ID: 1077008678

View in Genome Browser
Species Human (GRCh38)
Location 11:370495-370517
Sequence TAGGGATGGGGCCCAGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008664_1077008678 16 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008669_1077008678 0 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008662_1077008678 29 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008663_1077008678 28 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008678 Original CRISPR TAGGGATGGGGCCCAGCTTG GGG Intronic
900196786 1:1380730-1380752 CAGGGCTGGGGCCCTGCATGGGG - Intergenic
900430298 1:2598191-2598213 CAGGGAAGGGGCTCACCTTGCGG + Exonic
900661507 1:3786777-3786799 TCAGGATGTGTCCCAGCTTGCGG + Intronic
900977513 1:6026596-6026618 TAGGGATTGGCCTCAGCCTGGGG + Intronic
901040761 1:6361840-6361862 TAGGGAGGGGCCACAGCTTCTGG - Intronic
903336161 1:22626245-22626267 TAGGGGTGGGGCTCACCTTGAGG - Intergenic
905036052 1:34918886-34918908 TAGGGCCGGGGCCAAGCTAGAGG + Intronic
905316958 1:37088652-37088674 TAGGGAGGGGGCACAGCCTCAGG + Intergenic
906409382 1:45566743-45566765 TAGGGCTGGGGCCCAGCTGGAGG + Intronic
906493460 1:46286026-46286048 TCGGGATGGGGCCCGGCCTCGGG + Exonic
907170890 1:52463572-52463594 TTGGGGTGAGGCCCAGCTTCTGG - Intronic
908330625 1:63067532-63067554 TAGGTATGAGGCCCAGATGGGGG - Intergenic
914438542 1:147681432-147681454 GAGGCATGGGGGCCAGCTAGAGG - Intergenic
1063299548 10:4839608-4839630 TAGCCATGGGGCCCAGCTCCAGG - Intronic
1063604025 10:7507369-7507391 TTGGGATGGGGGCCAGATTGTGG + Intergenic
1065978046 10:30860908-30860930 GGGGGATGGGGCCCAGAGTGGGG + Intronic
1067241986 10:44505295-44505317 TAGGAATGGGGCCAGACTTGGGG + Intergenic
1067294743 10:44968859-44968881 TTGGGAGGGGGCACAGCCTGGGG - Intronic
1067721895 10:48733679-48733701 TGGGGATGGGACCCAGCATGGGG + Intronic
1067808935 10:49412230-49412252 GAGGTATGGGGGCCAGCTTAGGG - Intergenic
1070851172 10:79562596-79562618 GAGGGAGGTGGCCCAGCATGGGG - Intergenic
1071479431 10:86053782-86053804 TAGGGATGGGGGCCAGCATGTGG - Intronic
1071719027 10:88124041-88124063 TAGGGTGGGGACCGAGCTTGTGG + Intergenic
1072518931 10:96213268-96213290 GAGGGATCTGTCCCAGCTTGGGG + Intronic
1072740919 10:97908596-97908618 TAGGGATAGGTCCCAGCTATAGG + Intronic
1073597113 10:104812214-104812236 TAAGGATGGGGCCTAGCTAGTGG - Intronic
1074751579 10:116592039-116592061 TAGGTCTGGGGGGCAGCTTGAGG - Intronic
1076983548 11:218918-218940 CAGGGACGTGGCCCAGCTGGGGG - Exonic
1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG + Intronic
1077532273 11:3102975-3102997 TGGGGAAGGGGTCCAGCTTGGGG + Intronic
