ID: 1077014932

View in Genome Browser
Species Human (GRCh38)
Location 11:395318-395340
Sequence GGTCCACTTGGTGTTTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077014926_1077014932 -3 Left 1077014926 11:395298-395320 CCCAGATGCCAGTTCATCATGGT 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1077014927_1077014932 -4 Left 1077014927 11:395299-395321 CCAGATGCCAGTTCATCATGGTC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1077014923_1077014932 12 Left 1077014923 11:395283-395305 CCAGAATGCCAGGGACCCAGATG 0: 1
1: 0
2: 0
3: 24
4: 206
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1077014924_1077014932 4 Left 1077014924 11:395291-395313 CCAGGGACCCAGATGCCAGTTCA 0: 1
1: 0
2: 0
3: 32
4: 182
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1077014921_1077014932 16 Left 1077014921 11:395279-395301 CCTCCCAGAATGCCAGGGACCCA 0: 1
1: 0
2: 2
3: 22
4: 239
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1077014922_1077014932 13 Left 1077014922 11:395282-395304 CCCAGAATGCCAGGGACCCAGAT 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077014932 Original CRISPR GGTCCACTTGGTGTTTAGAG GGG Intronic
910762562 1:90748728-90748750 GGGCCCCTTGGTGGTTAGATAGG + Intergenic
915940647 1:160116307-160116329 GGTCCATTTTGAGGTTAGAGAGG + Intronic
920897524 1:210070686-210070708 GGTACACTTGGAGTTTTAAGTGG + Intronic
1063419094 10:5896843-5896865 AGTGCACTTGCTGTGTAGAGAGG + Intronic
1072794991 10:98347774-98347796 GGTCCATTTGGTTTCTAGGGAGG - Intergenic
1073307565 10:102515231-102515253 TTTCCACTTGTTGTTTAGTGTGG + Intronic
1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG + Intronic
1078463402 11:11532301-11532323 GGTCTACTTGGTTTTTAGAATGG - Intronic
1078531571 11:12140518-12140540 GGTCCACTTATGGTTGAGAGTGG - Intronic
1081127465 11:39339695-39339717 GGTCCATTTGGTCTATAGTGTGG + Intergenic
1083984234 11:66200774-66200796 GGTCCATTTGGTCTATAGTGCGG - Intronic
1084462713 11:69304869-69304891 GGTCCCTTTGATGTTTAAAGAGG - Intronic
1088687264 11:112295570-112295592 GGTCCACTTAGAGTTTAAAATGG - Intergenic
1090849817 11:130562257-130562279 AGTCCACTTGGTGTGGAGATGGG + Intergenic
1090856065 11:130610192-130610214 GGCCCACTTGGTGTTTGAAGTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1094553192 12:31471938-31471960 GTTCCACTTGGAATTTATAGGGG - Intronic
1107895138 13:44954537-44954559 TTTACAGTTGGTGTTTAGAGCGG - Intronic
1112389653 13:98971320-98971342 GGTCCCCATAGTGTTTACAGAGG - Intronic
1112608670 13:100933396-100933418 GCTCCACTTTGTGTTTTCAGGGG + Intergenic
1112998596 13:105604533-105604555 GGGTCACTTGGTGTCTGGAGAGG + Intergenic
1113000451 13:105629977-105629999 GGTCCATTTGCAGTTTATAGGGG - Intergenic
1129050966 15:72781624-72781646 GGTCCACCTGGTTTTAAGGGAGG - Intronic
1129512395 15:76134240-76134262 GGTTTTCTTGGTGTTTAGTGGGG - Exonic
1133770122 16:8862939-8862961 GGTGCACTTGGGGTGTTGAGGGG - Intronic
1136272131 16:29154521-29154543 TGTCAAGCTGGTGTTTAGAGTGG - Intergenic
1136359172 16:29766787-29766809 GCTCCAATTGGCGTTTATAGGGG + Intergenic
1137453365 16:48598049-48598071 GTTCCACTTGGCATTTATAGAGG - Intronic
1140085067 16:71788075-71788097 GGTCATCTTGGGGTTTGGAGTGG - Intronic
1143875334 17:9986743-9986765 GGCCCATTTGGAGGTTAGAGGGG - Intronic
1146054409 17:29574005-29574027 GGTCCATCTGGAGTTTTGAGGGG - Exonic
1148214831 17:45828843-45828865 GGTCCACCTGGTGTTCTGACTGG + Intronic
1158200622 18:54935537-54935559 GGCCCACTTGGTATTTACAAGGG - Intronic
1159915826 18:74186941-74186963 GGGACACTTGCTGTTTACAGAGG + Intergenic
1161913367 19:7211321-7211343 TGTCATCTTGGTGCTTAGAGAGG - Intronic
1164950698 19:32334392-32334414 GGGGCACATGGTGTTAAGAGAGG + Intergenic
