ID: 1077009606

View in Genome Browser
Species Human (GRCh38)
Location 11:374339-374361
Sequence CTGTGGGGATGGACGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 605}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077009599_1077009606 -10 Left 1077009599 11:374326-374348 CCCAGGGAGGTGGCTGTGGGGAT 0: 1
1: 0
2: 3
3: 49
4: 440
Right 1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 605
1077009595_1077009606 -3 Left 1077009595 11:374319-374341 CCTCAAACCCAGGGAGGTGGCTG 0: 1
1: 0
2: 2
3: 41
4: 365
Right 1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 605
1077009592_1077009606 5 Left 1077009592 11:374311-374333 CCTTTGGTCCTCAAACCCAGGGA 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 605
1077009587_1077009606 30 Left 1077009587 11:374286-374308 CCTGGGGGAAGGATTTTTACTGT 0: 1
1: 0
2: 2
3: 6
4: 133
Right 1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG 0: 1
1: 0
2: 1
3: 54
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077009606 Original CRISPR CTGTGGGGATGGACGGGGGA AGG Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900462646 1:2808929-2808951 CGGTGGGGACGCACGGTGGAAGG + Intergenic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
901236545 1:7670375-7670397 CTGTGGGGATGGCAAGGTGAGGG - Intronic
901420331 1:9146363-9146385 GTGTGGGGAGGGTAGGGGGAAGG - Intergenic
902231768 1:15032095-15032117 GTGTGGGGGTGGATCGGGGAGGG - Intronic
902728748 1:18354619-18354641 CTTGGGGGAGGGATGGGGGAGGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903199158 1:21719185-21719207 CTGGGCGGAGGGACGGGGGGCGG + Intronic
903215555 1:21841674-21841696 CTGTGAGGTTGCATGGGGGAGGG + Intronic
903425733 1:23252870-23252892 GTGTGGGGAGGGACATGGGAGGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
903772745 1:25774208-25774230 CAGCTGGGATGGACCGGGGAGGG + Intronic
904037745 1:27567873-27567895 TTGTGGGGAGGGACAGGGAAGGG + Intronic
904453511 1:30632262-30632284 CTGTGGGGAGGGCAGGGCGAGGG + Intergenic
904565393 1:31425440-31425462 CTGTGGGGAGGGAAGTGGGGCGG + Intronic
905743167 1:40389916-40389938 GTCTGGGGGTGGGCGGGGGAGGG - Intronic
905791643 1:40792664-40792686 CTGGTGGGAGAGACGGGGGACGG + Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
909702893 1:78547300-78547322 GTATGGGGAAAGACGGGGGAAGG + Intergenic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
913247849 1:116886051-116886073 CTCTGGGGATGACAGGGGGATGG + Intergenic
914666881 1:149840056-149840078 CTGTGGACATGGACAGGGAACGG + Exonic
914668886 1:149853734-149853756 CTGTGGACATGGACAGGGAACGG - Exonic
914680905 1:149937647-149937669 CAGATGGGAGGGACGGGGGATGG - Intergenic
915584414 1:156836485-156836507 CTGTGTGGAAGGACAGGGTAGGG + Intronic
915658002 1:157377474-157377496 CTCTGGGGAAGAATGGGGGAGGG + Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
921881568 1:220260589-220260611 CTGTTGGGGTGGTGGGGGGAGGG + Intronic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922241677 1:223759511-223759533 CAGTGGGGAGGGACAGGGAAGGG - Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
922934283 1:229411493-229411515 CTCTGGGGCTGGAAAGGGGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923673786 1:236064042-236064064 GTGGGGGGTTGGCCGGGGGAAGG - Intronic
924051582 1:240084926-240084948 CTGTAGGGATGGAAGTGGGTGGG + Intronic
924795769 1:247291261-247291283 CTGGGGTGATGGAGGGGTGAGGG - Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1062805518 10:416824-416846 CTGTGGGCTTGGACGGTGCAGGG + Intronic
1063460969 10:6214895-6214917 CTGTGAGGATGGGTGGGGGGAGG - Intronic
1064194376 10:13233495-13233517 AGGTGGTGATGGACGCGGGATGG + Intronic
1066347169 10:34599085-34599107 GTGTGGGGAGAGACGGGTGATGG - Intronic
1067934537 10:50598074-50598096 TTGTGGGGCGGGGCGGGGGAGGG - Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069659851 10:70116500-70116522 CTGTTGGGAAGAAAGGGGGAAGG + Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1069854550 10:71432763-71432785 CAGTGGGGCTGGACTCGGGATGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070307665 10:75249180-75249202 CTGTGGGGCTAGGCGGGGGAGGG - Intergenic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072553621 10:96497649-96497671 CTGTGGTGAGGGGCAGGGGAGGG - Intronic
1072615033 10:97043512-97043534 TTCTGGGGAGGAACGGGGGAGGG + Exonic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073351378 10:102822436-102822458 CTGCAGGGATGGAACGGGGAGGG + Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074235255 10:111578380-111578402 CCATGGGGATGGACGGTGGGAGG - Intergenic
1074461419 10:113641320-113641342 CTGTTGGGATGGAGTGGGGCAGG - Intronic
