ID: 1077014290

View in Genome Browser
Species Human (GRCh38)
Location 11:393077-393099
Sequence AAGCCTAGGAGGGCTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 604}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077014290_1077014308 14 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014308 11:393114-393136 CTACCAGGGGCTTGTCCCAGAGG 0: 1
1: 0
2: 2
3: 11
4: 143
1077014290_1077014300 1 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014300 11:393101-393123 TCCCCACCCCCATCTACCAGGGG 0: 1
1: 0
2: 8
3: 32
4: 300
1077014290_1077014310 21 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014310 11:393121-393143 GGGCTTGTCCCAGAGGCTAGAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1077014290_1077014311 22 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014311 11:393122-393144 GGCTTGTCCCAGAGGCTAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 119
1077014290_1077014298 -1 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014298 11:393099-393121 TATCCCCACCCCCATCTACCAGG 0: 1
1: 1
2: 4
3: 25
4: 228
1077014290_1077014299 0 Left 1077014290 11:393077-393099 CCACCCCCAGCCCTCCTAGGCTT 0: 1
1: 0
2: 8
3: 59
4: 604
Right 1077014299 11:393100-393122 ATCCCCACCCCCATCTACCAGGG 0: 1
1: 0
2: 1
3: 38
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077014290 Original CRISPR AAGCCTAGGAGGGCTGGGGG TGG (reversed) Intronic
900186378 1:1335028-1335050 GAGCCCAGGTGGGGTGGGGGCGG + Exonic
900529367 1:3145179-3145201 AACCCAAAGAGGGGTGGGGGCGG - Intronic
900802756 1:4747508-4747530 GTGCCTAGGAGGGAAGGGGGCGG - Intronic
901441941 1:9283330-9283352 AAGCCCAGGAGATCTGGGTGAGG - Intergenic
901475860 1:9488790-9488812 AAGAATAGGAAGGCTGGGCGCGG + Intergenic
901690448 1:10969814-10969836 GAGCCTGGAAGGGCTGTGGGGGG + Intronic
901720948 1:11197030-11197052 AAGCCTGTGGGGGTTGGGGGAGG + Intronic
901789992 1:11648998-11649020 CAGCCCAGGAGCGCTGTGGGCGG + Intronic
902365635 1:15972114-15972136 ATACCTTGGAGGGCTGGTGGAGG - Intronic
902448703 1:16483779-16483801 GAGCCTGGGAGCCCTGGGGGTGG - Intergenic
902468080 1:16630435-16630457 GAGCCTGGGAGCCCTGGGGGTGG - Intergenic
902506077 1:16939581-16939603 GAGCCTAGGAGCCCTGGGGGTGG + Intronic
902523704 1:17039506-17039528 GAGCCTAGGAGGTCTCAGGGAGG + Intronic
903625946 1:24730308-24730330 AAGCGGAGGAGGGGAGGGGGAGG + Intergenic
904011601 1:27393213-27393235 AAGTCTGGGAGGGTGGGGGGTGG + Intronic
904035691 1:27557338-27557360 AGGCCTAGTGGGGCTGGAGGAGG - Intronic
904042503 1:27592799-27592821 TAACCTGTGAGGGCTGGGGGTGG + Intronic
904253478 1:29240217-29240239 TAGCCTAGGAAGTCGGGGGGTGG + Intronic
904337794 1:29809440-29809462 AAGAGTAGGGGGGGTGGGGGTGG + Intergenic
904621064 1:31775612-31775634 AAGCCTAGGGTGGCGGTGGGGGG + Intergenic
905653283 1:39670870-39670892 GAGCCTAGGGGAGTTGGGGGGGG - Intronic
906518253 1:46452250-46452272 AAGCAGAGTGGGGCTGGGGGTGG + Intergenic
906636362 1:47412936-47412958 AATCCTGGGAAGGGTGGGGGTGG - Intergenic
907319611 1:53594350-53594372 AAGCCTTGGAGGCCTGGGGCTGG - Exonic
907323556 1:53620664-53620686 TAAACAAGGAGGGCTGGGGGTGG + Intronic
907454258 1:54565066-54565088 AGGCCAAGGAGGGCCTGGGGTGG - Intronic
908460638 1:64345547-64345569 GAGCTAAGGAGGGGTGGGGGTGG - Intergenic
910957402 1:92721526-92721548 AAGGGGTGGAGGGCTGGGGGAGG + Intronic
911072248 1:93841506-93841528 AAGCCTAGTAGGGCTCAGGAAGG - Intronic
911076512 1:93880492-93880514 AAGATCAGGAGGGCTGGGCGAGG - Intergenic
912209532 1:107543362-107543384 TAGCTCAGGAGGGCTGGGTGTGG + Intergenic
912557441 1:110526362-110526384 AAGACAAGGAGGGCTGGAGGGGG + Intergenic
912798037 1:112704761-112704783 AGGCCTAGGAGGAAGGGGGGAGG - Intronic
913645585 1:120851068-120851090 AGGGCTAGGAGGGCTGGGGGGGG - Intergenic
914001668 1:143699724-143699746 AGGGCTAGGAGGGCTCCGGGTGG - Intergenic
914004508 1:143720739-143720761 AGGGCTAGAAGGGCTTGGGGTGG - Intergenic
914005572 1:143729664-143729686 AGGGCTAGGAGGGCTGGGGGTGG - Intergenic
914081124 1:144412458-144412480 AGGGCTAGGAGGGCTGGGGGCGG + Intergenic
914096246 1:144546633-144546655 AGGGCTAGGAGGGCTCGGGGTGG - Intergenic
914098037 1:144560910-144560932 AGGGCTAGGAGGGCTGGGGGGGG - Intergenic
914134135 1:144883836-144883858 AAGCCGAGGCGGGGTGGGGGGGG + Intergenic
914134175 1:144883933-144883955 AAGCCGAGGCGGGGTGGGGGGGG + Intergenic
914176039 1:145280992-145281014 AGGGCTAGGAGGGCTGTGGGCGG + Intergenic
914300940 1:146376690-146376712 AGGGCTAGGAGGGCTGGGGGTGG + Intergenic
914302275 1:146387330-146387352 AGGGCTAGGAGGGCTGGGGGTGG + Intergenic
914393918 1:147246416-147246438 ATGCCTAGGAGTGCTGTGAGTGG + Intronic
914461640 1:147890876-147890898 AAGCCTAGGGTGGGTGGAGGAGG + Intergenic
914514513 1:148362629-148362651 AGGGCTAGGAGGGCTGGGGGTGG - Intergenic
914517458 1:148386057-148386079 AGGGCTAGGAGGGCTCAGGGTGG - Intergenic
914530760 1:148522474-148522496 AGGGCTAGGAGGGCTGTGGGTGG + Intergenic
915141711 1:153772199-153772221 CAGCCTGGGAGGGCTGGGGTTGG - Intronic
915222909 1:154389367-154389389 AAACCTAGGAGAGCTGATGGTGG + Intergenic
915283891 1:154840919-154840941 AAGCCTAAGATGGCAGGGTGCGG - Intronic
915365258 1:155311576-155311598 AAGTCTAGGAGAGGTGGGGATGG + Intronic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
916058284 1:161082728-161082750 AAGCCTGGGAGGGGTGCGGGTGG - Intronic
916860243 1:168795733-168795755 TAGCCTGGGAGGGGTGGGGCTGG - Intergenic
916889484 1:169102632-169102654 AAGACAAAGAGGGCTGGGAGAGG - Intergenic
918066449 1:181105140-181105162 GAGGTCAGGAGGGCTGGGGGCGG + Intergenic
918429226 1:184441129-184441151 ATGCCTAGGTGTGCTGGGAGTGG - Intronic
918955864 1:191205945-191205967 ATGCCTAGGAGGCCTAGGGCTGG + Intergenic
919905676 1:202076774-202076796 AAGTCTAAGAGGGCTGTGGTGGG + Intergenic
920443569 1:205998494-205998516 AACCCTAGGAGAGTTGGAGGAGG + Intronic
920693541 1:208164714-208164736 AAGGCGAGGAGGGCTGGGTTTGG - Intronic
921193303 1:212728858-212728880 AAGACTGGGAGTGCTGGGGGTGG + Intronic
921264644 1:213412082-213412104 AAGCCTGGGTGGGCAGAGGGTGG + Intergenic