1077555909 11:3225946-3225968 TGGGGATGGGGCCAGGGTTGGGG + Intergenic
1077995090 11:7446055-7446077 TGGGGCTGGTTCCCAGCTTGGGG - Intronic
1078133037 11:8629096-8629118 TAGGAATGAAGCCCAGCTTAAGG + Intronic
1079224772 11:18595750-18595772 TAAGGAGAGGGCCCAGCCTGCGG + Intergenic
1079308271 11:19343854-19343876 TAGGAAGGGGGCCCAGCTGTAGG - Intergenic
1083434526 11:62633468-62633490 GGGCGATGGGGCCCAGCCTGAGG - Exonic
1084323621 11:68386842-68386864 TGGGGGTGGGGCCCAGCTGCCGG - Intronic
1085013691 11:73158651-73158673 TTGTGATGGGGCCCAGTGTGGGG - Intergenic
1085184600 11:74564855-74564877 TAGGGGCTGGGCCCAGCTTTTGG + Intronic
1085483554 11:76842645-76842667 TGGGGAAGGGTGCCAGCTTGGGG + Intergenic
1087252442 11:95918259-95918281 TAGGGGTGGAGCCCAGCTGTTGG - Intronic
1090902242 11:131043341-131043363 CAGGGATGGGGCACACCTGGGGG + Intergenic
1092210043 12:6640024-6640046 TAGGGATGGGGCTGAGCTTTGGG + Intronic
1092911493 12:13148992-13149014 AATTGATGGGGCACAGCTTGGGG - Intergenic
1094272750 12:28635691-28635713 TGGAGATGGTGCCCAGTTTGAGG + Intergenic
1096497360 12:52046137-52046159 TAGGGGTGGGGCCCAGCCCAAGG + Intronic
1097222639 12:57460057-57460079 GAGGGCTGGGGGCCAGGTTGGGG + Intergenic
1097688834 12:62715261-62715283 GGAGGATGGGCCCCAGCTTGGGG + Intronic
1100522606 12:95389726-95389748 TAGGGATGGGTCTCAGGCTGAGG - Intergenic
1101198245 12:102407779-102407801 TACAAATGGGTCCCAGCTTGTGG - Intronic
1104784576 12:131441181-131441203 TAGGGGTGGGGCCAAGATGGAGG - Intergenic
1105302678 13:19150309-19150331 GAGGGCTGAGGCCCAGCTGGTGG - Intergenic
1107219375 13:37963240-37963262 TAGGGATGGGTGCCATCTTTGGG - Intergenic
1108252765 13:48583380-48583402 TAGAGATGGGGGCAATCTTGGGG - Intergenic
1108609605 13:52071211-52071233 AAGGGAGGGGTCCCAGGTTGGGG + Intronic
1113118944 13:106905801-106905823 TAAGGAAGAGGCCCAGCCTGTGG - Intergenic
1117786455 14:59291006-59291028 TAGGCATGGGGCACAGCAAGAGG - Intronic
1118257243 14:64215817-64215839 TAGGGATGGGGCTAAGGATGAGG - Intronic
1119502192 14:75138943-75138965 AAGGGATTGGGAACAGCTTGTGG - Intronic
1119565403 14:75624636-75624658 CAGGGATTGGGCCCTGCTGGGGG - Exonic
1121337415 14:93085873-93085895 TAGGGATGGGACCTAAATTGTGG + Intronic
1121789350 14:96687266-96687288 AAGGGATGGGCCCCACCTCGGGG - Intergenic
1122761746 14:104033751-104033773 GAGGGCTGAGGACCAGCTTGAGG + Intronic
1123001815 14:105299960-105299982 TGGGGATGGACCCCAGCCTGTGG - Intronic
1124795592 15:32775235-32775257 TAGGGATGGGGTCCAAATTTAGG - Intronic
1125687506 15:41572350-41572372 TAGAGATGGGACCCAGCAGGTGG + Intronic
1129391008 15:75220951-75220973 GAGGGATGGGAACCACCTTGGGG + Intergenic
