ID: 1077015555

View in Genome Browser
Species Human (GRCh38)
Location 11:397596-397618
Sequence AGGCCGCTCCCAGCACCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077015555_1077015558 22 Left 1077015555 11:397596-397618 CCTGCAGGTGCTGGGAGCGGCCT 0: 1
1: 0
2: 0
3: 20
4: 306
Right 1077015558 11:397641-397663 CGATGCAGCCGCCAAGAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077015555 Original CRISPR AGGCCGCTCCCAGCACCTGC AGG (reversed) Exonic
900144014 1:1150269-1150291 AGGTGGGTCCCAGCACCTGCAGG + Intergenic
900170818 1:1267790-1267812 AGGCCTCTGCCGGCCCCTGCTGG - Intronic
900360974 1:2288941-2288963 AGGCAGCTCCCGTCACCTGGAGG - Intronic
900394641 1:2448200-2448222 CAGCCGGTCCCAGCAGCTGCAGG - Intronic
900540786 1:3201670-3201692 CAGCCACTTCCAGCACCTGCAGG + Intronic
900556371 1:3282894-3282916 ACGCCTCTCACTGCACCTGCAGG - Intronic
900655662 1:3755583-3755605 GGGCCTCTGCCTGCACCTGCTGG + Intronic
901024428 1:6271639-6271661 TGGCCTCTCCCAGCAGCTGCAGG + Intronic
901114914 1:6835561-6835583 AGGCCCCACCCAGGACCTACTGG - Intronic
901461518 1:9394722-9394744 AGGCAGCTGCCAGCCCCTCCAGG + Intergenic
901778447 1:11576628-11576650 CGTCTCCTCCCAGCACCTGCTGG + Intergenic
901863418 1:12088965-12088987 AGCCCCCTCACAGCACCTCCTGG + Intronic
902668930 1:17958625-17958647 AGGCCCCTCCCAGCCACTGTAGG - Intergenic
902873259 1:19326632-19326654 CGGCCCCACCCAGCCCCTGCTGG - Intronic
902884061 1:19392455-19392477 AGGCAGCACGCAGCACCTCCTGG + Intronic
903573427 1:24322619-24322641 TGCCCGCTCCCAGCAGCTGGCGG - Intronic
904160399 1:28518507-28518529 AGGCAGCGCCCAGCCGCTGCTGG - Intronic
904306669 1:29594440-29594462 ATGCTGATCCCAGCACCTGCAGG + Intergenic
905250709 1:36646472-36646494 AGGCTGCTCACACCACCTTCTGG + Intergenic
909054722 1:70807324-70807346 AGGAAGCTCCCTGCCCCTGCAGG - Intergenic
910205738 1:84747367-84747389 AGGGCTTTCCCAGCTCCTGCGGG - Intergenic
915082142 1:153359557-153359579 AGTCCCCTCCCAGAACCTGTGGG - Intronic
916412546 1:164559882-164559904 CGGCCTGTCCCAGCACTTGCAGG + Exonic
916914450 1:169391374-169391396 AGGGGGATCCCAGCAGCTGCAGG - Intronic
917319622 1:173766181-173766203 TGGCCCCTACAAGCACCTGCAGG + Exonic
918071868 1:181139316-181139338 AAGCCTCTCCCAGCACCAGCTGG - Intergenic
920095055 1:203481143-203481165 AGGAGGCTCCCAGCACTGGCGGG - Intronic
921168341 1:212523765-212523787 AGGCCTCTCCCAGAAGATGCTGG - Intergenic
922565220 1:226597164-226597186 AGGCCTGGCCCAACACCTGCAGG + Intronic
923129850 1:231065707-231065729 ACGCCCATCCCAGCACCTCCCGG - Intergenic
923446719 1:234078056-234078078 AGGCCAGTCCCTTCACCTGCAGG + Intronic
1062798729 10:363535-363557 AGGCCACACACAGCACCCGCGGG + Intronic
1062952573 10:1515755-1515777 TGGCCGCTTCCTGCACCTTCCGG - Intronic
1063072347 10:2679683-2679705 AGGCAGCTACCAGGACCTGAGGG + Intergenic
1069486636 10:68827860-68827882 AGGCATCGCGCAGCACCTGCAGG - Exonic
1069486723 10:68828196-68828218 AGGCATCGCGCAGCACCTGCAGG - Intronic
