 4:9205306-9205328 GTAAGGAAGTGGCCCAGTTTTGG - Intergenic
975065369 4:70056345-70056367 GTAAGGAAGGGGTCCAGTTTCGG - Intronic
975212512 4:71717610-71717632 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
976769869 4:88639544-88639566 GTAGGGAAGGGGTCCAGTTTTGG - Intronic
978190601 4:105906742-105906764 GCAGGGATAGGGCCCCGCCTAGG + Intronic
980983349 4:139672459-139672481 GGAGGGATGGAGCCCAGGGTTGG + Intronic
984982076 4:185291866-185291888 GTAGGTATGGGGGGCAGATTAGG + Intronic
985727830 5:1524980-1525002 CTGAGGATGGGGCCCAGCTGGGG - Intergenic
989122200 5:38016047-38016069 CTAGAGATGGGGCCCAGTTATGG + Intergenic
989777408 5:45225853-45225875 GCAGGGCTGGGGACCTGCTTGGG + Intergenic
995768823 5:115647924-115647946 GTAAGGATGCAGCTCAGCTTAGG + Intergenic
1000653996 5:163853917-163853939 GTAAGGAAGGGGTCCAGTTTTGG - Intergenic
1001930737 5:175671095-175671117 GTGGGGATGGGGCAGTGCTTTGG + Intronic
1002068632 5:176665237-176665259 GTGGGGATAGGGCCCAGTCTAGG + Intergenic
1002885387 6:1289362-1289384 GGGGGATTGGGGCCCAGCTTGGG + Intergenic
1003122370 6:3328882-3328904 GGAGGGAGGGGGTGCAGCTTCGG - Intronic
1003202763 6:3977436-3977458 GCAGGGATGGAGCTGAGCTTAGG - Intergenic
1005152895 6:22772867-22772889 GAAGGGAGGGGGCCAATCTTGGG + Intergenic
1006109100 6:31734237-31734259 GCAGTGATGGGGCCAAGATTGGG - Exonic
1006400404 6:33814126-33814148 GGTGGGATGGGGCACAGCTGGGG - Intergenic
1006667933 6:35710981-35711003 GTAGGGATGGGCCCTTGCTTGGG + Intronic
1006730235 6:36230874-36230896 GTGGGGCTTGGGCCCAGCTTAGG + Exonic
1007630354 6:43269947-43269969 GGAGGGGGGGGGCCCAGCCTAGG - Intronic
1009783543 6:68300820-68300842 GTAAGGAAGGGGTCCAGTTTCGG + Intergenic
1012734054 6:102916432-102916454 GTAAGGAAGGGGTCCAGTTTCGG + Intergenic
1015886812 6:137926175-137926197 AGGGGGATGGGGCCCAGCTTCGG + Intergenic
1016013443 6:139161465-139161487 ACAGGGATGGGGCACAGCTGTGG + Intronic
1019805270 7:3118985-3119007 GCTGGGGTGGAGCCCAGCTTGGG + Intergenic
1020035001 7:4959278-4959300 GGAGGGAGGGGGCCGGGCTTAGG - Intergenic
1020120975 7:5503170-5503192 CAAGGGATGGAGACCAGCTTGGG + Intronic
1023114316 7:36846576-36846598 GTAAGGAAGGGGTCCAGTTTTGG - Intergenic
1024518822 7:50284955-50284977 GTAGGCTTGGGGCCCAGCCCAGG + Intergenic
1024759723 7:52581354-52581376 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
1027239662 7:76318628-76318650 GTAGGGAGGGGGCCCAGACCTGG + Intergenic
1029111987 7:98217346-98217368 GCAGGGACGGTGCCCAGTTTGGG - Exonic
1029121814 7:98273337-98273359 GTAGAGATGGGGGCCAGGCTCGG + Intronic
1030043968 7:105477990-105478012 GTAGAGATGGGGCCTTGCTATGG + Intronic
1034431911 7:151045390-151045412 TTAGGGCTGGGGCTCAGCCTGGG + Exonic
1034483440 7:151341367-151341389 TTAGGGAAGGGGTCCAGCCTAGG + Intergenic
1034544439 7:151780792-151780814 GCAGGCATGGAGCCAAGCTTAGG - Intronic
1035366363 7:158351330-158351352 TCAGGGATGGGGCCCAACTGAGG - Intronic
1036273284 8:7327237-7327259 GTAAGGAAGGGGTCCAGTTTTGG - Intergenic
1036348064 8:7983115-7983137 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
1036864724 8:12385906-12385928 GTAAGGAAGGGGTCCAGTTTTGG + Intergenic
1039737827 8:40351290-40351312 GGAGGGAGGGGGACCAGGTTTGG - Intergenic
1040614186 8:49018287-49018309 GGAGGGATGGGGTCAAGGTTAGG + Intergenic
1041020943 8:53637861-53637883 GTAAGGAAGGGGTCCAGTTTCGG + Intergenic
1041729732 8:61051866-61051888 AGTGGGATGGGGCCCAGCGTGGG - Intergenic
1042227098 8:66522547-66522569 GGAGGGCTGGGGCTCAGCTAAGG - Intergenic
1045365736 8:101474295-101474317 GGAGGGTTGGGGCCCCTCTTAGG + Intergenic
1047889530 8:129292546-129292568 TTAAGGATGGGGGCCAGCTTTGG + Intergenic
1048721209 8:137327475-137327497 GAAGGGATGGGGCACAGCAGAGG - Intergenic
1049680503 8:143915883-143915905 GGTGGGCTGGGGCCCAGCTTGGG + Exonic
1050339374 9:4620453-4620475 GTAGGGCTGGGGTGGAGCTTAGG - Intronic
1053033181 9:34800625-34800647 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
1057759323 9:97859938-97859960 ATGGGGAAGGGGCCCAGATTGGG + Intergenic
1061008452 9:127941740-127941762 GCAGCGCTGGGGCCCAGCTGGGG - Exonic
1062282201 9:135757094-135757116 GTGGGGGTGGGGCCCAGCAGGGG - Intronic
1193201469 X:78696628-78696650 GTAAGGAAGGGGTCCAGTTTCGG - Intergenic
1195326842 X:103765157-103765179 GCACAGATGGGGCACAGCTTAGG + Intergenic
1200137435 X:153882004-153882026 GCAGGGAAGGAGCCCAGCCTGGG + Intronic