922029216 1:221781901-221781923 AAGCCTAGGAGACCTGTGTGTGG + Intergenic
922439988 1:225646934-225646956 AAACAAAGCAGGGCTGGGGGCGG + Intronic
922731998 1:227953474-227953496 AGGCCTCGGAGAGCAGGGGGAGG + Intergenic
923267640 1:232329927-232329949 AAGCCTAGGAGAGATTTGGGTGG + Intergenic
923787615 1:237083385-237083407 AAGGCTAGAAGTGCTGAGGGAGG - Intronic
924499815 1:244626746-244626768 AATTCTAGGAAGGCTGAGGGAGG - Intronic
924601941 1:245498747-245498769 AAACCCAGGAGGGCAGTGGGTGG - Intronic
1063429350 10:5976256-5976278 AAGCCTCGCAGAGCTGGGGTGGG + Intronic
1063477331 10:6340611-6340633 GAGCCCAGGATGGCTGGGGCAGG + Intergenic
1063706242 10:8433537-8433559 AATCCTTGGGGGGCTGAGGGAGG + Intergenic
1063747205 10:8898150-8898172 AGGCCTAGGAGGGGTGGGAAAGG - Intergenic
1064029490 10:11874932-11874954 AAGCCCCAGAGGCCTGGGGGAGG - Intergenic
1064532537 10:16324875-16324897 ATGCTTAGGAGGGATGGGTGGGG - Intergenic
1064619932 10:17204742-17204764 AAGAGTGGGAGGGCTGGTGGAGG + Intergenic
1064832848 10:19490493-19490515 AAGCCAAGTGGGGCGGGGGGGGG + Intronic
1066956284 10:42177084-42177106 AAGCCGGGGAGGGGCGGGGGGGG - Intergenic
1067296653 10:44978621-44978643 GAGCTGAGGAGGTCTGGGGGTGG + Exonic
1067428402 10:46226425-46226447 AAGTGTAGGAGGGCTGGGCTGGG - Intergenic
1067582473 10:47454313-47454335 AAGCCTGGGAAGGATGGGGAAGG - Intergenic
1069178650 10:65327278-65327300 AAGCCAGGGCGGGTTGGGGGTGG - Intergenic
1069204140 10:65660559-65660581 AAGCCTAGGAGGACCTGGTGTGG + Intergenic
1069994872 10:72335989-72336011 AAGCCTGCGAGGGCTGTGGAGGG + Intronic
1070308034 10:75251405-75251427 AGGCCAAGGAGGGGTGGGCGTGG + Intergenic
1070798587 10:79231539-79231561 CAGCCTAGGAAGCCTGGTGGGGG + Intronic
1070970747 10:80565307-80565329 AAGGGTAGTGGGGCTGGGGGTGG - Intronic
1071480038 10:86058176-86058198 TTCCATAGGAGGGCTGGGGGAGG - Intronic
1071888628 10:89978204-89978226 AAGCCAAGGGGGGTTTGGGGAGG + Intergenic
1071896912 10:90077649-90077671 AAGCCAAATAGGGCTGGGCGCGG + Intergenic
1072771778 10:98146464-98146486 AAGCCAAGAAGGGGTGGGGATGG - Intronic
1072897184 10:99377008-99377030 AAGACAAGGAGGGATGGGTGGGG - Intronic
1073070591 10:100790853-100790875 AAGGCATAGAGGGCTGGGGGAGG + Intronic
1073220448 10:101867846-101867868 AAGCCATGAAAGGCTGGGGGTGG + Intronic
1073378640 10:103059849-103059871 AAGCTTATGTGGGCTGGGTGTGG + Intronic
1074113983 10:110442128-110442150 AGGGTCAGGAGGGCTGGGGGAGG - Intergenic
1074199545 10:111222697-111222719 GAAACTAGGAGGGCTTGGGGTGG - Intergenic
1075486743 10:122828902-122828924 AAGAGAAGGAGTGCTGGGGGAGG - Intergenic
1075521758 10:123147712-123147734 AAGGGGTGGAGGGCTGGGGGAGG + Intergenic
1075686244 10:124367179-124367201 AAGGCTAGGGTGTCTGGGGGAGG - Intergenic
1076549943 10:131271765-131271787 AAGCCCAGGATGGCTGGTGAGGG + Intronic
1076568501 10:131415041-131415063 AAGACTAAGATGGTTGGGGGTGG + Intergenic
1076799094 10:132812444-132812466 GAGCCCAGGAAGGCTGGGGTGGG - Intronic
1076877261 10:133221989-133222011 AACCCTAGGTGGGCCGGGCGCGG + Intronic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077062397 11:623649-623671 GAGCCGTGGAGGGCTGGGGTGGG + Intronic
1077086591 11:755432-755454 AAGCCAAGGGGAGCTGGGCGCGG - Intronic
1077407004 11:2387138-2387160 CAGCCAGGGAGGGCTGGGGGTGG + Intronic
1077638549 11:3860551-3860573 CTGCCTGGGAGAGCTGGGGGAGG + Intronic
1077985694 11:7348956-7348978 ACAGCTAGGCGGGCTGGGGGTGG + Intronic
1081534103 11:43984937-43984959 ATGCCAGGGAGGGCTGGGGAAGG + Intergenic
1082969040 11:58999775-58999797 AAGCCTAGGAGGACTTAGGATGG + Intronic
1083226853 11:61290771-61290793 ACGCCTGGGAGTGGTGGGGGAGG - Intronic
1083731161 11:64653475-64653497 GAGCCAAGGAGAGCTGGGGGAGG - Intronic
1083843170 11:65315834-65315856 AGGTCTAGGAGGGCGGGAGGAGG + Intronic
1083882432 11:65555179-65555201 AAGCCAAGGAGGGGTCTGGGTGG - Intronic
1083911234 11:65711471-65711493 AAGCCTAATATGGCTGAGGGCGG + Intergenic
1084182711 11:67454715-67454737 AGGCCCATCAGGGCTGGGGGAGG - Intronic
1084421274 11:69061817-69061839 AATCCTGAGAGGGCTGGGGTGGG + Intronic
1084660034 11:70541358-70541380 AAGCCAAGGATGGTTGGTGGGGG - Intronic
1084805603 11:71576872-71576894 AAGCCATGGGGGGCTGGGGGCGG - Intergenic
1084931788 11:72561885-72561907 ATGCCTATGTGGGCTGTGGGAGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1088989057 11:114935620-114935642 AAGCCCTGGAGAGCAGGGGGAGG + Intergenic
1089472891 11:118735128-118735150 AAGTAAAGGAGGGCTGGGCGCGG - Intergenic
1089578955 11:119469533-119469555 ATGCCCAGGAGGGCCGGGGTGGG - Intergenic
1089750717 11:120649208-120649230 ACACCTGGGAGGGCTGAGGGGGG + Intronic
1090192875 11:124787812-124787834 AAGCCAATTAGTGCTGGGGGTGG + Intronic
1090807429 11:130211155-130211177 AAATCTAGGGAGGCTGGGGGTGG - Intergenic
1091286102 11:134409404-134409426 AGGACCAGGAGGGCTGGGGCAGG + Intronic
1091827435 12:3523446-3523468 AATCCTGGGTGGGCTTGGGGTGG - Intronic
1092114363 12:5988381-5988403 TGGCCTCGGAGGGCTGGGGCAGG + Intronic
1093990405 12:25583706-25583728 GAGCCTAGTAAGGCTGGGAGAGG + Intronic
1095444129 12:42267791-42267813 AGGCCAAGGGGGGCTGAGGGTGG - Intronic
1095729729 12:45493407-45493429 AAGGCCACGAGGGCTGGAGGCGG + Intergenic
1095922861 12:47548210-47548232 AAGTCTATGAAGGCTGAGGGAGG - Intergenic
1096178274 12:49537568-49537590 AAGCCTTGAACGGCTGGGGGAGG + Intergenic
1096871305 12:54594111-54594133 AAGCCTGGGAGGACGGGGGAAGG - Intergenic
1097641919 12:62192228-62192250 ATGCCTAGAAGGGCAGCGGGTGG - Exonic
1101338006 12:103813918-103813940 CAGCAAAGGAGGGCTGAGGGTGG - Intronic
1101968843 12:109298651-109298673 AACCTTAGAAGGGCTGGGCGTGG - Intronic
1102014302 12:109637662-109637684 AACCCTGGGTGGGCTTGGGGTGG + Intergenic
1102424395 12:112829560-112829582 AAGCCTTTGTAGGCTGGGGGTGG - Intronic
1102458870 12:113087796-113087818 AAGTCTAGGCCTGCTGGGGGTGG + Intronic
1102467074 12:113136037-113136059 TAGGCAAGGAGGGGTGGGGGCGG - Intronic
1103979450 12:124726954-124726976 AAGCCGGGGTGGGGTGGGGGTGG - Intergenic
1104013694 12:124949072-124949094 AGGCCTCGGTGGGCAGGGGGTGG - Intronic
1104107430 12:125676496-125676518 AAGGCTAGGGGAGCTGGGGAGGG + Intergenic