1070562212 10:77576482-77576504 CGGCCTCTCCCAGCACTTGATGG + Intronic
1071563800 10:86661496-86661518 TGGCCGCTCCCAGCTGCTGGTGG - Intronic
1073143092 10:101261792-101261814 AGCCAGCAGCCAGCACCTGCAGG + Intergenic
1075797919 10:125134520-125134542 CTACCGCTCCCAGCAACTGCTGG + Intronic
1076479075 10:130772538-130772560 AGGATGCTCCAAGAACCTGCAGG + Intergenic
1076841909 10:133049991-133050013 AGGCCTCTCCCAGCGCCAACAGG - Intergenic
1076841977 10:133050217-133050239 GGGCTCCTCCCAGCACCAGCGGG + Intergenic
1076861668 10:133140830-133140852 AGGCTGCTCCCAGTACATCCAGG - Intergenic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1077185865 11:1235072-1235094 TGGCCCCTTGCAGCACCTGCAGG + Exonic
1077545250 11:3166373-3166395 AGGCTCCTTCCAGCACCTGAAGG + Intronic
1083288432 11:61676023-61676045 ACTCAGCTCCCAGCAGCTGCAGG - Intergenic
1083373530 11:62201486-62201508 AGGCTGCTCCATGCACCTGGAGG - Intergenic
1083379136 11:62250522-62250544 AGGCTGCTCCATGCACCTGGAGG - Intergenic
1084183577 11:67458562-67458584 AGGCTGAGCCCAGCACCTCCTGG + Intronic
1084296244 11:68214542-68214564 AGCGCGCTCCCGGCCCCTGCGGG + Intergenic
1084683626 11:70681133-70681155 AGGACCCTCCCAGCAGGTGCCGG - Intronic
1085083269 11:73650503-73650525 AGGCTGATCCCAGAGCCTGCTGG - Intronic
1085470221 11:76752915-76752937 AGGCCTCTCCCTGCCCCTGGGGG - Intergenic
1087317138 11:96615600-96615622 ATGGCTCTCCCAGTACCTGCAGG + Intergenic
1089311021 11:117558209-117558231 AAGCTGCTGCCAGCACCTACAGG + Intronic
1090807701 11:130212693-130212715 TGGCCTCTCCCAGCTGCTGCAGG - Intergenic
1091239552 11:134043436-134043458 AGGCTGCTCCCCGCCCCTGGTGG + Intergenic
1091743515 12:2976611-2976633 AGGCCCCACCCAACACATGCAGG - Intronic
1092183025 12:6458941-6458963 AGGACACTCCCAGTACCTGGTGG - Exonic
1092946446 12:13458456-13458478 AGGCACCTCCCAGCACCATCAGG - Intergenic
1096493655 12:52026811-52026833 AAGCCCCTCCTAGCTCCTGCAGG - Intronic
1096775395 12:53960756-53960778 CGGCCGGACCCATCACCTGCCGG - Intergenic
1097182694 12:57180189-57180211 AGGACCCTGCAAGCACCTGCTGG - Intronic
1102655763 12:114481058-114481080 AGGCAGCTCCCTGCACCAGTCGG - Intergenic
1103507133 12:121449167-121449189 AGCCCCCTGCCAGCCCCTGCAGG - Intronic
1103746375 12:123127291-123127313 AGGCAGCTGCCAGCACCTCCTGG - Intronic
1104229898 12:126874570-126874592 AGGCCACGCCAGGCACCTGCTGG - Intergenic
1104252493 12:127108849-127108871 AGGTCCCTCACAGCACCAGCTGG + Intergenic
1104502448 12:129299227-129299249 AGGCTGACCCCAGCACCTCCAGG - Intronic
1104640839 12:130465878-130465900 TGCCCCCACCCAGCACCTGCAGG + Intronic
1104688570 12:130806988-130807010 AGGCCGCATCCAGCGCCAGCTGG - Exonic
1104757930 12:131280492-131280514 AAGGTGCTCCCACCACCTGCTGG + Intergenic
1104820148 12:131672422-131672444 ACGCCACACCCAGCACCTGTGGG - Intergenic
1104831563 12:131755866-131755888 AGGACACCCCCAGCACCAGCTGG - Intronic
1105874706 13:24541450-24541472 AGGCTGTTCCCTGCACCCGCGGG + Intergenic
