ID: 1077018098

View in Genome Browser
Species Human (GRCh38)
Location 11:405834-405856
Sequence GAGGAGCGACGCCGCTGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077018094_1077018098 14 Left 1077018094 11:405797-405819 CCAGGGCTGCTGGCAGGGGTTGT 0: 1
1: 0
2: 3
3: 35
4: 337
Right 1077018098 11:405834-405856 GAGGAGCGACGCCGCTGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 120
1077018093_1077018098 15 Left 1077018093 11:405796-405818 CCCAGGGCTGCTGGCAGGGGTTG 0: 1
1: 0
2: 5
3: 62
4: 394
Right 1077018098 11:405834-405856 GAGGAGCGACGCCGCTGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077018098 Original CRISPR GAGGAGCGACGCCGCTGCCC TGG Exonic
900369237 1:2324028-2324050 GAGAGGCGAGGCCGCAGCCCAGG - Intronic
900392934 1:2441606-2441628 GAGGAGCGGCAGCTCTGCCCTGG + Intronic
901497328 1:9629541-9629563 GAGGAGCCACGACCCTGCCGTGG + Intergenic
903600527 1:24535289-24535311 GTGGTGCGAGGCGGCTGCCCTGG + Exonic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
918114027 1:181482202-181482224 GAGGAGCGGCGACGCGGCCATGG + Intronic
920310900 1:205047649-205047671 GAGGAGGGAGGCACCTGCCCAGG + Intronic
923630796 1:235648775-235648797 GAGGAGAGACGCGGCAGCCGCGG + Intronic
1069019145 10:63465992-63466014 GCTGCGCGCCGCCGCTGCCCGGG - Intergenic
1069661671 10:70127282-70127304 GAGGGGCTACGCAGCTGGCCGGG + Intronic
1072656769 10:97335022-97335044 GGGGAGGGAGGCCGCGGCCCAGG - Intergenic
1074843381 10:117375829-117375851 GATGAGCGACGCCGCTGCAGAGG - Intergenic
1075266925 10:121008910-121008932 GAGGAGCTACTTCTCTGCCCAGG + Intergenic
1076347420 10:129788883-129788905 GTGGAGGGACGCTGCTGCCTGGG + Intergenic
1077018098 11:405834-405856 GAGGAGCGACGCCGCTGCCCTGG + Exonic
1077303189 11:1856460-1856482 GCGGTGGGAGGCCGCTGCCCAGG + Intronic
1079396479 11:20067920-20067942 GAGGAGCCACCCTGCTCCCCAGG - Intronic
1083846074 11:65334259-65334281 GAGGAGCGGGGCCGAGGCCCGGG + Intronic
1090666716 11:128919204-128919226 GAGGAGCCAGGCCGCTGTCCAGG - Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1095937987 12:47705778-47705800 GACCCGAGACGCCGCTGCCCTGG + Intronic
1097769975 12:63572319-63572341 GAGGAGAGACCCCTCTGCCTGGG + Intronic
1100186368 12:92144969-92144991 GGGAAGCTGCGCCGCTGCCCCGG - Intronic
1100395029 12:94178396-94178418 GAGAAGAGAAGCTGCTGCCCTGG - Intronic
1101892680 12:108731082-108731104 GAGGTGGGACGAGGCTGCCCAGG - Intronic
1103615381 12:122148477-122148499 AGGGAGCGAGGCCGGTGCCCTGG + Intergenic
1104739632 12:131163554-131163576 GGGGAGCCCCGCTGCTGCCCGGG + Intergenic
1104935445 12:132361732-132361754 GCGGAGCGTCCCCGCTGCCTGGG - Intergenic
1104943606 12:132406013-132406035 CAGGAGCGAGGCCCCAGCCCAGG - Intergenic
1104976416 12:132553947-132553969 GTGGAGCGGAGCAGCTGCCCAGG - Intronic
1106264779 13:28100363-28100385 GAGGAGCGAGGCGGCTGGGCCGG + Intronic
1117336534 14:54760962-54760984 GAGGAGAGAGGCCACTGCCAAGG - Intronic
1120211927 14:81641783-81641805 GAGGAACGACGCGGATGCCAAGG - Intergenic
1122275153 14:100587295-100587317 GGTGAGCGGCGCGGCTGCCCTGG - Intronic
1127858316 15:62971381-62971403 GAGAAGCGACGCTGCTGGACTGG + Intergenic
1129326071 15:74800872-74800894 TAAGAACGACGCCACTGCCCAGG + Exonic