1104162147 12:126191310-126191332 AAGCACAGGTGGGCTGGGCGCGG + Intergenic
1104256730 12:127146132-127146154 ACGGCTAGGAGGGCGGGGGCGGG - Intergenic
1106019536 13:25901128-25901150 AAGCCCATGAGGGCTAAGGGAGG + Intronic
1106187464 13:27421993-27422015 AAGCCTAGCAGAGGTGGGGAAGG + Intergenic
1109243277 13:59918607-59918629 AAGCCTAGAAGTGCTTTGGGTGG - Intronic
1110031455 13:70619603-70619625 AAAGCTATGAAGGCTGGGGGCGG + Intergenic
1113143732 13:107183842-107183864 GAGGGGAGGAGGGCTGGGGGAGG + Intronic
1113901718 13:113801552-113801574 GAGCCCTGCAGGGCTGGGGGAGG - Intronic
1114460537 14:22883594-22883616 AGCCCTGGGAGTGCTGGGGGAGG - Intronic
1116157506 14:41225814-41225836 AAAGCTTGGAGGGCTGGAGGAGG + Intergenic
1117449843 14:55839741-55839763 AGCCCACGGAGGGCTGGGGGAGG - Intergenic
1118319117 14:64743043-64743065 CAGCCGAGGAGGGCTTGGGAGGG - Exonic
1118877669 14:69798311-69798333 GAACCTAGGAGGCCTGGGTGGGG + Intergenic
1119544030 14:75459087-75459109 AAGCCTTGGAGGGCAGAGGTTGG + Intronic
1119967363 14:78931854-78931876 AAGCCAAGGAAGGCTGGGCGCGG + Intronic
1121846685 14:97178214-97178236 CAGGCCAGGTGGGCTGGGGGTGG - Intergenic
1122131374 14:99605873-99605895 AAGGCCAGTGGGGCTGGGGGTGG + Intergenic
1122885190 14:104707642-104707664 AGGCCTGGCAGGGGTGGGGGCGG - Exonic
1122917697 14:104866335-104866357 AGGCCTAGGAGGGCTGGCTGGGG + Intronic
1123009228 14:105339214-105339236 AAGACTAGCAGGGTTGGGTGTGG + Intronic
1123938795 15:25206805-25206827 AAGCCCAGCAGGGGTGGTGGTGG + Intergenic
1124348746 15:28940220-28940242 AAGCCTCGGGAGGCTGGGCGTGG + Intronic
1125520067 15:40343540-40343562 AAGCCTGGCGGAGCTGGGGGAGG - Intergenic
1127503288 15:59574780-59574802 AGGCCGAGGAGGGGTGGGGGCGG - Intergenic
1128129346 15:65215195-65215217 AGGCCTTGGAGGCCTGTGGGGGG + Intergenic
1128733471 15:70035865-70035887 AAGCTGAGGAGGGGTGGTGGAGG + Intergenic
1129318797 15:74762490-74762512 AAGCTGGGGAGGGCTGGGGGTGG + Intergenic
1129324553 15:74793320-74793342 AAGCCTAGGAGCGGTCGGGGTGG - Intronic
1129702103 15:77774035-77774057 CAGCCAAGGAGGGCAGTGGGTGG - Intronic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1129933072 15:79428335-79428357 GAGGCAAGGAGGGATGGGGGAGG - Intergenic
1130103493 15:80911962-80911984 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103517 15:80912067-80912089 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130601895 15:85281240-85281262 TCTCCTAGGAGGGCCGGGGGAGG - Intergenic
1130635307 15:85613383-85613405 AATCTTAGGAGTGCTGGGGCCGG + Intronic
1130918231 15:88322791-88322813 AGGCCTGGGAGGGCTCAGGGTGG + Intergenic
1131086700 15:89581629-89581651 ATGCCTAGAAGGAGTGGGGGTGG + Intronic
1131120137 15:89817203-89817225 TAGCCTAAGTGGGCTGGGCGTGG + Intergenic
1131620959 15:94067651-94067673 AAGCCTGTGGGGGCGGGGGGCGG + Intergenic
1132392158 15:101447117-101447139 AAGCCTAGAAGGGCTTAGGTGGG - Intronic
1132625175 16:888147-888169 AAGCCTTGGGGTGCAGGGGGTGG + Intronic
1132629556 16:910594-910616 AAGCAAAGGAGGGCTGGTGGGGG + Intronic
1132629564 16:910617-910639 AAGCTCAGGAGGGCTGGTGGGGG + Intronic
1132934790 16:2474910-2474932 AAGCCAAGGGGGGCGGGGGGTGG - Intergenic
1133184661 16:4086948-4086970 AAGCTTTGGAGGGCTGGGCGTGG - Intronic
1133190514 16:4130338-4130360 AAGCTGTGGAGGGCTGGGTGTGG + Intergenic
1133240771 16:4413052-4413074 ATGGCCAGGAGGGCTGGGAGGGG - Intronic
1134002326 16:10792469-10792491 TAGCTCAGGAGGCCTGGGGGTGG - Intronic
1134028755 16:10975050-10975072 AAGTAGAGGAGGGCTGGGTGCGG + Intronic
1134077134 16:11299886-11299908 CAGCCTAGGAAGGCTGGGCCAGG + Intronic
1136228910 16:28875853-28875875 AAGGCTGGCAGGGCTGGGGGAGG - Intergenic
1137334416 16:47533707-47533729 AAGCCTGCGAGGGCAGGGAGGGG + Intronic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1137584254 16:49654531-49654553 AAGCCCGGGAGGGCTGGGAATGG + Intronic
1137613628 16:49834880-49834902 GGGCCCAGGAGGGCTGGGGGAGG + Intronic
1137713856 16:50585653-50585675 AAGACTCTGAGGGCTGGGGCGGG - Intronic
1137986351 16:53111262-53111284 ATGCCTGGGAGAGCTGGGGAGGG + Intronic
1138596372 16:58031381-58031403 AAGGCTGGGTGGGCCGGGGGAGG - Intronic
1139390070 16:66601769-66601791 GAGCCTGGGAGGGCAGGTGGGGG + Intergenic
1139664987 16:68448852-68448874 CAGCCGAGGATGGCTGGCGGAGG + Intergenic
1139789814 16:69424611-69424633 AAGCCGAGGAAGGCTGAGCGCGG + Exonic
1141656534 16:85419762-85419784 GAGTCTTGGAGGGGTGGGGGCGG - Intergenic
1141666550 16:85468610-85468632 GGCCCTACGAGGGCTGGGGGTGG - Intergenic
1141694804 16:85614216-85614238 GGGCCCGGGAGGGCTGGGGGCGG - Intronic
1141774225 16:86111495-86111517 AAGCCCAGGAGGGCTTAGGAAGG + Intergenic
1141910112 16:87053123-87053145 CAGCTGGGGAGGGCTGGGGGCGG - Intergenic
1142160471 16:88554905-88554927 AGGCCCAGCTGGGCTGGGGGTGG - Intergenic
1142292972 16:89201205-89201227 GGGCCTCGGCGGGCTGGGGGCGG + Exonic
1142681206 17:1549963-1549985 AAACCAAGGACGGCTGGGCGCGG - Intronic
1142782257 17:2190359-2190381 AAGGCTAGAAGGGATGGAGGGGG + Intronic
1142809032 17:2386768-2386790 TCCCCTAGGAGGCCTGGGGGTGG + Exonic
1142912286 17:3104575-3104597 TACCCTAGGAAGGCTGGGTGTGG + Intergenic
1143125108 17:4636862-4636884 CAGCCCAGGAGGGATTGGGGAGG - Intronic
1143230288 17:5348267-5348289 AAGCCTATCTGGGCTGGGCGTGG - Intronic
1143630888 17:8139797-8139819 AAGCCAAGGAAGGCCGGGCGCGG + Intergenic
1143636234 17:8165112-8165134 CAGCCTAGGTGGGGTGGGGTGGG - Intergenic
1143652277 17:8270763-8270785 AGGGCTAGGAGAGCTGGGTGGGG + Intergenic
1143770154 17:9163310-9163332 AAGCCCAGGAGGGGGAGGGGAGG - Intronic
1144702176 17:17347084-17347106 AGGCCTGGCAGGGCTGGGGAAGG - Exonic
1144799351 17:17914379-17914401 AGGCCTAGGAAGAATGGGGGTGG - Intronic
1144936030 17:18899824-18899846 AAGCTCAGTTGGGCTGGGGGTGG - Intronic
1145065091 17:19756757-19756779 AGGTCGAGAAGGGCTGGGGGCGG - Intergenic
1145415089 17:22708283-22708305 ATGCAAAGGAGGGATGGGGGAGG - Intergenic
1145975127 17:28979473-28979495 AAGCCAAGAGGGGCTGTGGGAGG - Intronic
1146167507 17:30601099-30601121 AAGCCGAGGATGACTCGGGGAGG + Intergenic