1129473300 15:75766926-75766948 GAGGGATGGGAACCAGCTTGGGG - Intergenic
1129667650 15:77588420-77588442 TAGAAATGGGTCCCAGCTGGAGG - Intergenic
1129731538 15:77935324-77935346 GAGGGATGGGAAGCAGCTTGGGG - Intergenic
1132028013 15:98419427-98419449 CATGGGTGGGGACCAGCTTGGGG + Intergenic
1132885865 16:2181677-2181699 TGGGCTTGGGGCCCAGCTTGGGG + Intronic
1135424247 16:22324476-22324498 AGGGGAGGGGGCCCAGCGTGAGG - Intronic
1136736804 16:32474105-32474127 TCGGGATGGCGCCCGGCCTGAGG + Intergenic
1136913536 16:34162273-34162295 GCGGGATGGGGCCGAGCTGGTGG - Intergenic
1137883583 16:52078076-52078098 TGGGGATGGGGCCCAGCAATCGG + Intronic
1138579133 16:57928340-57928362 TAGGGATAGGGCCCAACAAGAGG + Intronic
1138768221 16:59630031-59630053 CAGAGATGGGCCCCAGCTTCTGG - Intergenic
1139270868 16:65681532-65681554 GAGGGCTGGGGCCCTGCTTCAGG - Intergenic
1139436891 16:66941640-66941662 TTGGGTTGGGGCTCACCTTGGGG - Exonic
1139938771 16:70590189-70590211 CCGTGATGGGGCCCTGCTTGGGG + Intronic
1140202142 16:72903353-72903375 TAGGGATGGGGCCAGGAATGTGG + Intronic
1141112495 16:81281707-81281729 TGGCGATGGTGCCCAGATTGAGG - Intronic
1141204337 16:81921818-81921840 TTAGGAAGGGGCCCTGCTTGTGG + Intronic
1141491646 16:84377925-84377947 TAGGAATATGGCCCAGCTAGTGG - Intronic
1141881952 16:86866115-86866137 TGGGCATGGGGCCCAGGCTGGGG - Intergenic
1203016264 16_KI270728v1_random:355472-355494 TCGGGATGGCGCCCGGCCTGAGG - Intergenic
1203034599 16_KI270728v1_random:628630-628652 TCGGGATGGCGCCCGGCCTGAGG - Intergenic
1144849460 17:18236754-18236776 CAGGGGAGGGGCCCACCTTGCGG - Exonic
1146095401 17:29925536-29925558 TAGAGATGGGGACTTGCTTGGGG - Intronic
1146978155 17:37133878-37133900 TAGGAATGGGCTCCACCTTGGGG + Intronic
1147249421 17:39144135-39144157 CAGGGAGGGGGCCCAGCTGGGGG + Intronic
1147778863 17:42925041-42925063 CAGGGATGGGCCACAGCTTGGGG - Intergenic
1148028631 17:44605188-44605210 TAGGTTTGGGGCTCAGGTTGGGG - Intergenic
1148721627 17:49757541-49757563 TAGTGTTCGGGCTCAGCTTGTGG - Intronic
1148790080 17:50168023-50168045 AAGGGATGGGGCACAGCTAGAGG - Intronic
1149121803 17:53177405-53177427 TAGGGATGCTGACCACCTTGAGG - Intergenic
1149665311 17:58360952-58360974 GAGGAATGGGGCTCAGATTGGGG + Intronic
1150526764 17:65931826-65931848 TAGTGTTGGAGCCCAGCCTGAGG + Intronic
1151584161 17:74998495-74998517 AAGGGATGGGACCCAGGCTGGGG - Intronic
1152015406 17:77747390-77747412 GAGAGATGGGGCCCAGGATGGGG - Intergenic
1153393406 18:4590224-4590246 TGTGGATGAGGCCCAGGTTGAGG - Intergenic
1155074138 18:22340517-22340539 CAGGGAAGGGGCCCAGCAAGGGG + Intergenic
1155549372 18:26948960-26948982 GAGGGAAGGGGCCCAGCCTTTGG + Intronic