1074561931 10:114542760-114542782 CTCTGGGGAGGGATGAGGGATGG + Intronic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1075680893 10:124330534-124330556 GGGTGGGGTTGGATGGGGGAGGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076638085 10:131895955-131895977 GTGTGGGGATTGACTGGAGAGGG - Intergenic
1076868556 10:133181514-133181536 CTGTGGGGATGGCCAGCGGCCGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077048704 11:557146-557168 TTGTGAGGCTGGACGGGGGCAGG - Intronic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077081989 11:728351-728373 CTGTGGGGCTGGGCTGGGGGGGG + Intergenic
1077279217 11:1734554-1734576 CTGGGGGGACGGAAGGGGGTGGG - Exonic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077472490 11:2770553-2770575 CTGGGGGGATGCAGGTGGGAGGG - Intronic
1079363198 11:19786880-19786902 CTGGGGAGGTGGACGGGGGTGGG + Intronic
1080302568 11:30800606-30800628 CAGTTGGGATGGAAGGGGTAGGG + Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080382108 11:31782673-31782695 CAGTTGGGATGGGCGGGGGTTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080613405 11:33925105-33925127 CTGTGGGGATGGAATGTGTAGGG + Intergenic
1081583096 11:44365866-44365888 GTGTGGGCATGGATGGGGTAGGG - Intergenic
1081669503 11:44935165-44935187 CTGTGGGGTTGGCAGGGGCAGGG - Intronic
1082009162 11:47438699-47438721 CTGGGGGGGTGGACAGGGGTGGG - Intronic
1082315991 11:50723233-50723255 TGGTGGGGGTGGAGGGGGGAGGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083631082 11:64095857-64095879 CTGAGGGGAGGGTCTGGGGAAGG + Intronic
1083703312 11:64495620-64495642 CTGGGGGGATGGGTGGGGGGGGG - Intergenic
1083814990 11:65127741-65127763 CTGGGGGGAGGGGCGGGGCAGGG + Exonic
1084361445 11:68670626-68670648 TTTTGGGGATGGACGGGCGGAGG + Intergenic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084603106 11:70158320-70158342 CTGTTGGGCTGGACGAGGGCAGG - Intronic
1084695103 11:70748398-70748420 TTGTGGGGGTGGGCAGGGGACGG - Intronic
1084705780 11:70815315-70815337 CTGTGGGGGAGGATGGGGGCAGG + Intronic
1084884733 11:72196207-72196229 CTGTGGGGCTGAACAGGGCAGGG - Exonic
1084891453 11:72238967-72238989 CTCTGGGGATGCACGGCGGCAGG + Exonic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085133596 11:74064041-74064063 TTGTGGGGTGGGACGGGGGAGGG - Intronic
1086400382 11:86456629-86456651 CTCTGGGGAAGGACGGAGCAGGG + Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088533610 11:110836983-110837005 TGGTGGGGATGGACAGGGAAAGG - Intergenic
1088755122 11:112879146-112879168 CTGTTGTGATGGACAGCGGAAGG + Intergenic
1089012281 11:115141153-115141175 CGGTGGGGAAGGAAGAGGGAAGG - Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089731705 11:120523406-120523428 CTTTGGGGAGGGAAGTGGGAGGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1092920279 12:13224875-13224897 CTGTAGGGGTGGACATGGGAGGG + Intergenic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094218900 12:27972912-27972934 CTGGGGGGACGGGGGGGGGAGGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1095951424 12:47783887-47783909 CTGTGGGGAGGGACAAGGGTGGG + Intronic
1095999654 12:48118691-48118713 CAGTGGGGAGGGATGGGGGCGGG - Intronic
1096411862 12:51382798-51382820 CAGTGTGGATGGAAGAGGGAGGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096792600 12:54054280-54054302 CTGGAGGGATGGTCGGGGGCTGG - Exonic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097178719 12:57158662-57158684 CCATGGGGATGGAAGGGGGCTGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098268757 12:68750068-68750090 CGGTGGGAATGGACAGGGAAAGG + Intronic
1100722206 12:97371051-97371073 ATGAGAGGATGGAGGGGGGATGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101321631 12:103678079-103678101 AGGTGGGGATGGATGGGGGAAGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101814686 12:108136861-108136883 CTGTGGGGATGGACCTGGCCTGG - Intronic
1102445509 12:112999237-112999259 TTTTGGGGATGGGAGGGGGAAGG - Intronic
1102495560 12:113316714-113316736 CTGGTGGGATGGAGCGGGGAAGG - Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103468411 12:121160515-121160537 CTGTGGCCAGGGACAGGGGAAGG - Intronic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103698786 12:122836549-122836571 CTTGGGGGATGGGCGGTGGAGGG + Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104657951 12:130587958-130587980 CTGTGTGGAGGGACAGAGGAAGG - Intronic
1104950862 12:132439346-132439368 CTGTGGGGCTGGTCTGGGGCGGG - Intergenic
1104964142 12:132501443-132501465 CAGGGGTGATGGCCGGGGGAGGG + Intronic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106571944 13:30935073-30935095 CTGCAGGGATGGATGGGTGAAGG - Intronic
1107164582 13:37269526-37269548 CTGTGGGGATGCATGAGGGAGGG - Intergenic