1146219913 17:31008987-31009009 AAGCCGAGGATGACTTGGGGAGG + Intergenic
1146283538 17:31559822-31559844 AACCCTTGGAGGGCTGGGTTTGG + Intergenic
1146284486 17:31565212-31565234 GAGGATGGGAGGGCTGGGGGAGG + Intergenic
1146652187 17:34613722-34613744 TACCCATGGAGGGCTGGGGGAGG - Intronic
1146675639 17:34772142-34772164 CTGCCAAGGAGGGCTGGGGTTGG + Intergenic
1146687936 17:34854140-34854162 CAGCCAAGCAGAGCTGGGGGTGG - Intergenic
1147191290 17:38739517-38739539 GAGCGTGGGAGGGATGGGGGAGG + Intronic
1147454588 17:40529178-40529200 AAGCCAAGAAGCGCTGAGGGCGG + Intergenic
1147491067 17:40866889-40866911 TAGCTTTGGAGGGCTGGGGATGG - Exonic
1147650127 17:42057265-42057287 GTGCCTAGGATGGCTGGGTGAGG + Intronic
1147918129 17:43900619-43900641 AAGCCTGGCCGGGCTGGGGAAGG + Intronic
1147947242 17:44086966-44086988 GAGGCTGGGAGGGGTGGGGGCGG + Intronic
1147954291 17:44123701-44123723 AAGGCGGGGGGGGCTGGGGGGGG - Intronic
1148124314 17:45229089-45229111 GGCCCTTGGAGGGCTGGGGGAGG + Intronic
1148199349 17:45739788-45739810 AACCTTAGGAGGGCAGAGGGAGG - Intergenic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148429540 17:47631317-47631339 AAGCAAAAGAGGGCTGGGCGCGG + Intergenic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1148809346 17:50280243-50280265 AAGCCCAGGAGAGCAGTGGGTGG + Exonic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1150373425 17:64661623-64661645 AAGCCGAGGATGACTCGGGGCGG - Intronic
1150441502 17:65195226-65195248 TGTCCTAGGAGGGCTTGGGGAGG + Intronic
1150778790 17:68102143-68102165 AAGCCGAGGATGACTCGGGGCGG + Intergenic
1151316433 17:73325353-73325375 AAATCTAAGACGGCTGGGGGAGG + Intergenic
1151473591 17:74332651-74332673 TAGGCCAGGAGGGCTGGGTGAGG + Intronic
1151557541 17:74854281-74854303 AACCCTGGGAGCCCTGGGGGAGG - Intronic
1151658939 17:75508535-75508557 GAGCCAAAGAGGGCGGGGGGTGG + Intronic
1151772711 17:76175533-76175555 CAGCCTAGGAAAGTTGGGGGAGG - Intronic
1151822190 17:76502314-76502336 CAGGCTTGGAGGGGTGGGGGTGG + Intergenic
1151824640 17:76517519-76517541 AGGGGTAGGAGGGGTGGGGGTGG - Intergenic
1151971522 17:77459964-77459986 GAGTCTGGGAGGGCTGGGTGAGG - Intronic
1152146793 17:78573196-78573218 AAGCCTAGGAGGACTGTGATGGG + Intronic
1152300700 17:79493898-79493920 AAACATAGCTGGGCTGGGGGAGG + Intronic
1152391959 17:80008642-80008664 AACCCGAGGAGGTGTGGGGGAGG - Intronic
1152477840 17:80529761-80529783 AAGCTAAGGAAGGCTGGGTGTGG + Intergenic
1152571766 17:81124154-81124176 AAGCCCGGGAGTGGTGGGGGCGG + Intronic
1152624698 17:81382956-81382978 GTGCCTGGGAGAGCTGGGGGTGG - Intergenic
1152890876 17:82881030-82881052 AGGCTTCTGAGGGCTGGGGGAGG - Intronic
1153120682 18:1722832-1722854 GGGCCTTGGAGGGTTGGGGGTGG - Intergenic
1153532213 18:6058666-6058688 AAGCCTGGCAGTGCTGTGGGAGG + Intronic
1153970911 18:10226174-10226196 AAGCTTGGGGGGGCAGGGGGCGG - Intergenic
1154122962 18:11666400-11666422 AAGACGGAGAGGGCTGGGGGAGG - Intergenic
1154247234 18:12709924-12709946 AAGTTTATGAGGGCTGGGCGTGG - Intronic
1155621431 18:27784842-27784864 AAGCATAGCAGGGCTAGGAGGGG + Intergenic
1155918809 18:31582120-31582142 AAGCCTTGATGGCCTGGGGGAGG + Intergenic
1155964087 18:32019585-32019607 AAGGGTAGCAGGGGTGGGGGTGG - Intronic
1156786478 18:40921409-40921431 AAGCTTCAGAGGGCTGGGGTAGG - Intergenic
1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG + Intronic
1157464274 18:47930730-47930752 AAGCGGAGGTGGGCTGGCGGGGG - Intronic
1157465555 18:47941714-47941736 ATGCCAAGGAAGGCTGGGTGTGG + Intergenic
1157491080 18:48124252-48124274 AAGCCTGGGATGGCAGGCGGTGG + Intronic
1157529228 18:48408140-48408162 AGGCCGAGGGGAGCTGGGGGTGG - Intronic
1157578354 18:48758705-48758727 ATGCCTGGGAGTGATGGGGGAGG + Intronic
1157821650 18:50775779-50775801 AAGTCCAGGAGCGATGGGGGTGG - Intergenic
1158403154 18:57139349-57139371 AAGCCCAGGAGGGCTGGCCAAGG - Intergenic
1159074567 18:63665901-63665923 AAGCCTAGGAGCGCTACGGGAGG - Intronic
1159869315 18:73742799-73742821 AAGCCTAGCAGGGATTGGGTTGG + Intergenic
1160060449 18:75524872-75524894 AAGCCTCGGTGGGATGGAGGAGG - Intergenic
1160335640 18:78036200-78036222 AAGCCAAAGAGGGCCGGGCGCGG - Intergenic
1160676298 19:393133-393155 AAGCAAAGGAGAGTTGGGGGAGG + Intergenic
1160680242 19:408920-408942 GAGTCGGGGAGGGCTGGGGGCGG - Intronic
1160748653 19:723278-723300 CAGGCTGAGAGGGCTGGGGGTGG + Intronic
1160864683 19:1251431-1251453 AAGCCGGGAAGGGGTGGGGGTGG + Intronic
1161031370 19:2059311-2059333 AACCCTACGGGGGCGGGGGGCGG + Intergenic
1161811472 19:6473784-6473806 AAGCCCGGGAGGGGTGTGGGCGG + Intronic
1161834800 19:6638570-6638592 AAGCGTGGGAGGGCCGGGCGCGG + Intergenic
1161853794 19:6752762-6752784 AAGGTCAGGTGGGCTGGGGGCGG + Intronic
1161962889 19:7532469-7532491 AGGCCGAGGGGGGGTGGGGGTGG + Intronic
1162199335 19:9009523-9009545 CAGCGTGGGAGGGCTGTGGGAGG - Intergenic
1162382428 19:10339504-10339526 AAGCCGGGGAGGGCTGGAGAGGG - Intronic
1162405636 19:10471582-10471604 CAGCCTAACAGGGCTGGGTGTGG - Intergenic
1162474956 19:10894251-10894273 CAGCATGGGAGGGCCGGGGGTGG + Intronic
1162720229 19:12657666-12657688 AACTCGAGGACGGCTGGGGGCGG + Intronic
1162764239 19:12908612-12908634 AAGCCCAGGATGGCCGGGCGCGG - Intronic
1163010659 19:14423556-14423578 AGGCCAGGGAGGGGTGGGGGTGG + Intergenic
1163021452 19:14482889-14482911 AGGCCGTGGAGGGCTGGGCGTGG - Exonic
1163118346 19:15201014-15201036 GAGCCTTCGAGGGCTGGGGGCGG - Intergenic
1163231116 19:16002996-16003018 CAACCCAGAAGGGCTGGGGGTGG - Intergenic
1163245777 19:16093143-16093165 AAGAAAAGGAGGGCTGGGTGTGG - Intronic
1163275226 19:16279438-16279460 AAGTCAAGGAGGGCTGGGCACGG + Intergenic
1163663242 19:18590785-18590807 CATCCTTGGAGGGCAGGGGGTGG + Intronic
1163722698 19:18905808-18905830 AGGCCCAGGAGCTCTGGGGGAGG + Intronic
1163819296 19:19487108-19487130 AAGTCTATGATGGCTGGGGATGG - Intronic
1164247581 19:23446667-23446689 AAGACAAAGAGGGCTGGGTGCGG + Intergenic
1165331054 19:35141352-35141374 AGGCCTGGGAGGGGTTGGGGCGG - Intronic
1165390260 19:35534580-35534602 AAGGCTGGGAGTGCTGGGAGAGG + Intronic
1165413666 19:35677915-35677937 CAGGCTGGGTGGGCTGGGGGTGG + Intronic