1106001077 13:25723990-25724012 GGGCCACTCCCAGCACCTAGAGG - Intronic
1108271244 13:48761584-48761606 AGGCATCTGCCAGCAGCTGCTGG - Intergenic
1112298989 13:98213330-98213352 AAGCCGCCCCCAACACCTTCAGG + Exonic
1112356418 13:98677799-98677821 AGTCCTCTCGCAGCAGCTGCTGG + Intergenic
1112521387 13:100098452-100098474 AGGCCAGTCCCAGCACCTCAAGG - Intronic
1113415182 13:110123455-110123477 AGGCAGTTCCCGGCTCCTGCTGG - Intergenic
1113613696 13:111665832-111665854 CGGCCGCCCCCGCCACCTGCCGG - Intronic
1113731654 13:112645696-112645718 ACCCCTCTCCCAGCCCCTGCTGG - Intergenic
1113778012 13:112959963-112959985 AGGGCTCTCCCCACACCTGCAGG - Intronic
1113843699 13:113374295-113374317 AGGCCCCTCCCTGGACCTTCTGG - Intergenic
1115310671 14:31975045-31975067 AGGAAGCTCCCTGCCCCTGCAGG - Intergenic
1118473224 14:66094154-66094176 TGCCTGCTCCCAGCCCCTGCTGG + Intergenic
1118745767 14:68771909-68771931 AGGCTCCTCCCTGCACCAGCCGG - Intergenic
1119400011 14:74356939-74356961 AGTCCACTTCCAGCACCTGGAGG - Exonic
1120932885 14:89866475-89866497 GGGCCCCCTCCAGCACCTGCAGG + Intronic
1122577070 14:102749371-102749393 ATTCCTGTCCCAGCACCTGCCGG + Intergenic
1122686655 14:103511445-103511467 AGCCCGCCCCCAGGACCTGTGGG + Intergenic
1122896516 14:104760244-104760266 AGGCGGGTCCCAGCCCCTCCAGG + Intronic
1122901782 14:104785048-104785070 CGCCCGCTCCCAGGGCCTGCTGG - Intronic
1122907547 14:104808675-104808697 AGGCCACTCCCAACACGGGCTGG + Intergenic
1122918414 14:104869341-104869363 GGGCAGCTCCCTGCACCTGCAGG - Intronic
1124017901 15:25893337-25893359 AGGCTGCTCTCTGCACCTGTGGG - Intergenic
1124620119 15:31269049-31269071 AGGCAGCTCCCAGGACCTTGTGG + Intergenic
1125476223 15:40049867-40049889 AGGCCTCTCTCAGCATATGCTGG - Intergenic
1127916790 15:63461365-63461387 ATGCCGCTCCCACCGTCTGCAGG + Intergenic
1128457311 15:67838926-67838948 CGGCAGCTCCCAGCGCCCGCTGG + Intergenic
1128786034 15:70398171-70398193 AGGAAGCTCCCAGAACCTACAGG + Intergenic
1128790760 15:70431978-70432000 AGGCCCCTCCCTGTCCCTGCAGG - Intergenic
1128886204 15:71290272-71290294 AGGCAGCTCGCAGAACCTCCAGG - Intronic
1129319014 15:74763449-74763471 CGCCTGCTCCCAGCCCCTGCCGG - Intergenic
1132904303 16:2274264-2274286 AGCACGCTGCCAGCACCAGCAGG - Intergenic
1133058724 16:3160493-3160515 CGACCGCGCCCAGCCCCTGCTGG - Intergenic
1133843005 16:9427476-9427498 AAGACGATCCCAGCACCTGGGGG + Intergenic
1134002816 16:10795835-10795857 AGGAGGCTCCCAGCGCCTGGCGG - Intronic
1134098572 16:11435864-11435886 CGGCAGCTGCCTGCACCTGCAGG + Exonic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1136511080 16:30738648-30738670 ACACCTCTCCCAGCATCTGCTGG - Exonic
1136913732 16:34162917-34162939 AGGGCGCTCCCAACACCAGGAGG - Intergenic
1137715511 16:50595866-50595888 AGGCCACTGCCTGCCCCTGCAGG - Intronic
1137847983 16:51710589-51710611 GGGCCCCTCCCCGGACCTGCTGG + Intergenic
1138339439 16:56279111-56279133 ACCCCACTCCCAGCACCTGCCGG + Intronic