1157606254 18:48927641-48927663 AAGTGATTGGGGCCAGCTTGTGG + Intronic
1160976683 19:1796270-1796292 TAGGGAGGGGGGCCATTTTGGGG + Intronic
1161520233 19:4719799-4719821 TGAGGATGTGGCCCAGCTTCTGG - Intronic
1163354367 19:16800247-16800269 GAGCCATGGGGCCCAGCCTGTGG - Intronic
1163845067 19:19634036-19634058 TGGGCATCAGGCCCAGCTTGTGG - Exonic
1164591690 19:29511058-29511080 GAGGCTTGGGGCCCAGCATGTGG - Intergenic
1165893946 19:39130399-39130421 GAGGCATGTGGCCCAGCGTGGGG + Intronic
1168145188 19:54416386-54416408 TGGGGAAGGGGCCCGGCTCGGGG + Intronic
928667139 2:33560742-33560764 TCAGGATGGCGCCCACCTTGTGG + Intronic
929431034 2:41886742-41886764 AAGAGATGTGGCCCAGCCTGTGG - Intergenic
932329513 2:70889720-70889742 TAGGGATGGGGCTGAGATTCTGG + Intergenic
933688063 2:85158857-85158879 TGTGGCTGGGTCCCAGCTTGTGG - Intronic
933843330 2:86305313-86305335 GAGGGCTGGGGCCAAACTTGGGG - Intronic
934308660 2:91844726-91844748 TCGGGATGGCGCCCGGCCTGAGG - Intergenic
934716770 2:96549277-96549299 TTGGGATGGGCCCCAGTTGGTGG - Intronic
934775085 2:96932250-96932272 AAGGGATGATGCCCAGCTGGAGG - Intronic
935268434 2:101413886-101413908 GGAGGATGGGGCCCAGCTCGGGG + Intronic
935807955 2:106767466-106767488 CAGGGATGGAGTCCAGCCTGAGG - Intergenic
937910246 2:127072161-127072183 AATGGATGGGGCCCACCTTCCGG - Intronic
938139464 2:128784118-128784140 TGGGGCTGGGCTCCAGCTTGTGG + Intergenic
938288694 2:130138253-130138275 GAGGGCTGAGGCCCAGCTGGTGG - Intergenic
938467839 2:131534679-131534701 GAGGGCTGAGGCCCAGCTGGTGG + Intergenic
941700298 2:168597123-168597145 TAGGGATGGCGCCAGGTTTGAGG + Intronic
942220218 2:173761849-173761871 TAGGGCTGGGGAACAGCCTGAGG - Intergenic
942989612 2:182183577-182183599 TAGGGTTGGGGTCCAAGTTGGGG + Intronic
943054504 2:182959390-182959412 CAGGGATGAAGCCCGGCTTGTGG - Intronic
947751488 2:232535050-232535072 CATGGCTGGGCCCCAGCTTGGGG + Intronic
948473016 2:238197673-238197695 TGGGGATGGGGCTCAGTTTGGGG - Intronic
948495585 2:238346477-238346499 GAGAGAGGGGGCCAAGCTTGTGG - Intronic
1169196961 20:3688566-3688588 CAGGGGTGGGGCACAGGTTGAGG + Exonic
1169635410 20:7685767-7685789 TAGGGAAGGGCCCCATCCTGGGG + Intergenic
1173091422 20:39975550-39975572 CAGGGATGGGGCCAAGATGGCGG - Intergenic
1175701486 20:61140828-61140850 TCGGCAGGGGGGCCAGCTTGGGG + Intergenic
1175876577 20:62232995-62233017 CAGAGATGGGGCCCAGGTTGAGG - Intronic
1175915128 20:62422607-62422629 TGGGGATGGGGCCCGGAGTGGGG + Intronic
1175915139 20:62422625-62422647 TGGGGATGGGGCCCGGGGTGGGG + Intronic
1179952664 21:44718868-44718890 CAGGGAGAGGGCCCAGCCTGGGG - Intergenic
1181108261 22:20587267-20587289 GAGGGCTGAGGCCCAGCTGGTGG - Exonic