1108439572 13:50436947-50436969 CCTTGGGGATGGTGGGGGGAGGG - Intronic
1108846139 13:54679887-54679909 ATGTGGAGCTGGACAGGGGATGG - Intergenic
1110009354 13:70312353-70312375 GTCTGGGGAGGGATGGGGGAGGG + Intergenic
1110661594 13:78064260-78064282 GTCAGGGGATGGATGGGGGAGGG - Intergenic
1111383708 13:87495275-87495297 CTCTGGGGATGGAATAGGGAGGG + Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1113574169 13:111382529-111382551 CTGTGGTGATGGGTGGGGGTCGG + Intergenic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1113756126 13:112812369-112812391 CAGTGGGGCTGCACGAGGGAGGG - Intronic
1113814154 13:113159901-113159923 CTGTGGAGACGGACGGGGCTGGG + Intronic
1113867381 13:113535909-113535931 GTCTGGGGAGGGACTGGGGATGG + Intronic
1114444071 14:22774585-22774607 CTTTGAGGATTGACAGGGGATGG - Intronic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1116733141 14:48651354-48651376 CGGCGGGGAGGGTCGGGGGAGGG + Intergenic
1117779597 14:59218871-59218893 ATGTGTGGAGGGCCGGGGGAAGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1119618620 14:76114914-76114936 TTGTGGGGAAGGACGAAGGAGGG + Intergenic
1119727280 14:76929038-76929060 CGGTGGGCATGGAATGGGGAGGG + Intergenic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121727573 14:96164447-96164469 CTTTGAGGATGGAGGAGGGAGGG + Intergenic
1121940534 14:98066257-98066279 CTGTGAGGTGGGGCGGGGGAAGG - Intergenic
1121959711 14:98247979-98248001 GTGGGGGGAGGGGCGGGGGAGGG + Intergenic
1122264409 14:100539948-100539970 GTGAGGGGAGGGTCGGGGGACGG + Intronic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122715754 14:103696096-103696118 CTGTGGGGGGGGGCGGGGGGCGG - Intergenic
1122840758 14:104461595-104461617 CAAGGGGGGTGGACGGGGGACGG + Intergenic
1123113156 14:105882333-105882355 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1123115506 14:105892485-105892507 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1124625842 15:31307033-31307055 CTGGGGGGATGGCCTGGGGCTGG + Intergenic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125796406 15:42407079-42407101 CTGTAGGGAAAGCCGGGGGAAGG - Intronic
1126379494 15:48031338-48031360 CTAAGGGGATGCACGGGGAAGGG + Intergenic
1127632865 15:60842692-60842714 CTGTGTGGAGGGTCGGGGGAGGG - Intronic
1127657733 15:61071533-61071555 CGGTGGGGATGGAAGGGGAGGGG + Intronic
1128066895 15:64770788-64770810 TTGTGTGGATGGAACGGGGAGGG - Intronic
1128391794 15:67187319-67187341 CTGTGGGGATGGAAGTGGCCAGG - Intronic
1128528455 15:68428406-68428428 CTGTGTGGATGGGCTGGGAATGG + Intronic
1128797647 15:70477311-70477333 CTATGGGGAGGGAATGGGGAGGG - Intergenic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131341405 15:91605140-91605162 CTGTGGGGAGTGATGAGGGAAGG + Intergenic
1131841844 15:96445709-96445731 CGGTGGGGAGGGATGAGGGAAGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132464562 16:71748-71770 TTGTGGGGCTGGGCGGGGAATGG - Intronic
1132547179 16:538678-538700 CTGTGGGGAGGAACCAGGGAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133420110 16:5638698-5638720 CTGTGGGGACAGACAGGGAATGG - Intergenic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1135024077 16:18985822-18985844 CCGTGGGGTGGGGCGGGGGATGG + Intronic
1135315976 16:21444669-21444691 CCGTGGGGTGGGGCGGGGGATGG - Intronic
1135368901 16:21876931-21876953 CCGTGGGGTGGGGCGGGGGATGG - Intronic
1135442915 16:22494212-22494234 CCGTGGGGTGGGGCGGGGGATGG + Intronic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1136312652 16:29423404-29423426 CCGTGGGGTGGGGCGGGGGATGG - Intergenic
1136326086 16:29525153-29525175 CCGTGGGGTGGGGCGGGGGATGG - Intergenic
1136440775 16:30265137-30265159 CCGTGGGGTGGGGCGGGGGATGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137561292 16:49503921-49503943 CTCTGGGCATGGCCGGGGCAAGG - Intronic
1137581946 16:49638998-49639020 CTGTGGGGAGGGGCAGGGGCCGG + Intronic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137797524 16:51234560-51234582 CTGGTGTGATGGACGGGGGTGGG + Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138588453 16:57986134-57986156 GGGTGGGGGTGGACGCGGGAGGG + Intronic
1139683195 16:68581239-68581261 TTTTGGGGAGGGAAGGGGGATGG + Intergenic
1139887290 16:70217456-70217478 CCGTGGGGTGGGGCGGGGGATGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142249932 16:88986564-88986586 CTGTGGGGCTGTAGGGGGGCAGG - Intergenic