1129675945 15:77632535-77632557 GAGGCGGGAGGCCGCGGCCCCGG + Intronic
1130224159 15:82045252-82045274 CCGGAGCCGCGCCGCTGCCCTGG - Intronic
1130957813 15:88639528-88639550 GAGGGGTGACCCCGCTGACCCGG - Exonic
1131054776 15:89368792-89368814 GGGGAGGGAGGCCCCTGCCCTGG - Intergenic
1132840824 16:1977807-1977829 GGGGAGGGGCGCCACTGCCCTGG - Intronic
1133258210 16:4531635-4531657 GAGGAGAGAAGTGGCTGCCCCGG + Intronic
1135135509 16:19883800-19883822 GAGGAGTGAACCCGCTGCACGGG + Intronic
1136863896 16:33725149-33725171 GAGGAGCCACACCCCCGCCCCGG + Intergenic
1142119121 16:88377251-88377273 GAGCAGCAACGCCCCTCCCCTGG - Intergenic
1142147844 16:88499927-88499949 GAGGAGCGCAGCCGGAGCCCTGG + Intronic
1203125383 16_KI270728v1_random:1573287-1573309 GAGGAGCCACACCCCCGCCCCGG + Intergenic
1144786859 17:17836876-17836898 AGGGAGCGCCGCCGCGGCCCCGG + Exonic
1145230845 17:21172249-21172271 GAGGAGCGGCCCAGCTGCACAGG + Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148603081 17:48908674-48908696 GCGGAGCCAGGCCGCTCCCCGGG - Exonic
1148742703 17:49901909-49901931 AAGGAGCGAGGACGCTGCCGGGG - Intergenic
1150274081 17:63884713-63884735 GAGGAGACACTCCCCTGCCCCGG - Intergenic
1150276239 17:63899518-63899540 GAGGAGACACTCCCCTGCCCTGG - Intergenic
1150278394 17:63914247-63914269 GAGGAGACACTCCCCTGCCCTGG - Intronic
1150279491 17:63920879-63920901 GAGGAGACACTCCCCTGCCCTGG - Intergenic
1150840326 17:68600816-68600838 GAGGAGCGACACCCCTCCACAGG - Exonic
1152568330 17:81110133-81110155 AAGGAGCGCCGCAGCTTCCCAGG - Intronic
1152571120 17:81121705-81121727 CAGGAGCCAGGCTGCTGCCCCGG - Exonic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1158391745 18:57050425-57050447 GAGGAGGCACGCTTCTGCCCTGG - Intergenic
1160455255 18:78994823-78994845 CAGGGGCGCCTCCGCTGCCCGGG - Exonic
1160730848 19:641008-641030 GCGGAGCCAGGCCTCTGCCCCGG - Intronic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1162109467 19:8392170-8392192 GGGGAGCAACACCCCTGCCCTGG - Intronic
1162809175 19:13153973-13153995 GTGGAGAGAAGCCGCCGCCCGGG + Exonic
1165096153 19:33410981-33411003 GAGCAGCTGGGCCGCTGCCCCGG - Intronic
1165153250 19:33773062-33773084 GAGGGGCGCCGCAGCTGGCCGGG + Exonic
1166367699 19:42285689-42285711 GAGGAGAGAGGCCCCTGCTCGGG - Intronic
1166932234 19:46308419-46308441 GAGGAGAGATGGCCCTGCCCTGG + Intronic
926018576 2:9474963-9474985 GAGGGGAAAGGCCGCTGCCCAGG - Intronic
926901358 2:17754362-17754384 GTGGAGAGACGGCGCCGCCCGGG + Intronic
928094171 2:28393759-28393781 CAGGAGAGCCGCTGCTGCCCCGG - Exonic
929033592 2:37671437-37671459 GAGGATCCCAGCCGCTGCCCCGG + Exonic
931745970 2:65292428-65292450 GAGCAGCGAAGCCACTGCCCAGG + Intergenic
932660212 2:73645004-73645026 CAGAAGCGAGGCTGCTGCCCAGG + Intergenic
937208668 2:120253135-120253157 GCGGAGCGGGGCCGCTGCCGGGG - Intronic
938069136 2:128299328-128299350 CAGGAGCGAGCCCTCTGCCCTGG + Intronic
947878673 2:233485910-233485932 GAGGACCTATGCCCCTGCCCTGG - Exonic
948427342 2:237896203-237896225 CAGGAGCCAGGGCGCTGCCCAGG + Intronic
948866920 2:240780236-240780258 GAGGAGCCATGCAGCTGCTCGGG - Intronic
1168991941 20:2102832-2102854 GAGCAGCAACGGCGCTGCCCGGG - Exonic