1181439735 22:22929558-22929580 CAGGGATGGAGCCCAGGGTGTGG - Intergenic
1181572333 22:23774324-23774346 TGGAGCTGGGGGCCAGCTTGGGG + Intronic
1181749128 22:24976696-24976718 TAGGGGTGGGCCCCAGCATGTGG - Intronic
1181803063 22:25359689-25359711 TGGGGATGGGGCCCAGCCGCTGG + Intronic
1181890427 22:26058288-26058310 TAGGGATAGGGACCACCTTGAGG + Intergenic
1185315772 22:50178499-50178521 AAGGGAGGGGGCCTGGCTTGAGG + Intronic
951674610 3:25223161-25223183 TAGGGCTGGGGGCCAGTTGGTGG - Intronic
953145091 3:40267669-40267691 TAGGGATGGGGACAAGCTGGAGG - Intergenic
953383846 3:42493603-42493625 TAGGACTGGGGCCAAGCTTGTGG - Intronic
953686589 3:45082899-45082921 CAGTGAAGGGGCCCAGCCTGAGG - Exonic
955346374 3:58164919-58164941 TAGAGAGGGGGCCAAGCTCGGGG - Intronic
960456121 3:117874422-117874444 TAGGGGTGGAGAACAGCTTGGGG - Intergenic
961491916 3:127262375-127262397 AAGGGATGGGGCCCTTCCTGTGG - Intergenic
961648343 3:128404667-128404689 TTGGGATGGGGCACAGAGTGTGG - Intronic
961817868 3:129560542-129560564 TAGGGATGGGGCCCAGAATCAGG - Intronic
962842938 3:139252010-139252032 GAGTGAAGGGGGCCAGCTTGGGG + Intronic
967891366 3:194366616-194366638 GAGGGATGGGGCCAGGCCTGTGG - Intronic
969552959 4:7883984-7884006 TGGGGATGGGGCCTGGCTGGTGG + Intronic
983671676 4:170245551-170245573 TAGGGAAGGTGCCGTGCTTGTGG + Intergenic
997986678 5:138507154-138507176 AAGGGATGGGACACAGCTTCTGG - Exonic
998139710 5:139693004-139693026 AAGGGAAGGGGCCCAGCATGTGG - Intergenic
998405264 5:141870651-141870673 TTGTGATGGGGTACAGCTTGTGG - Intronic
999317623 5:150594411-150594433 TAGGGATCCTGCCCAGCTTGAGG - Intergenic
1001094053 5:168762567-168762589 TTGGGATGCGGACCAGCTTCTGG + Exonic
1001564383 5:172690019-172690041 GGGGGCTGGGGCCCCGCTTGAGG - Exonic
1001761523 5:174211889-174211911 TATGAATGGGGCCCAGACTGGGG - Intronic
1003005853 6:2380780-2380802 GAGCAATGTGGCCCAGCTTGTGG + Intergenic
1005152896 6:22772868-22772890 AAGGGAGGGGGCCAATCTTGGGG + Intergenic
1011029065 6:82901474-82901496 TAGGGGTGGGGCCTAGCAAGGGG + Intronic
1016029523 6:139323188-139323210 AAGGGATGGGGCTCAGTGTGTGG + Intergenic
1019472166 7:1226934-1226956 TGGTGCTGGGGCCCAGCCTGGGG + Intergenic
1019475714 7:1243108-1243130 CAGGGAAGGGGCTGAGCTTGGGG - Intergenic
1019999923 7:4749793-4749815 TGGGGACGGAGCCCAGCTGGCGG + Intronic
1021370479 7:19839083-19839105 TAGAGATGGGGACCTACTTGAGG - Intergenic
1029111986 7:98217345-98217367 CAGGGACGGTGCCCAGTTTGGGG - Exonic
1029300699 7:99580370-99580392 TGGCGGCGGGGCCCAGCTTGCGG + Intronic
1029406117 7:100374846-100374868 AAGGTATGGGGCCCACCCTGAGG - Intronic
1034431912 7:151045391-151045413 TAGGGCTGGGGCTCAGCCTGGGG + Exonic