1164990316 19:32677776-32677798 GGGCCACCTGGTGTTTAAACAGG + Exonic
1165884618 19:39069070-39069092 GGTCCACTGGCTGTTCACAGTGG - Intergenic
926278721 2:11426459-11426481 GGGACACTTCCTGTTTAGAGAGG + Intergenic
926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG + Intergenic
947400028 2:229722581-229722603 GATCCACTTGGAGTTTATTGAGG - Intergenic
1169311522 20:4545985-4546007 GGTCCATTTGGTGTATAGTGTGG + Intergenic
1169708201 20:8532040-8532062 GGTTAAGTTGGGGTTTAGAGGGG + Intronic
1170236332 20:14108895-14108917 GGTCCATTTGGTCTATAGTGCGG - Intronic
1170635445 20:18100305-18100327 GGTTCAATTTGTGTTTATAGAGG - Intergenic
1175761553 20:61565133-61565155 GGTCCTCTTGGTGTTGGTAGTGG + Intronic
1181390513 22:22577139-22577161 TGTCCTCTTGGTGTTTGGTGTGG - Intergenic
1184891617 22:47382855-47382877 GGTCCCCTTGCTGTTTAAAAAGG + Intergenic
952030624 3:29137978-29138000 GATACTCTTGGAGTTTAGAGGGG - Intergenic
955848108 3:63189966-63189988 GGTCCATTTGGTCTATAGTGTGG + Intergenic
957911190 3:86621678-86621700 GGTCCATTTTGTTTTTACAGGGG - Intergenic
959020376 3:101182023-101182045 GCTCCACTTGGCATTTAAAGGGG - Intergenic
960149835 3:114238608-114238630 GGGCCAGTTGGAGTTCAGAGTGG - Intergenic
966339076 3:178905139-178905161 GATACACTTGGGTTTTAGAGGGG - Intergenic
968635295 4:1675365-1675387 GGACCACTTCCTGTTTGGAGGGG - Intronic
971154446 4:24066229-24066251 AGTCCACTTGCTTTTTAGAGAGG - Intergenic
972634303 4:40869639-40869661 GGCCCACTTTGTTTATAGAGCGG - Intronic
975096532 4:70463823-70463845 GGCCGACTTGGTGTTTGGCGAGG - Intronic
976504640 4:85832593-85832615 GGTATATTTGGTGTTAAGAGAGG - Intronic
980861845 4:138508598-138508620 TATCCACTTGGTGTCTAAAGAGG - Intergenic
981404634 4:144353852-144353874 GCTTCACTTGGTGGTTAGAGTGG + Intergenic
985138140 4:186810519-186810541 GGTCCTCATGGTATTTTGAGTGG + Intergenic
985923977 5:3001298-3001320 TGTCCACTTGTTTTCTAGAGTGG - Intergenic
986262672 5:6162051-6162073 GGTCCCATTGGCCTTTAGAGTGG + Intergenic
987867545 5:23564762-23564784 GATCCACTTAGTTTTTGGAGAGG + Intergenic
988107861 5:26773340-26773362 GGTCCACTGGGTGATGACAGGGG - Intergenic
991982530 5:72247972-72247994 AGTCCAATTGGTTTTTAGAAAGG + Intronic
995692896 5:114847014-114847036 GGTCCACTTGGTGCAGAGATGGG - Intergenic
997660824 5:135588406-135588428 GCTCAACTTGGTGTTTATAGAGG - Intergenic
1004948199 6:20638537-20638559 AGTCCATTTGGTGTTTATATAGG + Intronic
1007071589 6:39041988-39042010 GGTTCCCTTGATGTTTAGGGTGG - Intergenic
1016878330 6:148885622-148885644 AGCCCACTTGGTGTTCACAGTGG - Intronic
1022726807 7:32988574-32988596 GGTCTACTTGGTGTTTGCATTGG + Exonic
1025009503 7:55384599-55384621 ATTCCTCTTGGTGTTTTGAGGGG - Intronic
1025046781 7:55699059-55699081 GGTCTACTTGGTGTTTGCATTGG - Intergenic
1029527657 7:101104860-101104882 GGCCTCCTTGGTGTTTAGATGGG + Intergenic
1035038777 7:155912436-155912458 GGTGCTTTTGCTGTTTAGAGTGG + Intergenic
1037079307 8:14763965-14763987 GGTACACCTGGTGTTCAGATGGG + Intronic
1039934362 8:42028244-42028266 GGTCCATTTGGTGTAAAGTGTGG + Intronic
1045531129 8:102986461-102986483 TGTCCACTGGGTTTTTAAAGTGG + Intergenic
1045534772 8:103017415-103017437 GGTCCTTTTGGTGTTTTAAGAGG - Intergenic
1054942852 9:70762866-70762888 GATCCACTTGGTGTAAACAGAGG - Intronic
1056632312 9:88303986-88304008 GCTCCACTTGGCATTTATAGGGG + Intergenic
1057667002 9:97053909-97053931 GCTCCACTTGGCATTTACAGGGG - Intergenic
1186535383 X:10341772-10341794 GGTGAACTTGGTGATTTGAGAGG + Intergenic
1187976988 X:24712759-24712781 GATCCATTTGGTGTTTATACTGG + Intronic
1197069565 X:122279747-122279769 GCTCCACTTGGTATTTATTGAGG - Intergenic
1197443109 X:126514120-126514142 GTTCCACTTGGAATTTATAGTGG + Intergenic