1138452448 16:57101751-57101773 AGGCCCCTCCCCAGACCTGCTGG + Intronic
1138474729 16:57264018-57264040 TGGCTGCTCCCAGCAGCTGAGGG + Intronic
1139474991 16:67198637-67198659 TAGCCGCCCCCACCACCTGCAGG - Exonic
1139476757 16:67206670-67206692 AGGGCTCCCCCAGTACCTGCAGG - Intergenic
1141525250 16:84606956-84606978 AGGCTTTTCCCAGCACGTGCTGG - Intronic
1141897166 16:86965469-86965491 GGGCGGCTGGCAGCACCTGCTGG - Intergenic
1141957913 16:87384499-87384521 GCGCGGCTCCCAGCAGCTGCAGG - Intronic
1141961596 16:87412806-87412828 AGGCTGCGCTCAGCATCTGCGGG + Exonic
1141964958 16:87435629-87435651 ACGACCCTCACAGCACCTGCAGG - Intronic
1144061009 17:11583381-11583403 TGCCTGCTCCCAGCTCCTGCTGG + Intergenic
1146791380 17:35752664-35752686 GGCCCGTTTCCAGCACCTGCAGG + Exonic
1147544527 17:41390474-41390496 AGGCTGCTGTCAGCATCTGCAGG - Intronic
1147944957 17:44075694-44075716 AGGCCGCTCACACCACTTGAAGG - Exonic
1151906497 17:77052746-77052768 AGCCCTGTCCCTGCACCTGCCGG - Intergenic
1151949619 17:77343370-77343392 ACTGCCCTCCCAGCACCTGCAGG - Intronic
1152269227 17:79313962-79313984 AGGACCCTCCCAGCAGTTGCGGG - Intronic
1152422837 17:80203426-80203448 AGGCCTCTCCCTGGACCTGCTGG - Intronic
1156487471 18:37475645-37475667 AAGCCATGCCCAGCACCTGCAGG + Intronic
1157331235 18:46705271-46705293 AAGCCCCTTCCAGCACCAGCTGG + Intronic
1157741444 18:50096897-50096919 CGTCTGCTCCCAGCTCCTGCGGG + Intronic
1158403814 18:57143714-57143736 AGGGCTCTCCGAGCAGCTGCAGG - Intergenic
1160624847 18:80196669-80196691 CGGCTGCTCACAGCGCCTGCAGG + Intronic
1160682806 19:419544-419566 AGGCCCCTCCCGGCGCCCGCTGG - Intronic
1160832759 19:1111327-1111349 AGGCGGCCCCCAGCAGCTGCCGG - Intronic
1160842119 19:1150822-1150844 ATCCCCCACCCAGCACCTGCGGG - Intronic
1160939625 19:1614238-1614260 GGGCCGCCCCCACCACCTGGAGG - Intronic
1160954248 19:1682848-1682870 AGGAGGCACCCAGCGCCTGCAGG - Intergenic
1160954629 19:1684922-1684944 AGCCGGCTCCCAGCTCCTGACGG - Intergenic
1161232590 19:3182084-3182106 AGGCCTCTCCCAGTTCCTGCTGG + Intergenic
1161301076 19:3543553-3543575 AGCCTACACCCAGCACCTGCGGG + Exonic
1161428543 19:4217572-4217594 AGGCCGCCTCCAGCTCCCGCAGG - Exonic
1161507917 19:4654005-4654027 GGGCCTCTCCCAGCTCCTGGTGG - Exonic
1162135342 19:8551859-8551881 AGGCCCCTTCCAGCAGCTGGAGG + Exonic
1162736518 19:12750046-12750068 AGCCTGCCCCCAGCCCCTGCGGG + Intergenic
1163153733 19:15429107-15429129 AGGCAGCTCTCTGCGCCTGCCGG - Intronic
1163364315 19:16867741-16867763 AGGCCTCTCCCAGAGCCTGTGGG + Intronic
1163696741 19:18768132-18768154 AGCCAGCTCCCAGCCCCTGTGGG - Intronic
1164807080 19:31125299-31125321 GGGCTGCTTCCAGCATCTGCAGG - Intergenic
1164811520 19:31160569-31160591 AGGCCTTTCCCTGCAGCTGCTGG - Intergenic
1165324878 19:35108790-35108812 AGGCCCCATCCAGCCCCTGCGGG - Intergenic
1166044946 19:40224532-40224554 AAGCCACGCCCAGCAGCTGCAGG + Exonic
1166075798 19:40413247-40413269 GGCCCCCTCCCAGCACCTCCCGG + Intronic