1166395933 19:42441174-42441196 CAGCCTAGAAGGACAGGGGGTGG + Intronic
1166793791 19:45414087-45414109 GAGCCTAGGAGGGCAGGGCTGGG + Intronic
1167150355 19:47705461-47705483 AAAGCTAGAAGGGCTGGGCGCGG - Intergenic
1167612773 19:50515282-50515304 AGGCCCTGGAGGGCTGGGGCTGG - Intergenic
1167620558 19:50557683-50557705 AGGGCTGGGAGGGCTGGGTGGGG + Intronic
1168326213 19:55539765-55539787 AGGCCAGAGAGGGCTGGGGGTGG + Intergenic
925507296 2:4582869-4582891 TGGCCTAGGTGGGGTGGGGGTGG - Intergenic
925915655 2:8603589-8603611 AAGGGAAGGAGGGCTGGGCGTGG + Intergenic
925981370 2:9180079-9180101 AAGCCTGGGAGGGTCAGGGGAGG - Intergenic
926171152 2:10553304-10553326 AAGTGTAGGGGGGCTGTGGGGGG - Intergenic
926311788 2:11680555-11680577 CAGCCTGGCAGGGCTGGAGGAGG + Intronic
926348154 2:11968370-11968392 ATCCCCAGGAGGCCTGGGGGTGG + Intergenic
926871110 2:17418279-17418301 CAGCCTGGGAAGGATGGGGGAGG + Intergenic
926929752 2:18024876-18024898 AAGCCTAGGTGGGCTGTGTGGGG - Intronic
927420594 2:22926442-22926464 AAGCCAAGGTGGGTTGGGTGCGG - Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927823263 2:26287974-26287996 AAGCCAGAGAGGGCTGGGTGCGG + Intronic
928170483 2:28999945-28999967 AAACGGAGGAGGGGTGGGGGAGG - Intronic
928182743 2:29080920-29080942 GAGGCCAGGAGGGCTGAGGGAGG - Intergenic
928244349 2:29614434-29614456 AAGCCTGGGAGGGCAGGGGCTGG - Intronic
928318957 2:30268346-30268368 AAGCCTGGGAGGGCTGGAGTAGG + Intronic
928897206 2:36279679-36279701 AAGCCTGGGAGCGCTGTAGGAGG - Intergenic
928983302 2:37157199-37157221 AACCCTAGGAGCCCCGGGGGCGG - Intergenic
929599319 2:43195036-43195058 CAGCCTCCGAGCGCTGGGGGCGG + Intergenic
931564546 2:63601720-63601742 GAGCCAAGGAGGACTGAGGGTGG + Intronic
932189662 2:69730209-69730231 AAACCCAGGAGGGCTGGGCATGG + Intronic
932282686 2:70508152-70508174 AAGACTAGGAGGGCTGGGCATGG + Intronic
933777034 2:85777326-85777348 CAGCCTATGAGGGCAGGGGTTGG + Intronic
935252489 2:101275729-101275751 AATACTAGGAGGGCCGGGCGCGG - Intronic
935488344 2:103686359-103686381 AGGCCAAGGCGGGCTGGGGTCGG + Intergenic
936350357 2:111707644-111707666 AAACTTAGGAGGGCTGGGCACGG - Intergenic
936656826 2:114498321-114498343 AAGCCTGGCAGGGGAGGGGGAGG - Intronic
937871496 2:126789352-126789374 AAGCCAAGGAGTGCTGTGAGGGG - Intergenic
938716567 2:134027349-134027371 AAGCCTGGGAGGACTGGGCAGGG + Intergenic
940377119 2:152969292-152969314 AAGGGTAGCAGGGCTGGAGGGGG + Intergenic
940910176 2:159203493-159203515 AAGCCTATCAAGGCTGGGCGTGG - Intronic
941700752 2:168601838-168601860 AAGGCCAAGAGGGCTGGGCGAGG - Intronic
942009028 2:171739950-171739972 AAGCCGAGGAGGGCTGAGGCAGG - Intronic
942182083 2:173389806-173389828 AAGCCAGGGAGTGCTGGGGAGGG + Intergenic
942401441 2:175608073-175608095 ATGCCTGGGAGGGGTGTGGGTGG - Intergenic
942413054 2:175731740-175731762 CAGCCTAAGAGGTCTGGGTGAGG - Intergenic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
944483555 2:200180823-200180845 AAGCCTAGAAGGACTGAGGCAGG - Intergenic
944488778 2:200235399-200235421 AAGTCAAGGAGGGCTGGGTGTGG - Intergenic
944777863 2:202987240-202987262 AAACATCGGGGGGCTGGGGGTGG - Intronic
945054801 2:205859218-205859240 AAGCCAAGCAGCGCTGGGGAGGG - Intergenic
945960966 2:216134670-216134692 AGGCCGAGGAGGGGGGGGGGTGG - Intronic
946163035 2:217847646-217847668 AGGCCCTGGAGGGCTGTGGGTGG + Exonic
946194265 2:218023783-218023805 AAAACAAGGAGGGCTGGTGGGGG - Intergenic
946217872 2:218199707-218199729 TAGCCAAGGTGGGCTGGGAGTGG + Intergenic
946636375 2:221732363-221732385 TTGGCTAGGAGAGCTGGGGGAGG - Intergenic
946696029 2:222360123-222360145 AAGCCTAGGAGTAGTGTGGGAGG - Intergenic
947534745 2:230933598-230933620 AAGCCTAAGGGGACTGAGGGTGG - Intronic
947710969 2:232315535-232315557 AAGCCTCAGAGAGCTGGGAGTGG - Intronic
948144588 2:235699073-235699095 GAGCCTAGGTGGGGTGGGGGGGG - Intronic
948514708 2:238496853-238496875 AGGGCAAGGAGGGCTGGGCGGGG + Intergenic
948953379 2:241269877-241269899 AAGCGTGGGAGGGCGGAGGGTGG - Intronic
949065227 2:241986254-241986276 AAGGATAGGAGGTGTGGGGGTGG - Intergenic
1169084964 20:2820910-2820932 AGGCCGAGTGGGGCTGGGGGTGG + Intergenic
1169316132 20:4592508-4592530 TAGGCTATGAGGGCAGGGGGTGG + Intergenic
1169376108 20:5067742-5067764 AAGCAGAGGGGGGCTGGGTGGGG - Intergenic
1169901833 20:10561376-10561398 AAGACTAGGAAGGATGGGGAAGG - Intronic
1170326243 20:15157365-15157387 AAGCCTGGGTGGCCGGGGGGGGG - Intronic
1171385090 20:24764501-24764523 AAGCCTAGTGGGGCTGCTGGGGG - Intergenic
1171448207 20:25219318-25219340 CAGCACAGGAGGGCTGTGGGGGG + Intronic
1171777435 20:29382246-29382268 AAGCCTGGGAGTGCTATGGGAGG - Intergenic
1172080681 20:32338379-32338401 AGGACTAGGAGGGCTGTGTGAGG - Intergenic
1172137517 20:32697275-32697297 AACCCAAGCAGGGCTGGGTGTGG + Intergenic
1172358630 20:34296962-34296984 TAGGGTAGGAGGGCTGGGGTGGG - Intronic
1172461288 20:35120885-35120907 AAGCAGAAGAGGGCTGGGTGTGG - Intronic
1172773862 20:37396318-37396340 CAGCCTCGGAGGGCGGAGGGCGG + Intronic
1172839993 20:37897115-37897137 AGGCCTAGGAGCCCTGCGGGAGG + Intergenic
1173588797 20:44208116-44208138 ATGCCCAAGAGGGGTGGGGGCGG - Intronic
1173619285 20:44424264-44424286 AAGCCCAGGAGGGGCGGGGTTGG + Intronic
1173902482 20:46601108-46601130 AGGCCTAGGGGAGATGGGGGTGG + Intronic
1174221103 20:48956304-48956326 TATCCTAGGAAGGCTGTGGGGGG - Intronic
1174568195 20:51482116-51482138 CAGACTTGGGGGGCTGGGGGTGG - Intronic
1175101144 20:56579667-56579689 AAGGCTGGGAGGGGTGGGTGAGG + Intergenic
1175568313 20:59998464-59998486 AAGACCAGGAGGGTTGGAGGGGG + Intronic
1175613890 20:60375869-60375891 AAGCCAAGAAGAGCTGGTGGGGG + Intergenic
1175853238 20:62104847-62104869 GAGCCCAGGGGGGCCGGGGGAGG + Intergenic
1175871135 20:62210056-62210078 AAGCCCAGCAGGGCTGGAGCAGG - Intergenic
1175890895 20:62315472-62315494 AAGCCCAGGAGAGATGGTGGGGG - Intronic
1176171655 20:63699041-63699063 AAGCATGGGAGGCCTGGAGGAGG - Exonic
1176198081 20:63846745-63846767 AACCCTGGGAGGGGTGGGGGCGG - Intergenic
1176390597 21:6161143-6161165 AAGCCTTGAAGGGTGGGGGGAGG + Intergenic