1142325455 16:89411947-89411969 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325473 16:89412008-89412030 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325490 16:89412069-89412091 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325507 16:89412130-89412152 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325525 16:89412191-89412213 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325543 16:89412252-89412274 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325561 16:89412313-89412335 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142325579 16:89412374-89412396 CTGAGGGGAGGGATGGGGCACGG - Intronic
1142621114 17:1166246-1166268 CTGTGAGCAGGGACGGGGGCAGG + Intronic
1142686186 17:1578189-1578211 GTGTGGGAATGGCCGGGGGGAGG - Intronic
1142851196 17:2705633-2705655 CTCTGGGAATGAAAGGGGGAGGG - Intronic
1142871892 17:2826555-2826577 CTTTGGGGATGGATTGCGGAAGG + Intronic
1143137215 17:4718589-4718611 CTGTGGGGTGGGACGGGGTCAGG - Intronic
1143196289 17:5078598-5078620 CTGTGGGGGTAGGCGGGGGCTGG + Intronic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143582544 17:7835346-7835368 CTGTGGGGAAGGCCGAGGGCAGG + Intergenic
1143722370 17:8821982-8822004 ATGTGGGGATGCATGGGGAAAGG - Intronic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1145978554 17:28998120-28998142 CTATGGGGAGGGAGGAGGGATGG + Intronic
1146430079 17:32784821-32784843 CTGTGGGGAGGGGTGGGGTATGG + Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146941591 17:36847350-36847372 GTGTGGGGAGGGAGGTGGGAGGG + Intergenic
1146965521 17:37025482-37025504 CAGTGGCCATTGACGGGGGAGGG + Intronic
1147342050 17:39758507-39758529 CTGTGGCGAGGGATTGGGGAAGG + Intergenic
1147703698 17:42411843-42411865 CAGTGGGGATGGGAGGGGAATGG - Intronic
1148051587 17:44772376-44772398 CTGTGGGGAGGGGCAGGTGAGGG - Intronic
1148201618 17:45753365-45753387 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201625 17:45753396-45753418 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201633 17:45753427-45753449 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201641 17:45753458-45753480 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201648 17:45753489-45753511 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148449539 17:47767105-47767127 CTGGGTGGATGAATGGGGGAAGG + Intergenic
1148457939 17:47820997-47821019 CTGTGAGGGTAGACAGGGGATGG - Intronic
1149567243 17:57648940-57648962 CTCTGGGGCTGGACCTGGGAGGG - Intronic
1149931099 17:60756413-60756435 ATGTGTGGATGGAAGGGGGGTGG - Intronic
1150295038 17:64002924-64002946 CTCTGGGGAGGGAGGGGGCAAGG + Exonic
1150549007 17:66191952-66191974 CTGGTGGGAGGGGCGGGGGAAGG + Intronic
1151217586 17:72588142-72588164 GTGAGGGGCTGGACGGGGGTGGG + Intergenic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152251051 17:79212744-79212766 CTGTGGGGAGGGGCGGGGAATGG + Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152772111 17:82176500-82176522 CTGTGGGGGTAGACAGGTGAGGG - Intronic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154475731 18:14755540-14755562 GTGAGGGGAAGGAAGGGGGAGGG - Intronic
1156866374 18:41893194-41893216 CTCTGGGGACTTACGGGGGAAGG + Intergenic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1157728050 18:49979852-49979874 CTAAGTGGATGGACGGGTGATGG - Intronic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159903733 18:74072001-74072023 ATGTTGGGATGGAGGAGGGAAGG - Intergenic
1160040484 18:75340401-75340423 CTGGGAGGATGGACGGCGGAGGG + Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160877886 19:1305886-1305908 CTCTGGGGATGGTGGGGGGGGGG - Intergenic
1160922434 19:1527164-1527186 GTGTGAGGGAGGACGGGGGAGGG + Intronic
1161010907 19:1958907-1958929 CTGTGGCCCTGGACGGGGGTGGG - Intronic
1161249131 19:3270988-3271010 TTCTGGAGATGGACGAGGGAGGG - Intronic
1161285404 19:3465883-3465905 GGGTGGGGATGCACGGGGCAGGG - Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161700037 19:5789482-5789504 CGTTGCGGATGGACGGGGGCTGG + Exonic
1162059331 19:8085453-8085475 CTGTGGGGGTGGCCGGGGCTGGG - Exonic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162526641 19:11210218-11210240 GTGAGGGGATGGACAGGTGAGGG - Intronic
1162934755 19:13976392-13976414 CTGTGGAGATGGGAGAGGGAAGG + Intronic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163717704 19:18881547-18881569 CTCTGTGGAAGGACAGGGGATGG - Intronic
1163722827 19:18906374-18906396 CTCTGTGGATGGAGGTGGGATGG + Intronic
1163732119 19:18955252-18955274 GGATGGGGATGGATGGGGGATGG - Intergenic
1164228179 19:23264527-23264549 CTGTGGGCATGGACCAGGCAGGG + Intergenic
1164318369 19:24115509-24115531 CTCTGGGGATTGATGTGGGATGG + Intronic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165347480 19:35257914-35257936 ATGTGGGGATGGAAGGGGAGGGG + Intronic
1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG + Intergenic
1166392894 19:42419698-42419720 GGGTGGGGGTGGATGGGGGATGG + Intronic
1166657492 19:44622959-44622981 CTGTGGGGTTGGACTGGGGGTGG - Intronic