1166256217 19:41606667-41606689 AGGCCTGTACCAGCCCCTGCAGG + Intronic
1166366341 19:42280394-42280416 GGGCCGCGCCCAGCCCCCGCTGG + Intronic
1166918503 19:46212458-46212480 GGGCCCCTCCCAGCTTCTGCAGG - Intergenic
1168287045 19:55340282-55340304 AGGCCTCTCCCTGCACCCCCAGG + Intronic
925011046 2:486544-486566 TGGCCGCACACAGCACCTGTTGG - Intergenic
925844087 2:8020226-8020248 AGGTCACTCCCAGCATCTCCCGG - Intergenic
926340170 2:11898731-11898753 AGCCCCATCCCAGCTCCTGCTGG - Intergenic
926757950 2:16251090-16251112 GAGCCGCTCCCATCTCCTGCGGG + Intergenic
927613677 2:24566996-24567018 TGCCTGCTCCCAGCCCCTGCTGG + Intronic
929830892 2:45345495-45345517 AGGCCATTCACAGCAACTGCAGG - Intergenic
932446668 2:71785892-71785914 GGGCCGCCCCCAGCGCCTGCCGG + Intergenic
934862438 2:97775417-97775439 ATGTTGCTCCTAGCACCTGCTGG - Intronic
936075086 2:109396721-109396743 AGGCCCCTCCTGGCACCTGCGGG + Intronic
937436720 2:121887469-121887491 AGCCCCGTCCCAGTACCTGCAGG - Intergenic
938068293 2:128293418-128293440 TGGCGGCTGCCACCACCTGCTGG + Intronic
938251225 2:129817172-129817194 TGGCCGCTCCCAGGGCCTGAGGG - Intergenic
938626386 2:133113674-133113696 AGCCTGCTTCCAGGACCTGCTGG + Intronic
940252603 2:151695941-151695963 GGGCCCCTCTCAGAACCTGCAGG - Intronic
940612337 2:156006962-156006984 TGCCTGCTCCCAGCTCCTGCCGG + Intergenic
943928590 2:193820167-193820189 AGCCTGTTCCAAGCACCTGCAGG + Intergenic
946360817 2:219218506-219218528 GGGCCGCTCCCGGCGTCTGCAGG + Exonic
946431656 2:219629689-219629711 AGGCTGCAGCCAGTACCTGCTGG - Exonic
947054890 2:226088424-226088446 AGGAAGCTCCCTGCCCCTGCAGG - Intergenic
947747060 2:232513260-232513282 AGGTCCCTCCCATCATCTGCTGG + Intergenic
948600986 2:239107363-239107385 AGGCCGCTGCCATCGCCTGGCGG + Intronic
948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG + Intergenic
948826757 2:240576773-240576795 GGGCCGCCCCCATCAGCTGCAGG - Intronic
948896972 2:240932195-240932217 AGGCATCACCCAGCACCGGCAGG + Intronic
1171275835 20:23855880-23855902 AAGCCTCTCCAAGGACCTGCTGG - Intergenic
1171810331 20:29741681-29741703 AGGGCGCTCCCAACACCGGGAGG + Intergenic
1172367741 20:34363079-34363101 GAGCGGCTCCCAGCACCTCCAGG - Intergenic
1173333345 20:42093802-42093824 AAGCCGCCCTCAGCACCTGGAGG - Intronic
1173474726 20:43351004-43351026 ATGCCTCTTCCAGCTCCTGCTGG - Intergenic
1173922737 20:46758231-46758253 ATGCCCCTCCCAGGATCTGCCGG - Intergenic
1175180930 20:57146976-57146998 TGCCCTCTCCCAGGACCTGCTGG + Intergenic
1175203076 20:57291203-57291225 GTCCCGCTCCCTGCACCTGCAGG - Intergenic
1175369182 20:58475776-58475798 GGGCCTCTCCCAGCACCTGGTGG + Intronic
1175966446 20:62662245-62662267 AGGCAGCTCCCAGCTCCTTTGGG - Intronic
1175969206 20:62675390-62675412 AGGCAGCTCCCAAGAGCTGCGGG + Intronic
1175989848 20:62783013-62783035 AGGCTGCTCCCAGCTTCTGGAGG - Intergenic
1176303807 21:5113250-5113272 AGGCCCCTCCCACCTACTGCTGG - Intergenic