1034757795 7:153639484-153639506 CAGGGATGGGGCTCAGGCTGAGG - Intergenic
1035366362 7:158351329-158351351 CAGGGATGGGGCCCAACTGAGGG - Intronic
1035438138 7:158874765-158874787 CAGGGATGATGCCCAGCTGGGGG - Intronic
1037728268 8:21502059-21502081 TAAGGATGGTGACCAGGTTGAGG + Intergenic
1038604063 8:28980666-28980688 TAGGGATGGGGCTTAGGTGGGGG - Intronic
1040036167 8:42872211-42872233 TATGGAGGGGCCCCAGATTGAGG - Intronic
1041373532 8:57189860-57189882 CAGGGCTGGGGCACAGCTTCAGG - Intergenic
1043554942 8:81420346-81420368 GATGGATGGGGCCCACCATGTGG + Intergenic
1044893700 8:96864814-96864836 GGGGGATGGGGCACAGCATGAGG + Intronic
1047889531 8:129292547-129292569 TAAGGATGGGGGCCAGCTTTGGG + Intergenic
1049233291 8:141495259-141495281 TAGGGTTTGAGCCCACCTTGGGG + Intergenic
1049710739 8:144062244-144062266 CAGGGATGGGGCCCAGGATCAGG + Intronic
1049839778 8:144763503-144763525 TAGAGATGGGGCCAAACTAGGGG + Intergenic
1052640977 9:31165590-31165612 GAGGGAGGGGAACCAGCTTGGGG - Intergenic
1054937099 9:70699748-70699770 TGGAGGTGGGGCCCAGCTTCAGG + Intronic
1055006468 9:71512988-71513010 TAGGTATGTGGACCACCTTGAGG - Intergenic
1055336590 9:75238370-75238392 TAGCCAAGGTGCCCAGCTTGGGG - Intergenic
1057831619 9:98411482-98411504 CAGGGATGGGGCACAGCAAGGGG + Intronic
1058633443 9:107012936-107012958 AAGGGATGGGGGCCATCATGTGG + Exonic
1060655404 9:125369208-125369230 TGGGGATGGGGCCCAGGATTTGG + Intergenic
1061008451 9:127941739-127941761 CAGCGCTGGGGCCCAGCTGGGGG - Exonic
1061481264 9:130898768-130898790 GAGGGAGGGGGCACAGGTTGGGG - Intergenic
1061989781 9:134152643-134152665 GTGGGATGGGGCGCACCTTGAGG + Intronic
1062400644 9:136371235-136371257 TAGGGATGGGGGCCAGGCAGAGG + Intronic
1062448260 9:136604767-136604789 AAGGCATGGGGCTCAGCCTGTGG - Intergenic
1186524736 X:10238196-10238218 TAGGGGAGGGGACCAGCTGGGGG + Intergenic
1187029965 X:15475869-15475891 TAGGGAAGAGGCACAGCTGGTGG - Intronic
1188826874 X:34846054-34846076 TAAGGAAGGGGCCCAGTTTCAGG + Intergenic
1190991961 X:55561048-55561070 TAGGGTTGGGGCCCACCTGATGG + Intergenic
1191875997 X:65796965-65796987 AAGGGATGGGACACAGCTTCTGG + Intergenic
1192479705 X:71474348-71474370 TAGGGAAGGAGCCAGGCTTGGGG + Intronic
1196817038 X:119673405-119673427 TAGGGAGTGAGCCTAGCTTGTGG + Intronic
1198700193 X:139388448-139388470 TAGGGTTGGGGCACGGCCTGTGG + Intergenic
1199097391 X:143758820-143758842 CAGGGATGGGGCACTGCTAGTGG + Intergenic
1199709968 X:150462005-150462027 CAGGGATGGGCCACAGCTGGAGG + Intronic
1199779733 X:151047173-151047195 TAGGGATAGGGCCAAGTTGGAGG - Intergenic
1200137436 X:153882005-153882027 CAGGGAAGGAGCCCAGCCTGGGG + Intronic