1166708819 19:44924303-44924325 CTGAGGGGTTGGAAGGGGGCAGG - Intergenic
1167321071 19:48797377-48797399 CTCTGGGGCTGGGCTGGGGAAGG - Intronic
1167368015 19:49064872-49064894 GGGTGGGGAGGGACGGGGGCGGG - Intronic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167644105 19:50696418-50696440 CAGTGGGGATGGGTCGGGGATGG - Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1168282554 19:55313173-55313195 CTGTGAGGAGCTACGGGGGAAGG - Intronic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
925521768 2:4754430-4754452 TTGTGGGGGTTGAGGGGGGAAGG + Intergenic
926240505 2:11081218-11081240 ATGGGGGGAGGGAGGGGGGAAGG - Intergenic
926701044 2:15803802-15803824 CTTTTGAGAGGGACGGGGGAGGG - Intergenic
927385173 2:22524240-22524262 GTGAGAGGATGGATGGGGGAGGG + Intergenic
927443114 2:23133751-23133773 ATGTGGGGATGGACAGGCAAGGG + Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930046202 2:47175682-47175704 TGGCGGGGATGGGCGGGGGAGGG - Intronic
930076389 2:47409066-47409088 CTGAGGGGAGGGGAGGGGGAGGG + Intronic
930347002 2:50196119-50196141 CTGTGGGGGTGGTCAGGGGTAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
932572795 2:72946729-72946751 TTGTGGGGAGGGACGGGGAGAGG - Intronic
933870865 2:86563937-86563959 CAGTTGGGATGGAAAGGGGAGGG - Intronic
934622041 2:95817674-95817696 CTGTTGGGAAGGTAGGGGGAAGG - Intergenic
934811409 2:97281109-97281131 CTGTTGGGAAGGTAGGGGGAAGG + Intergenic
934826282 2:97426831-97426853 CTGTTGGGAAGGTAGGGGGAAGG - Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936971868 2:118184088-118184110 GGGTGGGGATGGGTGGGGGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937890267 2:126933312-126933334 CTTTGGGAAAGGACGGGCGAGGG + Intergenic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
938875955 2:135531649-135531671 CCGGGGAGCTGGACGGGGGAGGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940890547 2:159031305-159031327 CTGTGGGGAAGGAAGGGCCATGG + Intronic
941229821 2:162897921-162897943 CTGTGGGCCTGGATGGGGGCTGG - Intergenic
942374020 2:175317292-175317314 ATTTGGGGATGGACAGAGGAGGG + Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
944734060 2:202545204-202545226 GTGTGGGGAGGGGAGGGGGACGG - Intronic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
945225785 2:207530174-207530196 CCGGGGGGACGGAGGGGGGACGG + Intronic
945338583 2:208622141-208622163 CTGTAAGGAGGGTCGGGGGAGGG - Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946247757 2:218397131-218397153 TTGTGGGGCAGGACGGGGGACGG + Intergenic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947439874 2:230109809-230109831 CTATGGGGATGGGTGAGGGATGG + Intergenic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948261793 2:236609674-236609696 TTGTAAGGATGGAAGGGGGATGG + Intergenic
948719449 2:239889468-239889490 CTGTGGGGATGGAGTGGGACCGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948982280 2:241500529-241500551 CTGTGGGAGTGGGCGGGGGCAGG - Intronic
1171982495 20:31637855-31637877 CTGTGGGGCGGGCCGGGGGCGGG + Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172275789 20:33678354-33678376 CTGTGGGGAGGCACCAGGGAGGG + Intronic
1172421010 20:34817704-34817726 CTGAAGGGAGGGAAGGGGGAAGG + Intronic
1173497840 20:43532120-43532142 CTCTGGGGCTGGACTGGGGTAGG - Intronic
1173681476 20:44885524-44885546 CAGGGCGGATGGCCGGGGGAGGG - Intergenic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174788503 20:53455704-53455726 TTGTGGGGTGGGGCGGGGGAGGG - Intronic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175197293 20:57253084-57253106 AAGTGGGGATGGAAGGGGGTGGG - Intronic
1175291955 20:57881897-57881919 CTGTGGGGAGGGATAGCGGAGGG - Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175871937 20:62213134-62213156 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872029 20:62213354-62213376 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872039 20:62213378-62213400 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177867912 21:26535097-26535119 CTGTGGGGGTGTTTGGGGGAAGG + Intronic
1178300633 21:31450013-31450035 CTGTGGGGAGGGAAGAGGCAAGG - Intronic
1178510301 21:33199694-33199716 CTGTGAGGCTGGGCTGGGGATGG - Intergenic
1179029677 21:37709849-37709871 CTGTGGTGAAGGATGGGTGATGG + Intronic
1179054191 21:37916243-37916265 GTTTGGGCAGGGACGGGGGAGGG + Exonic
1179411008 21:41163271-41163293 CAGTGGCGATGGGCGTGGGAGGG - Intergenic
1179635947 21:42709296-42709318 CTGTTGGGAGGGTTGGGGGAGGG + Intronic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1180066820 21:45416440-45416462 GTGTGGGGGTGGCCGGGGCAGGG + Intronic
1180155496 21:45975349-45975371 CAGTGAGGGTGGACGGCGGAGGG - Intergenic