1177195726 21:17901541-17901563 AGGCATCTCCCAGGTCCTGCAGG + Intronic
1179853223 21:44148700-44148722 AGGCCCCTCCCACCTACTGCTGG + Intergenic
1180070214 21:45432161-45432183 AGGCCTCTCCCTGCCCCAGCAGG + Intronic
1181080083 22:20408100-20408122 AAGCCCCTCCCAGCACCCACTGG + Exonic
1181429159 22:22867345-22867367 ATGCCTCTCCCAGCTTCTGCTGG + Intronic
1182321693 22:29481872-29481894 AGGCTGTGCCCAGCAGCTGCAGG + Intronic
1182547688 22:31085324-31085346 AGGGCGGTCGCAGAACCTGCGGG + Intronic
1183094026 22:35541425-35541447 AGGCAGCTCCCCGCAGCTCCCGG + Exonic
1183187610 22:36300883-36300905 GGAGCGCTGCCAGCACCTGCAGG - Exonic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183509254 22:38225398-38225420 AGCCCCCTCCCAGCACCTGGAGG - Intronic
1183786282 22:40030871-40030893 AGGACACTACCAGCACCTGGGGG + Exonic
1184439180 22:44498209-44498231 GGCCCGGTCCCTGCACCTGCCGG - Exonic
1184710285 22:46245604-46245626 CTGCCGCTCCCAGCACCAGGTGG - Intronic
1185057376 22:48588020-48588042 AGGGGGCTCCTGGCACCTGCAGG - Intronic
1185248525 22:49786711-49786733 TGGCCGCTCCCAGCACTTGTGGG - Intronic
1185248962 22:49789643-49789665 AGTCTCCTCCCAGCACCTCCGGG + Intronic
950027803 3:9832828-9832850 AAGCTGCCCCCAGCCCCTGCTGG - Intronic
950088581 3:10278739-10278761 AGGACTCTCCCTGCACCTGCAGG + Exonic
950630053 3:14276373-14276395 AGGTGGCTGCCAGCAACTGCAGG + Intergenic
950633228 3:14297953-14297975 GGGCCGCTGCCAGCTCCTGGAGG + Intergenic
954077839 3:48194277-48194299 AAGGAGCTCCCAGCTCCTGCAGG - Intergenic
954289477 3:49642160-49642182 AGGCCACTCCTAGCACAGGCAGG - Intronic
954373792 3:50183845-50183867 AGCCTGCCTCCAGCACCTGCAGG - Intronic
955414971 3:58683740-58683762 AGGCCGCCCCCAGGTCCTGGAGG + Intergenic
958072037 3:88626742-88626764 ATGCAGCTCCCAGCTCCAGCAGG + Intergenic
961319231 3:126061442-126061464 GGGCCGCTCCCACCACTTGCTGG + Intronic
962827875 3:139113240-139113262 AGGCAGCTCCCTGCACCCTCAGG - Intronic
968452329 4:681452-681474 GCGCCGCTCCCAGCCCCAGCGGG + Intronic
968585723 4:1415045-1415067 CGGCCCCTCCCGGCACCCGCAGG + Intergenic
968603713 4:1521819-1521841 AGGCCACGCCAAGCCCCTGCTGG + Intergenic
968903480 4:3441656-3441678 GCGCCGCTCCCAGTCCCTGCAGG - Intergenic
968964432 4:3762846-3762868 AGCCCCCTCCCTGCACATGCAGG - Intergenic
969289608 4:6230293-6230315 AGGCCCCACCCTGAACCTGCTGG - Intergenic
975189033 4:71438043-71438065 AGGCCACTCCCAGCTCGTGCAGG + Intronic
975973272 4:80068049-80068071 AGGCTGCACTCAGCATCTGCAGG + Intronic
978342499 4:107733571-107733593 AGGAAACTCCCAGCAGCTGCTGG + Intergenic
982661349 4:158210470-158210492 AGGCCGCCCCCAGCACGTAGAGG + Exonic
983576839 4:169270334-169270356 AGGCCGCGACCGGCTCCTGCCGG - Intronic
984888566 4:184472964-184472986 ATGCCCCTCCCAGCACGCGCCGG - Intronic
984908448 4:184650117-184650139 AGGCAGTTCTCAGCACTTGCTGG + Intronic
985705727 5:1400477-1400499 AGGCCTCTCCCAGCCCCTCCAGG + Intronic
985744353 5:1637859-1637881 AGGCCACCCCCAGCAGGTGCAGG + Intergenic