1177009209 21:15711364-15711386 AAGGCTAGGAAGGCTGGAAGAGG - Intergenic
1178673596 21:34613240-34613262 AAGACTTGGAGGGCAGGAGGAGG - Intronic
1178968521 21:37148013-37148035 AAGTCCAGGAAGGCTGGGCGTGG - Intronic
1179457426 21:41508643-41508665 CAGCCTAGGCGGACTGGGGAGGG - Intronic
1179626598 21:42652930-42652952 GAGCCCAGGAGAACTGGGGGCGG + Intergenic
1179732870 21:43377096-43377118 AAGCCTTGAAGGGTGGGGGGAGG - Intergenic
1179971419 21:44838199-44838221 GAGCCTAGGAGGGGTGGGCGGGG - Intergenic
1181013390 22:20055018-20055040 AAGCCTACCAGGGGTGGGGAAGG + Intronic
1181171374 22:21012044-21012066 AAGCCTATGAGGTCTTGTGGGGG + Intronic
1181573182 22:23778900-23778922 AGGCCAATGAGGTCTGGGGGTGG - Intronic
1181594008 22:23902752-23902774 AAGCTCAGGGAGGCTGGGGGTGG - Intergenic
1182926262 22:34128314-34128336 ATGCCTGGGAGGTCTGGGGTGGG + Intergenic
1183333233 22:37232464-37232486 AGCCCTGGGAGTGCTGGGGGAGG - Intronic
1183397544 22:37580791-37580813 AAGCAGAGGAGAGCTGGGCGCGG + Intronic
1183506346 22:38211183-38211205 AAGCCAAGTAGGGCTGAGGTTGG + Intronic
1183526443 22:38325991-38326013 CAGGCTGGCAGGGCTGGGGGCGG - Intronic
1183600442 22:38837102-38837124 AAGCCTGTGGGGGCTGGGCGCGG - Intronic
1183655174 22:39180259-39180281 AAGGCAAGGAGGGCCGGGCGCGG + Intergenic
1183929928 22:41230077-41230099 AACTCTGGGAGGGGTGGGGGCGG - Intronic
1184679219 22:46061460-46061482 AGGCCCAGGCGGGCTGCGGGAGG - Intronic
1184730957 22:46370773-46370795 AAGCCCTGGATGGCCGGGGGAGG + Intronic
1184923448 22:47621600-47621622 AATTCTAGGAGGGGTTGGGGTGG + Intergenic
1185189525 22:49425632-49425654 GACCCTTGGAGGGCTGTGGGTGG + Intronic
1185282798 22:49982930-49982952 AGGCCTAGGGGAGCTGGGGACGG + Intergenic
1185342787 22:50299172-50299194 AGGCCTGGGAGGGCAGGAGGGGG + Intronic
949509993 3:4759222-4759244 AGGACTTGCAGGGCTGGGGGAGG + Intronic
949540329 3:5027102-5027124 AGGCTTGGGAGGGGTGGGGGCGG + Intergenic
950127202 3:10517229-10517251 GAGCTGAGGAAGGCTGGGGGCGG + Intronic
950565672 3:13768296-13768318 AACCCCAGCTGGGCTGGGGGAGG + Intergenic
950575472 3:13829709-13829731 GAGACAAGGAGGGCAGGGGGAGG + Intronic
950727143 3:14923821-14923843 AAGGCTATGGGGGCTGGGGAGGG - Intronic
950940475 3:16885393-16885415 AATCCAAGGACGGCTGAGGGTGG - Intronic
951978974 3:28545028-28545050 AAGTCCAGCATGGCTGGGGGCGG - Intergenic
952240453 3:31526978-31527000 AAGCAGAGGAAGGCCGGGGGCGG - Intergenic
952902188 3:38117713-38117735 AGGGCTGGGAGGGCTGGGGGAGG - Intronic
953583497 3:44178355-44178377 TGGCCCTGGAGGGCTGGGGGTGG + Intergenic
953732570 3:45462917-45462939 AATCCTAGGAGGACTGGGTTGGG - Intronic
953944829 3:47137479-47137501 AATACTAGGAAGGCTGGGCGCGG - Intronic
954205274 3:49054256-49054278 AGGCCCAGGAGAGCTAGGGGAGG + Intronic
954317228 3:49807697-49807719 AGGCCTAGTAGGGCTAAGGGTGG + Intronic
954391283 3:50269311-50269333 AAGGCGTGGGGGGCTGGGGGCGG - Exonic
954417988 3:50403458-50403480 AAGCCAAGCAGGGCTGCAGGGGG - Intronic
954425294 3:50439914-50439936 CAGCCTAGAAGGGGTGGGTGAGG - Intronic
954550050 3:51473790-51473812 AAGACTAGCAAGGCTGGGTGTGG - Intronic
955174027 3:56594937-56594959 AACCCTAGGAGGGCTACTGGAGG - Intronic
955969741 3:64426413-64426435 AAGTCTTGGAGGGCTGGGCTAGG + Intronic
956418099 3:69054277-69054299 AAGCCGAGGGGGGCGGGGGGGGG + Intergenic
956652822 3:71521100-71521122 AAGGCTAGGTGGTGTGGGGGAGG + Intronic
956974712 3:74566293-74566315 AAGCGAAGGTGGCCTGGGGGTGG - Intergenic
958675232 3:97261160-97261182 AAACAAAGCAGGGCTGGGGGTGG + Intronic
958839189 3:99182953-99182975 AACATCAGGAGGGCTGGGGGCGG - Intergenic
959953486 3:112208905-112208927 AAGCCTAGGATGCATGGTGGTGG + Intronic
960005630 3:112777951-112777973 ACACTTAGGAGGGCAGGGGGAGG + Intronic
960385070 3:117012807-117012829 TAGTCTAGAAGGGCTGGGGTGGG + Intronic
962804245 3:138915692-138915714 AAGAGGAGGAGGGCTGGGGGAGG + Intergenic
962971004 3:140402008-140402030 ATGGCTAGGAGGGGTGGCGGCGG + Intronic
963346236 3:144099184-144099206 AGGCCAAGTAGGGCTGAGGGTGG + Intergenic
963410448 3:144921170-144921192 AAGCCTAGGAAGGCTGAGGAGGG - Intergenic
963787411 3:149548893-149548915 AAGTCATGGAGGGCTTGGGGAGG - Intronic
964646773 3:158967220-158967242 AAGCCTATCTGGGCTGGGTGTGG + Intronic
964756555 3:160094719-160094741 AAGGCCAGTAGGGCTGGGAGAGG - Intergenic
966624342 3:182000373-182000395 AAGGCTGGGCGGGGTGGGGGCGG - Intergenic
967278994 3:187804439-187804461 AAGCATGGGAGGGGTGGGTGGGG + Intergenic
967286875 3:187880175-187880197 AACCCTAGCATGGCTGGGTGTGG - Intergenic
967475457 3:189911578-189911600 AAGAGTAGGTGTGCTGGGGGTGG - Intergenic
967718390 3:192789308-192789330 GAGCCCAGGAGGGTTGGGGGAGG - Intergenic
968482087 4:837739-837761 ATGACTAGGATGGCTGGGTGGGG + Intergenic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969131462 4:4993844-4993866 AAGCTTGGGTGGGCTGGGTGCGG - Intergenic
969293935 4:6258057-6258079 AGCCATAGGAGGGCTGGGGAAGG + Intergenic
969313257 4:6366608-6366630 CAGCCTAGGAGGGGTGTGGCAGG + Intronic
969448625 4:7260045-7260067 AAGCCTGGGAGGGCAGGAGAGGG - Intronic
969715849 4:8867781-8867803 AAGCCGAGCAGCGGTGGGGGCGG + Exonic
970626445 4:17889723-17889745 AAGCCCAGGAATGGTGGGGGTGG + Intronic
971344380 4:25798535-25798557 AAGACCAGGACGGCTGGGCGAGG + Intronic
971589566 4:28450207-28450229 AAGCCTAGGGGAGCTGTGGTAGG - Intergenic
972290040 4:37683464-37683486 ATGCCTATGAAGGCTGGGCGCGG + Intronic
972398020 4:38673679-38673701 TAGCAAAGCAGGGCTGGGGGCGG - Intronic
973846020 4:54914105-54914127 AAGGCTAGCAGGGGTGGAGGTGG - Intergenic
976336727 4:83896508-83896530 TAGAAAAGGAGGGCTGGGGGAGG - Intergenic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
977338542 4:95728827-95728849 AAACCTGTGACGGCTGGGGGCGG - Intergenic
979485888 4:121270073-121270095 AATCCTATAAGGGCTGGGTGCGG + Intergenic
979649004 4:123107730-123107752 AGGCTGAGGAGGGCTGAGGGTGG - Intronic
979664466 4:123295256-123295278 AAGCCTTGGAAGGCTGGTTGGGG + Intronic
980094464 4:128475009-128475031 AGAACTAGGAGGGCTGGGCGCGG + Intergenic
984462657 4:180057869-180057891 AAGCCTGGAAGGGCTGGCGTTGG + Intergenic
984734892 4:183099492-183099514 ATGCCTAGGAGGGCCGGGAGCGG + Exonic