1180185438 21:46136933-46136955 CTCTGGGGATGGGCGAGGGAGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181010062 22:20035045-20035067 CTGTGGGGCTGGAAGTGGGTTGG - Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183314502 22:37129463-37129485 CTCTGGGGATGGGAGGCGGAGGG - Intronic
1183654957 22:39179323-39179345 CTGTGCGGAAGGATGGGGCAGGG + Intergenic
1183976546 22:41515583-41515605 TGGTGGGGATGAACGGGAGACGG + Intronic
1184104575 22:42360040-42360062 GTGTGGGGATGGATTGGGGAAGG - Intergenic
1184148959 22:42627609-42627631 CTGTGGGCATGATCGCGGGAGGG - Exonic
1185318687 22:50190394-50190416 CTGTGGCCATGGACAGGGCAGGG - Intronic
1185333278 22:50261045-50261067 CTGTGGGGCCGGGCGGGGGTCGG - Intronic
950041728 3:9924033-9924055 CAGTGGGAATGGACTTGGGAAGG - Intronic
950043419 3:9934258-9934280 CTGTGGGGATGGGTGGGGAAAGG - Intronic
950443498 3:13023185-13023207 CTGTAGGGATGGAGTGGGGTGGG + Intronic
950702799 3:14761718-14761740 CTGAAGGGATGGAGTGGGGAGGG + Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
954700362 3:52447702-52447724 CCGTGGGGGTGGAGGGGGCATGG - Intergenic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955611269 3:60759792-60759814 CGGTGGGGATGAAAGTGGGATGG + Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961391785 3:126556423-126556445 ATGTGGGGAGGGAAGGGGAAGGG - Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
965295103 3:166935369-166935391 CTGTGGGGGTGGTTAGGGGAGGG - Intergenic
966208453 3:177428208-177428230 CGGTGGGGATGGGCAGGGGCAGG + Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
967129614 3:186458454-186458476 CTGAGGCGGTGGGCGGGGGAGGG + Intergenic
967292067 3:187931045-187931067 CTGTGGGGATCACCAGGGGATGG - Intergenic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
967923413 3:194629404-194629426 CAGTGGATATGGACTGGGGAGGG - Intronic
968663067 4:1806732-1806754 CTCCGGGGCTGGGCGGGGGAGGG + Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969137064 4:5037930-5037952 CTGAAGGGACGGAAGGGGGAGGG + Intergenic
969182132 4:5450326-5450348 CTGTGGATATGGTCAGGGGAAGG - Intronic
969226750 4:5803551-5803573 CTGAGAGGATGGATGGGGGCTGG - Intronic
970399444 4:15703376-15703398 CGGTGGGGAGGGCCTGGGGAGGG + Intronic
970554828 4:17220692-17220714 ATGTGAAGATGGAAGGGGGATGG + Intergenic
972433094 4:39002883-39002905 GTGGGGGGGTGGACGGGGGAGGG + Intronic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973330414 4:48906373-48906395 CTGCAGGGCTGGACGGCGGACGG + Intronic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
975465167 4:74700667-74700689 CTGTGGAGATGAACACGGGAGGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980020415 4:127702957-127702979 CTGTGGGGCTGAACAGGGCAGGG - Intronic
980463281 4:133146153-133146175 CCTAGGGGGTGGACGGGGGAGGG + Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
980785245 4:137545300-137545322 CTCTGGGGATGGAAAGGGAAGGG - Intergenic
980885679 4:138759858-138759880 CTGTGAGGACGGAAGGGGAATGG + Intergenic
982116802 4:152104933-152104955 ATATTGGGTTGGACGGGGGAGGG + Intergenic
985113806 4:186571967-186571989 CTGTGGGGCGGGGCGGGGCAGGG + Intergenic
985511326 5:315760-315782 CCCTGGGGATGGGAGGGGGAGGG + Intronic
985632519 5:1021419-1021441 CTGTGGGGAGGGGCTGGGGGGGG - Intronic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985805479 5:2039710-2039732 TTGTGGGGATGGGCCAGGGAGGG - Intergenic
985894563 5:2740687-2740709 CTGCGGGGAAGGACGTGGGCCGG + Intergenic
985977861 5:3435548-3435570 CTTTGGGGACTGGCGGGGGAAGG - Intergenic
986144805 5:5067375-5067397 GTGTTGGGGTGGTCGGGGGATGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987323553 5:16792557-16792579 CTGTGGGGAGGGACTGGGGTTGG - Intronic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
989164038 5:38417569-38417591 TTGTTGGGGTGGACGGGGGGTGG - Intronic
989192111 5:38680694-38680716 CTTTGGGGTGGGATGGGGGATGG - Intergenic
992605524 5:78452325-78452347 GTGGGGGGAGGGAGGGGGGAGGG - Intronic
993042008 5:82824994-82825016 CTCTGGTGATGGTAGGGGGATGG - Intergenic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
994052171 5:95374690-95374712 CTGTGGGCATTGACAGGGAAGGG - Intergenic
994821198 5:104652938-104652960 CAGTGGTGATGGACTGGGGTGGG - Intergenic
994871247 5:105352103-105352125 CCGGGGGGATGGTCGGGGCATGG + Intergenic
994901033 5:105769488-105769510 TTGTGGGGTGGGGCGGGGGAGGG + Intergenic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
997380537 5:133433316-133433338 CTGGTGGGTTAGACGGGGGAAGG + Intronic
997526093 5:134554199-134554221 CTGTGGGGATTGGAAGGGGAGGG + Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001210553 5:169806788-169806810 GTGTGGGGAGGGACGGGGAGGGG + Intronic