988226921 5:28425042-28425064 AGGCTCTTCCCAGCACCTCCTGG + Intergenic
989167480 5:38445877-38445899 TGGGCGCCCCCAGCAGCTGCCGG - Intronic
996661798 5:126012720-126012742 AGTCAGCCCCCATCACCTGCAGG + Intergenic
1001912690 5:175534257-175534279 CGGGCGCTCCCCGCAGCTGCCGG + Intergenic
1002185457 5:177452726-177452748 AGGCCACGCCCAGGACCTGCTGG - Intronic
1002341085 5:178516903-178516925 AGCCCGCTCCCACCAGCTACTGG - Intronic
1002426787 5:179181334-179181356 AGGCTGCCACCACCACCTGCTGG + Intronic
1002441439 5:179266472-179266494 TGGCCCCTCCCAGCTCCTGGGGG - Intronic
1004503202 6:16227112-16227134 AGCCCACTCTCCGCACCTGCTGG + Intergenic
1006364497 6:33607455-33607477 AGGCTCCTCCCAGCCACTGCTGG + Intergenic
1007290310 6:40780736-40780758 AGGCCACTCTCAGCTCCTGGAGG - Intergenic
1007714280 6:43845419-43845441 AGGCCCCACCCCACACCTGCTGG - Intergenic
1011997822 6:93615474-93615496 TTGCTTCTCCCAGCACCTGCAGG - Intergenic
1014240708 6:119015347-119015369 AGGCTGCACGCAGCACTTGCGGG + Intronic
1015712991 6:136162461-136162483 AGGCCCCTCCCATCACATGTAGG + Intronic
1016531189 6:145059516-145059538 AAGCTGCTCCCAGAACCTACAGG + Intergenic
1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG + Intergenic
1017983819 6:159425223-159425245 AGGGCCCTCCCAGCTCATGCTGG + Intergenic
1018239109 6:161754632-161754654 AGTTGGCCCCCAGCACCTGCAGG - Intronic
1018719293 6:166560695-166560717 AGGCCACCCCCTCCACCTGCTGG - Intronic
1019278326 7:187682-187704 TGGCCGGTCCCAGCACCCCCGGG + Intergenic
1019317019 7:391516-391538 CGGCCGCTCCCTGCGTCTGCTGG - Intergenic
1019599102 7:1872611-1872633 AGGCCGCTCTCTGCTCCCGCCGG + Intronic
1021021260 7:15600519-15600541 TGCCTGCTCCCAGCTCCTGCTGG + Intergenic
1022524686 7:31029372-31029394 CTGCCGCTCCCAGGACTTGCAGG + Intergenic
1022603909 7:31789864-31789886 AGGCCTCTCCCAGCATATCCAGG + Intronic
1023814619 7:43940090-43940112 AGTCCCCTCCCAGGACATGCAGG - Intronic
1026595788 7:71733160-71733182 CTGGCTCTCCCAGCACCTGCAGG + Intergenic
1027131228 7:75592630-75592652 AGGCTGCACCCAGCCACTGCAGG + Intronic
1027187661 7:75981618-75981640 AGGCCACCCACCGCACCTGCGGG - Intronic
1029174122 7:98651900-98651922 AGGCTGCTCCCAGCCCGTGATGG - Intergenic
1029487723 7:100853406-100853428 AGGCCCCTCCCGGCTCCTGGGGG - Intronic
1033245274 7:139712506-139712528 AGTCCCCACCCACCACCTGCAGG + Intronic
1033406292 7:141073744-141073766 AAGCCGGCCCCAGCACCTGGAGG + Intergenic
1034101944 7:148457799-148457821 AGCCTGTTCCCAGCTCCTGCTGG + Intergenic
1034435398 7:151060657-151060679 AGTCCGCCCAGAGCACCTGCAGG - Intronic
1034441524 7:151088019-151088041 AGGCCAAACCCACCACCTGCCGG - Intronic
1035396577 7:158538929-158538951 AGCCCAGTCCCAGGACCTGCTGG + Intronic
1035722490 8:1802520-1802542 AGGCAGCTCCCAGCAAAGGCTGG - Intergenic
1036786795 8:11693015-11693037 AGGCTTCTGCCAGCGCCTGCGGG + Intronic
1037655285 8:20877842-20877864 AGGCAGCTCCCAGAATGTGCTGG + Intergenic