985190182 4:187364336-187364358 AAGCCTTAGAGGACTGGAGGAGG + Intergenic
985619500 5:946742-946764 AGCCCCAGGAGGGCTGAGGGCGG - Intergenic
986240422 5:5955119-5955141 AAGCCAAGGAGGGAAGGGGAAGG - Intergenic
986636134 5:9823980-9824002 TTGCCTTGGAGGGCTGGGGGAGG + Intergenic
987319185 5:16751759-16751781 AAGGCTGGGAGCGGTGGGGGCGG - Intronic
987926159 5:24344718-24344740 AAGTTTTGGAGGGCTGTGGGTGG - Intergenic
989125018 5:38044611-38044633 AAGATTGGCAGGGCTGGGGGAGG - Intergenic
990311297 5:54541316-54541338 AAGACCAGGAGGGCCGGGCGCGG - Intronic
990946874 5:61259017-61259039 AAACCTGGAAGGGCTGGGTGCGG + Intergenic
991922633 5:71671909-71671931 GAGCATTGGAGGGCGGGGGGAGG - Intergenic
993733095 5:91445662-91445684 AAGCCCTGCAGGGCGGGGGGGGG - Intergenic
994366908 5:98928141-98928163 GAGCCTGGGAGGGCGCGGGGCGG - Intronic
994553395 5:101264428-101264450 AAGCATAGGAGGGTGGGGGAGGG + Intergenic
998230935 5:140361061-140361083 AATCCTAGGAGGGGTAGGGATGG - Intronic
998526545 5:142847956-142847978 AAGCCCATGAGGGCAGGGGCTGG + Intronic
999007829 5:148002091-148002113 AGGCCTGGGAGTGATGGGGGTGG - Intergenic
999699942 5:154219016-154219038 AAGTCTAGGGGAGCCGGGGGAGG - Intronic
999735621 5:154510846-154510868 AAGCCCAGGAAGGGTGGGAGGGG + Intergenic
999922357 5:156335656-156335678 AAGGCTTGGAGGGCAGGAGGGGG - Intronic
1000255349 5:159532979-159533001 AAGCCTAAGAGGGGTAGGTGGGG + Intergenic
1000333835 5:160227242-160227264 AAGCCTAAAAGGGCTGGGTGTGG + Intronic
1001248321 5:170123098-170123120 AAGCCTGGGTGCACTGGGGGTGG + Intergenic
1001530907 5:172461036-172461058 AAGCAAAGGTGGGGTGGGGGTGG - Intergenic
1002567482 5:180119968-180119990 CAGCCCAGGATGGCTGGGGAAGG - Intronic
1002685617 5:181007407-181007429 AAACATTGGAGGGCTGGGCGTGG + Intergenic
1002713932 5:181213545-181213567 AATCCCAGGAGGGCTGAGGCAGG + Intergenic
1002995022 6:2274860-2274882 ATGACTAGGAGGGTAGGGGGAGG - Intergenic
1004439133 6:15630625-15630647 AAGCCTAGACAGGCTGGGTGCGG + Intronic
1004930536 6:20458971-20458993 TAGCCTGGAAGGGCTGGGGGCGG + Intronic
1005251954 6:23956803-23956825 AAGCCAGGAAGGGCTGGGTGCGG - Intergenic
1006149996 6:31981991-31982013 CAGCTTAGCTGGGCTGGGGGAGG + Intronic
1006156297 6:32014729-32014751 CAGCTTAGCTGGGCTGGGGGAGG + Intergenic
1006304158 6:33208755-33208777 AAGGCGAAGAAGGCTGGGGGTGG - Exonic
1006405542 6:33842752-33842774 AAGGCTGGGGGAGCTGGGGGTGG + Intergenic
1006535807 6:34697646-34697668 AAGGCGGGGAGGGGTGGGGGGGG + Intergenic
1007223530 6:40296987-40297009 CAGCCGGGGTGGGCTGGGGGTGG + Intergenic
1007262990 6:40576817-40576839 AACCACAGGAGAGCTGGGGGTGG - Intronic
1007285188 6:40742555-40742577 AATCCCAGGAGGGCTGAGGCTGG + Intergenic
1007360701 6:41353277-41353299 GAGCCCTGGAGGGCTGGGGAAGG - Intergenic
1007391810 6:41553673-41553695 AAACTTAGGAGGACTAGGGGAGG + Intronic
1007421129 6:41720421-41720443 AAGGCTGGGAGGACTGGGGAAGG - Intronic
1007512153 6:42381808-42381830 AAGCACAGGAGGGCTCAGGGAGG + Intronic
1007648113 6:43398350-43398372 AATCCTGGGTGGGCTCGGGGTGG - Intergenic
1007687276 6:43674261-43674283 CAGCCTAGGAGGTCTGCTGGGGG + Intronic
1007718336 6:43870181-43870203 AGGCCTGGGAGGGCTGGGGGAGG - Intergenic
1007763995 6:44150429-44150451 TAGCTCAGGAGGCCTGGGGGTGG - Intronic
1007774824 6:44219279-44219301 AAGCCCCGCAGGGCTGGGGGTGG - Intergenic
1009214970 6:60910798-60910820 AAGCCTGGGAGCGCTGCAGGAGG - Intergenic
1011095996 6:83663575-83663597 AATTCTAGGAGGGCTGAGAGAGG + Intronic
1011119104 6:83930934-83930956 AATTCTAGGAGGGCTGAGAGAGG - Intronic
1012445685 6:99304898-99304920 TAGCCCAGGGAGGCTGGGGGAGG + Intronic
1013008574 6:106098760-106098782 AGGACTTGGAGGGTTGGGGGTGG + Intronic
1014284631 6:119482843-119482865 AAGCATAGAAGGGCTGGTTGAGG - Intergenic
1016355585 6:143214752-143214774 AAGCATAGGTGTGCAGGGGGAGG - Intronic
1016587188 6:145702622-145702644 AAGACTAGGAGGACTGGAAGAGG - Intronic
1016796707 6:148125584-148125606 AGGCCTGAGAGGCCTGGGGGAGG + Intergenic
1017067586 6:150543529-150543551 AAGGCCAGGAGGGAAGGGGGAGG - Intergenic
1017086351 6:150716643-150716665 CTGTCTAGGAGGGCTGGGGTGGG - Intronic
1017293771 6:152771183-152771205 TAGCCTAGGAGAGGTGGGAGTGG + Intergenic
1018696164 6:166393435-166393457 GAGCCTACGGGGGCGGGGGGAGG + Intergenic
1019477680 7:1251881-1251903 GTGCCTAGGGGAGCTGGGGGCGG - Intergenic
1019481919 7:1270810-1270832 ATGCCTGGGAGGGCTGGGGCTGG - Intergenic
1019499055 7:1355355-1355377 AGGCCTAGGAGGGCTTGGCAGGG + Intergenic
1019690416 7:2407644-2407666 AAGCTTGGGAAGGCTGGGTGTGG + Intronic
1019793889 7:3035589-3035611 AATCCAAGGAGGGCTGGGCGCGG - Intronic
1019798837 7:3072810-3072832 AGACCTGGGAGGGCTGGGAGGGG + Intergenic
1020014771 7:4824491-4824513 CAGCCGAGCAGGGCTGGGGGAGG + Intronic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020407371 7:7852760-7852782 AAGCCTAGGAGGACAGGGTTCGG - Intronic
1022171976 7:27839576-27839598 AAGCCTCTGAGGGCTGGCAGAGG - Intronic
1022999494 7:35793405-35793427 CAGCCAAGGAGGGAAGGGGGAGG - Intergenic
1023910908 7:44555795-44555817 AGGCAGAAGAGGGCTGGGGGTGG + Intergenic
1024265709 7:47604926-47604948 AAGCCAAGGAGGGAGGGCGGGGG - Intergenic
1025162145 7:56670493-56670515 AAGCCTATGGGGGCTGGGCACGG - Intergenic
1026588187 7:71674805-71674827 AAGCATATGTGGGCTGGGTGCGG - Intronic
1026624660 7:71981380-71981402 AACCCAAGAGGGGCTGGGGGTGG + Intronic
1026829184 7:73600784-73600806 AAGCCTGCGAGAGCTGGGGGAGG + Intronic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1027365260 7:77450901-77450923 AAGACAAGAAGGGCTGGGCGCGG + Intergenic
1028316677 7:89410609-89410631 AAGCCAAGAAGGCCTGGAGGAGG + Intergenic
1029209368 7:98893238-98893260 AAGATTAGGAGGGCTGGGCGAGG - Intronic
1029469993 7:100748251-100748273 AATCCGGGGTGGGCTGGGGGAGG + Intronic
1030682164 7:112445354-112445376 AAGCCTAGGCCGGCCGGGCGGGG - Intronic
1032090949 7:128911369-128911391 AAGCCTGGGACTGCTGGGGTGGG - Intergenic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1032517628 7:132518846-132518868 AGGACAAGGAGGCCTGGGGGAGG - Intronic