1001923863 5:175622086-175622108 CTCTGGGGAAGGAAGGGGGTTGG - Intergenic
1002186279 5:177456197-177456219 CTGCGGGGAGGGGCGGGGGGAGG + Exonic
1002280136 5:178124949-178124971 CTGTGGGCATTGCCGGGGTAGGG + Exonic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003425745 6:5997223-5997245 CGGGGGGGGGGGACGGGGGAAGG - Intergenic
1003672743 6:8174563-8174585 CTGTGTGGCTGGACAGAGGACGG + Intergenic
1004980907 6:21022603-21022625 GTGTGAGGAGGGAAGGGGGATGG + Intronic
1005238582 6:23795650-23795672 CTGTCAGGGTGGTCGGGGGAGGG + Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006384727 6:33723981-33724003 CAGTGGGCATGGCCGGGGGGGGG + Intronic
1006579265 6:35067246-35067268 CTGTGGGGCTGGCCCGGGGGTGG - Intronic
1006626568 6:35402104-35402126 ATCTGGGGTTGGTCGGGGGAAGG - Intronic
1006792653 6:36714083-36714105 CAGAGGGGATGCACAGGGGAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008036752 6:46753444-46753466 CTGTGGCAATGCACAGGGGAGGG + Intronic
1008673536 6:53795984-53796006 CTGCGGGGGTGGACGCGAGATGG + Intronic
1009740930 6:67745636-67745658 TTGTGGGGTTGGGTGGGGGAGGG - Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1013309414 6:108879451-108879473 ATGGGTGGATGGATGGGGGATGG - Intronic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016601525 6:145866886-145866908 CTGTGCTGATTGATGGGGGAAGG + Intronic
1017055811 6:150434717-150434739 AGGTGGGGAGGGAAGGGGGATGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018066614 6:160129026-160129048 CAGTGTGGAGGGACGGGGGCAGG + Intronic
1018984260 6:168623895-168623917 CTGTGGGGATGGCAGAGGAAGGG + Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019341374 7:510527-510549 CTGCGGTGGTGGACGCGGGAGGG + Intronic
1019341491 7:510816-510838 CTGCGGTGGTGGACGCGGGAGGG + Exonic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019477276 7:1249945-1249967 CTGGGGGGAGGGACGGAGGGAGG + Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019705637 7:2495969-2495991 CTGTGGGGAGGGAGTGGGGCGGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020462579 7:8441931-8441953 CTGTGGGGGTGGGCGGGGAGGGG + Intronic
1022025149 7:26441493-26441515 CTGTGAGGATGGGCGGGTCAGGG + Intergenic
1022320871 7:29286438-29286460 ATGTGGGGATGGGGTGGGGAGGG + Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022960246 7:35419215-35419237 CCGTGGGGGTGGGCGGGGGTCGG - Intergenic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1024053182 7:45642377-45642399 GTCAGGGGATGGACTGGGGATGG + Intronic
1024356524 7:48418980-48419002 TTCTGGGGATGGAAGGTGGAAGG + Intronic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1025799115 7:64767851-64767873 CTGTGGGGAGGCACAGGGTATGG - Intergenic
1025916792 7:65872976-65872998 GGGTGGGGATGGGCGGGGCAGGG - Intergenic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1029542635 7:101193242-101193264 CACTGGGGATGGGCGGGGTATGG - Intergenic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1030638698 7:111979556-111979578 CTGGCGGGGTGGAGGGGGGATGG - Intronic
1032757666 7:134906333-134906355 CTTTGGGGTTGGCCGGGTGATGG + Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033890403 7:146006312-146006334 CTGGGAGGATGCAAGGGGGAAGG - Intergenic
1033944117 7:146693891-146693913 CACTGGGGCTGGTCGGGGGATGG - Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035311645 7:157973349-157973371 CTGTGGGGAGGAATGGGGAAAGG + Intronic
1035469054 7:159098151-159098173 CTGTGCTGATGGATGGGGGCCGG - Intronic
1036112861 8:5923955-5923977 CAGAGGGGATGGTCGGGGGGGGG + Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036990248 8:13584325-13584347 CTGTGGGCCTGGACAGGGGTGGG + Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037910257 8:22739896-22739918 CTGGGGGGATGGAGGGGGAGGGG + Intronic
1039546047 8:38412402-38412424 CGGTGGGGTTGGGCTGGGGAGGG - Exonic
1039864633 8:41490437-41490459 CTGTGGGGCTGGGCCGAGGAAGG - Intronic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042543988 8:69934533-69934555 ATGTGGGGAAGGATGGGGGCAGG - Intergenic
1043530978 8:81149749-81149771 CCGAGGGGATGGACTGGGGGAGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1046856736 8:119040786-119040808 CTGTGGCCATTGACAGGGGAAGG + Intronic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049298898 8:141859308-141859330 CTGTGGGGATGCCCTGGGGGAGG + Intergenic
1049359998 8:142207815-142207837 ATGGGAGGATGGATGGGGGATGG + Intergenic
1049405153 8:142449102-142449124 GTGGGTGGATGGACGGTGGACGG - Intergenic
1049412696 8:142480415-142480437 CTGTGGGGAGGTGTGGGGGACGG + Intronic
1049428488 8:142548464-142548486 GTGGGTGGATGGATGGGGGATGG + Intergenic
1049464328 8:142744142-142744164 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464934 8:142746779-142746801 ATGGGTGGATGGATGGGGGATGG + Intergenic
