ID: 1077012651

View in Genome Browser
Species Human (GRCh38)
Location 11:385751-385773
Sequence GACCCGGCTGTGCCTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077012651_1077012663 24 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012663 11:385798-385820 TGGGTTTATTTGTGCAGGGTTGG No data
1077012651_1077012664 28 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012664 11:385802-385824 TTTATTTGTGCAGGGTTGGCAGG No data
1077012651_1077012654 -5 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012654 11:385769-385791 GGGTCTCGTGGAACCAGCCCTGG No data
1077012651_1077012656 4 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012656 11:385778-385800 GGAACCAGCCCTGGGAGCAGTGG No data
1077012651_1077012662 20 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012662 11:385794-385816 GCAGTGGGTTTATTTGTGCAGGG No data
1077012651_1077012657 5 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012657 11:385779-385801 GAACCAGCCCTGGGAGCAGTGGG No data
1077012651_1077012661 19 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012661 11:385793-385815 AGCAGTGGGTTTATTTGTGCAGG No data
1077012651_1077012655 -4 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012655 11:385770-385792 GGTCTCGTGGAACCAGCCCTGGG No data
1077012651_1077012665 29 Left 1077012651 11:385751-385773 CCAGCTGAAGGCACAGCCGGGTC No data
Right 1077012665 11:385803-385825 TTATTTGTGCAGGGTTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077012651 Original CRISPR GACCCGGCTGTGCCTTCAGC TGG (reversed) Intergenic
No off target data available for this crispr