1033310154 7:140255393-140255415 AAGCCCAGGGAGGCTGGGCGGGG - Intergenic
1033890612 7:146008471-146008493 AATCCAGGGAGGGCTGGGCGCGG + Intergenic
1033954173 7:146824028-146824050 AGGGGTTGGAGGGCTGGGGGAGG - Intronic
1034414253 7:150956502-150956524 TAGCCTTTGGGGGCTGGGGGTGG - Intronic
1034571528 7:151960148-151960170 AAGGCAAGGAAGGCTGAGGGTGG - Intronic
1034941708 7:155234841-155234863 AACCCTTGGATGGCTGGGCGCGG - Intergenic
1035020307 7:155796912-155796934 CAGCCTCGGGGGGCTGGGGCCGG - Intergenic
1035480411 7:159177970-159177992 AAGCATAGCTGGGCTGGGCGTGG + Intergenic
1035730221 8:1849343-1849365 ATGCCGAGGAGGGCATGGGGCGG + Intronic
1037788768 8:21919203-21919225 CAGCCTAGGTGGGGTGTGGGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037985274 8:23287136-23287158 AAGCACAGGCGGGATGGGGGAGG - Intronic
1038734415 8:30156290-30156312 GAGCCTGGCAGGGTTGGGGGAGG - Exonic
1038963428 8:32547826-32547848 AACCCTGGGAGGGGTGCGGGGGG - Intronic
1039615444 8:38951587-38951609 GAGCCTAGGAAGGCTGAGGCAGG - Intronic
1039843146 8:41307954-41307976 TGCCCTCGGAGGGCTGGGGGTGG - Intronic
1040829900 8:51664830-51664852 GTGCCTGGGAGGGCTGGGGGAGG - Intronic
1040896442 8:52373605-52373627 TGGCCTAGGAGGGTTTGGGGTGG - Intronic
1040938552 8:52808122-52808144 ATGCTTAGGAGGTCTGGGGAGGG - Intergenic
1040939148 8:52815213-52815235 GAGCTTAGGAAGGCAGGGGGCGG - Intergenic
1041461951 8:58120838-58120860 AAGCCTGGCAGGGTTGGGGCTGG + Intronic
1041669177 8:60475693-60475715 AAGACGAGGAGAGATGGGGGAGG - Intergenic
1041740282 8:61150528-61150550 GAGGGGAGGAGGGCTGGGGGTGG - Intronic
1042877155 8:73449789-73449811 AGGCCCAGGAGGGCTTAGGGTGG + Intronic
1043584369 8:81750307-81750329 AAGACAAGGAGGGCTGGGTGTGG + Intronic
1043788986 8:84438680-84438702 AATCCTAGAAGGGCTGGGTACGG - Intronic
1044758791 8:95494741-95494763 AGGCCTGGGATGGCTGCGGGAGG + Intergenic
1045409559 8:101903653-101903675 AAGCCTGGGAAGGCTGAGAGAGG - Intronic
1045449375 8:102306013-102306035 TAGCATAAGAGGGCTGGGTGTGG - Intronic
1047381753 8:124371692-124371714 ACGCCTGGGACGGCTGGGGGCGG - Intronic
1047794911 8:128245254-128245276 AATTCTATGAGGGCTGAGGGAGG - Intergenic
1047957391 8:129986014-129986036 AGGTCTGGGAGTGCTGGGGGAGG - Intronic
1048195692 8:132330176-132330198 AAGCCCAGGAATGCTGGGGCAGG + Intronic
1048855206 8:138681029-138681051 AAGCCTAGGGGAAGTGGGGGAGG - Intronic
1049444113 8:142622245-142622267 AATCCTGGTAGGGCTGGGGCTGG - Intergenic
1049469591 8:142769390-142769412 AGGCCCAAGAGGGCTGGAGGGGG + Intronic
1049763894 8:144343981-144344003 AAGCCCAGGACGGCTGGGCCAGG - Intergenic
1050317955 9:4422749-4422771 AAGTCAGGGAGTGCTGGGGGCGG + Intergenic
1051196404 9:14566627-14566649 ATGCCTAGGAAGGCAGGGGTGGG + Intergenic
1051913009 9:22176448-22176470 AAGGCTAGAAAGGCTGGGGAAGG + Intergenic
1052464209 9:28809453-28809475 AATGCTAGGATGGCTGGGCGTGG + Intergenic
1052464612 9:28814595-28814617 AATGCTAGGATGGCTGGGCGTGG + Intergenic
1056680259 9:88711303-88711325 AACCCTGGGAGGGCAGGTGGAGG + Intergenic
1057005133 9:91550551-91550573 AAGCAGAGCAGTGCTGGGGGTGG + Intergenic
1058271322 9:102975458-102975480 ATGCCTAGTAGGGCCAGGGGAGG - Intergenic
1059037459 9:110771378-110771400 GAGCATAAGAGGGCTGGGCGCGG - Intronic
1059061580 9:111038845-111038867 AAGCGCAGGAGGGGCGGGGGTGG - Intergenic
1059149253 9:111933815-111933837 AAGACGGGGTGGGCTGGGGGAGG - Exonic
1060663075 9:125415751-125415773 AGGCCTGGGAGGCCTGGGGTGGG + Intergenic
1060666583 9:125435602-125435624 TAGCCTGGGTGGGCTGGTGGGGG - Intergenic
1060813619 9:126623691-126623713 CAGCCTGGGAGGGGTGGGGAGGG + Intronic
1061086898 9:128404788-128404810 AAGGGGAGGAGGGATGGGGGAGG + Intergenic
1061193207 9:129094165-129094187 ATGCCGGGGTGGGCTGGGGGAGG - Intergenic
1061738006 9:132676187-132676209 AAGCAAAGGATGGCTGGGCGTGG - Intronic
1062113163 9:134793370-134793392 AAGGCTAAGGAGGCTGGGGGGGG + Intronic
1062137907 9:134939315-134939337 GGCCCTAGGAGGCCTGGGGGTGG - Intergenic
1062199523 9:135294523-135294545 AATCCTGGGTGGGCTTGGGGTGG - Intergenic
1062462657 9:136668376-136668398 TAGCCTGGGAGTGCTGGGGTGGG + Intronic
1062474591 9:136720757-136720779 TGGCCTCGGAGGGCTGGGAGAGG + Intronic
1062565619 9:137162743-137162765 AGGCCTGGCCGGGCTGGGGGAGG + Intronic
1062607070 9:137353187-137353209 GAGGCCAGGAGGGCTGGTGGAGG - Intronic
1062634779 9:137484998-137485020 TAGCCTCTGAGGGTTGGGGGAGG - Intronic
1062721357 9:138045918-138045940 GAGCTTAGAGGGGCTGGGGGCGG + Intronic
1185483072 X:462854-462876 AAGCAAAGGGGGGCTGGAGGTGG - Intergenic
1185662934 X:1741444-1741466 AGGCCAAGGGGGGGTGGGGGCGG + Intergenic
1188590183 X:31823862-31823884 AAGCCTAATAAGGCTGGGTGTGG - Intronic
1189192155 X:39119611-39119633 AAGCCTACGTGGGCAGGAGGAGG - Intergenic
1190222589 X:48521936-48521958 TAGCCGGGGAGAGCTGGGGGAGG - Intronic
1190323006 X:49189253-49189275 AAGCCCAGGAGGACCTGGGGGGG - Exonic
1190331980 X:49241883-49241905 AGGCCTTGGGGAGCTGGGGGAGG + Intronic
1190735235 X:53251318-53251340 GAGCCTGTCAGGGCTGGGGGAGG - Intronic
1190786150 X:53651138-53651160 AAGCTCAGGTGGGGTGGGGGAGG - Intronic
1192523984 X:71825585-71825607 AAACCTAGGAGGGCATGGAGTGG + Intergenic
1193049064 X:77082195-77082217 GAGCCTGGCTGGGCTGGGGGAGG + Intergenic
1195108649 X:101623909-101623931 GACCCTAGGAGGGACGGGGGTGG + Intronic
1196816336 X:119667833-119667855 AGCCCTGGGAGGGCTGGGGGAGG - Intronic
1196961353 X:121006194-121006216 AAGCAGAGGAGGGATGAGGGGGG - Intergenic
1198311041 X:135425858-135425880 AAGCCTCTGAGGGCTAGGGCTGG + Intergenic
1198405978 X:136312812-136312834 AAGGCCTGGAGTGCTGGGGGAGG - Intronic
1199649589 X:149939190-149939212 AAGCAGGGCAGGGCTGGGGGAGG + Intergenic
1199895171 X:152120128-152120150 AAGCCACGGGGGGCTGGGGGCGG + Intergenic
1200234960 X:154463774-154463796 AAGTGGAGGAGGGCGGGGGGAGG - Intronic
1201892887 Y:18962069-18962091 AAACCTAGGCAGGCTGGGTGTGG + Intergenic
1202240647 Y:22764422-22764444 AAGTCTTGTAGGGCTGGGCGCGG + Intergenic
1202393633 Y:24398175-24398197 AAGTCTTGTAGGGCTGGGCGCGG + Intergenic
1202477152 Y:25271925-25271947 AAGTCTTGTAGGGCTGGGCGCGG - Intergenic