1173453948 20:43189271-43189293 GAGGAGCGGCACCGACGCCCGGG - Intronic
1175578599 20:60081098-60081120 GAGGTGAGAGGCCGCTGTCCTGG + Intergenic
1176019906 20:62957252-62957274 GAGGAGGCAGGCCGCTCCCCTGG + Intronic
1176155731 20:63619418-63619440 GAGGACTGACGCTGCTGGCCTGG - Exonic
1179177677 21:39021020-39021042 GAAGAGGGAAGCAGCTGCCCTGG - Intergenic
1181173170 22:21021663-21021685 GAGGATGGACACTGCTGCCCAGG - Intronic
1182099584 22:27648531-27648553 GAGGAGAGGAGCTGCTGCCCAGG - Intergenic
1183524361 22:38314891-38314913 GAGGAGGGACCCCTCTGCTCTGG + Intronic
1184035841 22:41917723-41917745 GAGGAGTGACCCCTTTGCCCTGG + Intergenic
953493242 3:43366806-43366828 CAGGAGCCACGATGCTGCCCCGG + Exonic
954686552 3:52373214-52373236 GCGGAGAGACGCCGCCGCCACGG + Intronic
960143542 3:114174151-114174173 GAGGAGGGCAGCCGCTACCCTGG + Intronic
961115546 3:124326093-124326115 GAAGAGCTTCGCTGCTGCCCTGG + Exonic
961259798 3:125593138-125593160 GTGGGGCGCCGCCGCGGCCCTGG - Intronic
963741512 3:149086357-149086379 GAGGAGCGCCTCGGCTCCCCTGG + Exonic
976398714 4:84583720-84583742 GATGACCGCGGCCGCTGCCCGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
982288807 4:153759984-153760006 GCGGAGCGGCGGCCCTGCCCGGG + Exonic
982380067 4:154740611-154740633 CAGGTGCGAGGGCGCTGCCCCGG + Intronic
984667936 4:182448632-182448654 GAGGAACACGGCCGCTGCCCGGG + Intronic
988437591 5:31194090-31194112 CAGGACCGACGCCGCTTCCCGGG + Intronic
1002400020 5:178986481-178986503 GAGGAGCGGCGGGGCTGCCCAGG + Exonic
1002808738 6:604674-604696 GAGGAGATAGGCCGCAGCCCAGG - Intronic
1003640034 6:7868804-7868826 GAGGGGCCACTCGGCTGCCCTGG - Intronic
1004346904 6:14857275-14857297 GAGGACAGAGGCCGATGCCCAGG - Intergenic
1004540019 6:16541115-16541137 GAGAAGCTGCCCCGCTGCCCCGG + Intronic
1006671397 6:35731826-35731848 GCGGAGCGACGGGGCTGCCCGGG - Intergenic
1007180524 6:39926174-39926196 CAGGAGGAACGCCCCTGCCCAGG - Intronic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1015077163 6:129172741-129172763 GAGGGGCGCCGCCATTGCCCAGG - Intronic
1018828437 6:167424133-167424155 GAGGAGCCACGGCCCTCCCCAGG - Intergenic
1019747202 7:2707626-2707648 CAGGAGCGCCCCCACTGCCCAGG + Intronic
1020169165 7:5831740-5831762 GAGGAGGGATGCGGCTGCCGTGG - Intergenic
1022088003 7:27087830-27087852 GAGGGGCGAGGCCTCTGACCTGG + Intergenic
1024796905 7:53031887-53031909 GAGGGGCGCCGCCATTGCCCGGG - Intergenic
1029538616 7:101170276-101170298 GAGGAAAGAAGCCGCTGCTCAGG - Intergenic
1034557118 7:151857321-151857343 GAGGAATGAGGCCGATGCCCAGG + Intronic
1044411765 8:91891786-91891808 GAGGGGCGCCGCCATTGCCCAGG + Intergenic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1049011399 8:139890031-139890053 GAGGACGGAGGCCGCCGCCCCGG + Intronic
1049409014 8:142464201-142464223 GAGGGGCCAGGCCGCCGCCCCGG + Exonic
1061578849 9:131524381-131524403 GAGAAGCGAGGCGGATGCCCTGG - Exonic
1062111229 9:134783117-134783139 AAGGAGCGCAGCTGCTGCCCAGG + Intronic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062355725 9:136161103-136161125 GAGCAGTGAGGCCCCTGCCCAGG - Intergenic
1189335400 X:40168123-40168145 GAGGAAGGACGCGGCTGCCGCGG - Intronic
1190265727 X:48826478-48826500 GGGGGGCGACGCTGCTCCCCGGG - Intergenic