1038267187 8:26046262-26046284 AGGCTGCTGCCACCGCCTGCCGG - Intergenic
1038521709 8:28238693-28238715 AGGGCACCCCCACCACCTGCTGG + Intergenic
1040991254 8:53352664-53352686 AGGAGACTCCCAGCAGCTGCCGG - Intergenic
1041459973 8:58100549-58100571 ATGCCTCTCCCAGCTTCTGCTGG + Intronic
1042194346 8:66219810-66219832 GGCCCTCTCCCAGCACCAGCTGG - Intergenic
1044115273 8:88327592-88327614 CCGCCGCCCCCAGCTCCTGCGGG + Intronic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1048369956 8:133768636-133768658 CAGCTGCTCCCAGCATCTGCTGG - Intergenic
1049306122 8:141905202-141905224 AGCCCTCCCCCAGGACCTGCGGG - Intergenic
1049444218 8:142622603-142622625 ACCCAACTCCCAGCACCTGCTGG - Intergenic
1049537875 8:143190348-143190370 TGGCCTCTCCCAGCATCTGGTGG + Intergenic
1049602871 8:143515991-143516013 AGCACACTCCCTGCACCTGCAGG - Intronic
1049685131 8:143936320-143936342 AGGCTGCACCCTGCACCTCCCGG + Intronic
1049800773 8:144516590-144516612 AGGCCGGCTCCAGCATCTGCAGG - Exonic
1049891444 9:73700-73722 AGCCCGATCCCAGAGCCTGCTGG + Intergenic
1052703082 9:31960829-31960851 AGGCTGCTCCCAGCAACTCTGGG - Intergenic
1053004185 9:34593352-34593374 AGACAGCTCCCAGCACCATCCGG + Intergenic
1053293700 9:36898774-36898796 GGGCCGCCCCCAGAGCCTGCTGG - Intronic
1053557696 9:39154843-39154865 AGGCATCTCGCAGCCCCTGCAGG - Intronic
1056350249 9:85742008-85742030 AGCCGGCTCCCAGCACGCGCAGG + Intronic
1056975982 9:91254327-91254349 AGGCCTCTCCCAACAACAGCAGG + Intronic
1057442377 9:95091581-95091603 GGGTCGTTCCCAGCACCCGCGGG + Intergenic
1058040203 9:100294348-100294370 AGGCCTCTCCCTGGACCTCCTGG - Intronic
1060231240 9:121827028-121827050 GGGCCTTGCCCAGCACCTGCAGG - Intronic
1061636826 9:131916729-131916751 GGCCAGCTCCCAGCACCTCCCGG + Intronic
1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG + Exonic
1061993214 9:134171236-134171258 AGGCATCTCCCAGCATCTCCTGG - Intergenic
1062046011 9:134424888-134424910 AGGCCCCGCCCAGCTCCGGCAGG + Intronic
1062374273 9:136254957-136254979 AGGCTGCTCACAGAGCCTGCTGG + Intergenic
1062462671 9:136668427-136668449 AGGCGGCCCTCAGCACCTGTCGG + Intronic
1062566109 9:137164660-137164682 TGGCCGCTGCCAGCACTGGCGGG + Intronic
1185914572 X:4021863-4021885 CTGCCTCTCCCAGCACCTGGGGG - Intergenic
1185970413 X:4655955-4655977 ATGACGTTCCCAGCATCTGCAGG - Intergenic
1186727451 X:12372508-12372530 TGGCTCCTCCCAGGACCTGCTGG + Intronic
1187297602 X:18017145-18017167 AGGCTGCTTCCAGCCCTTGCTGG - Intergenic
1190217654 X:48490670-48490692 ACACCGCCCCCAGAACCTGCAGG - Intergenic
1193234977 X:79095601-79095623 AGCTGGCTCCCAGCACATGCAGG + Intergenic
1194219943 X:91177424-91177446 GGGCCCCTCCCACCACATGCAGG - Intergenic
1195854012 X:109310997-109311019 TGGCCGCTTTTAGCACCTGCAGG + Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic
1200212961 X:154355057-154355079 GGGCCGATGCCAGCACCTGGTGG + Exonic
1201239519 Y:11945220-11945242 CTGCCTCTCCCAGCACCTGGGGG - Intergenic