1051120997 9:13752307-13752329 CCGTGGGGATGTATGGGTGAGGG + Intergenic
1051340074 9:16102901-16102923 GGGTGGGTATGGACTGGGGAGGG - Intergenic
1052381460 9:27775447-27775469 GTGTGGGGTTGGGCGGGGGTGGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052982057 9:34457357-34457379 CGGAGGGAATGGAAGGGGGAGGG - Intronic
1053477001 9:38389634-38389656 CTGTGTGGATTGAAGGGGAAAGG - Intergenic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057250864 9:93500515-93500537 TTGTGGGGAGTGACGGGGGAAGG - Intronic
1057258375 9:93568807-93568829 CAGTGGGGAAGGGTGGGGGAAGG + Intergenic
1057339073 9:94183082-94183104 CTCTGGGGTGGGTCGGGGGAGGG - Intergenic
1057476956 9:95411283-95411305 CTGTGGGAGTGGGCGGGGGCGGG + Intergenic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057700901 9:97362468-97362490 GTGGGGGGATGGACTGGGAAGGG - Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1057914224 9:99043307-99043329 CTGTGGAGATGGACCAGGGCTGG + Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1059163476 9:112057128-112057150 TGGTGGGGATGGAGTGGGGAGGG - Intronic
1059596301 9:115724244-115724266 CAGTGAGGATGGACGGGTCAGGG - Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060110393 9:120902582-120902604 CTGTGTGGCAGGATGGGGGAGGG - Exonic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060397799 9:123328174-123328196 CTGTGGGGAGAGGCGGGGGGGGG + Intergenic
1060700503 9:125746646-125746668 CCGGGGGGAGGGACGGGGGCTGG - Intergenic
1061201307 9:129140060-129140082 CTGGGGGGATGGGCGGGGGTGGG - Intronic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062002517 9:134223867-134223889 CTGTGTGCATGGTCGGGGGTGGG - Intergenic
1062264271 9:135679692-135679714 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264315 9:135679815-135679837 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264329 9:135679850-135679872 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062363709 9:136199162-136199184 CTGTGGGGCGGGATGGGGGTGGG - Intronic
1062384913 9:136305397-136305419 CTGTAGGAATGGAAGGGGGCTGG - Intronic
1062428251 9:136515940-136515962 CAGCGGGGAGGGACTGGGGACGG - Intronic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062589712 9:137268017-137268039 CTGGGGGCCTTGACGGGGGAGGG + Intronic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1185581430 X:1213355-1213377 ATGAGGGGATGGGAGGGGGATGG - Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186976348 X:14910245-14910267 CAGTGGGCATGGACCTGGGAAGG - Intronic
1187061858 X:15794326-15794348 CTGTGGGGAGGGGCGGGGGGCGG - Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1188112808 X:26212095-26212117 CTGTGGGGAAGGGTGGGGGGTGG + Intergenic
1189161819 X:38817156-38817178 CAGTGGGGAGGGGAGGGGGATGG - Intergenic
1189776010 X:44470633-44470655 CTGCAGGGGTGGACGGGGGTTGG + Intergenic
1190318864 X:49167501-49167523 CTGTGGGGAGGGGACGGGGAAGG + Intronic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1191066068 X:56349105-56349127 TTGTGGGGTGGGACGGGGGGAGG - Intergenic
1191902225 X:66053361-66053383 GTGTGGGGGGGGGCGGGGGAGGG - Intergenic
1192202155 X:69073236-69073258 ATGAGTGGATGGACGTGGGAAGG + Intergenic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1193219724 X:78910132-78910154 CAGGGGGGATGGGAGGGGGATGG + Intergenic
1194041952 X:88952235-88952257 CTGTGGGGAGTGCCTGGGGAAGG - Intergenic
1194525966 X:94977922-94977944 CTGTTGGTATGGCAGGGGGAGGG + Intergenic
1194729465 X:97437005-97437027 CTGTGATGGTGGGCGGGGGAGGG - Intronic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195465717 X:105176680-105176702 CTGTGGGGAGAGAAGGGGGGTGG + Intronic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196132563 X:112173000-112173022 CTGTTGGGGGGGTCGGGGGAGGG + Intergenic
1197147494 X:123185485-123185507 CTGTGCGGATGGGCGGGGGGCGG + Intronic
1197395922 X:125927511-125927533 TTGTGGGGTGGGACGGGGGAGGG - Intergenic
1197726696 X:129781367-129781389 CAGTGGTGGTGGGCGGGGGAGGG + Intronic
1197821905 X:130549875-130549897 CTGTGGGGAGGGGCGTGGGATGG + Intergenic
1198033287 X:132776574-132776596 GAGTGAGGATGGATGGGGGAAGG - Intronic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1200065395 X:153502199-153502221 CTGTGGGGAGGGGCTGGGGAAGG - Intronic
1200071090 X:153529745-153529767 CTGAGGGGACGGACAGTGGAAGG - Intronic
1200097998 X:153673199-153673221 GTGTGGACCTGGACGGGGGAGGG - Intronic
1200133800 X:153864995-153865017 CTGTGGGGACAGACAGGGGTTGG + Intronic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200498612 Y:3917126-3917148 TTGTTGGGAGGGACAGGGGAGGG - Intergenic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic