ID: 1077020373

View in Genome Browser
Species Human (GRCh38)
Location 11:414522-414544
Sequence GTGGTAATGGGAGGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 396}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077020373_1077020377 -8 Left 1077020373 11:414522-414544 CCACACACACCTCCCATTACCAC 0: 1
1: 0
2: 3
3: 40
4: 396
Right 1077020377 11:414537-414559 ATTACCACTGCACACAGCTTAGG 0: 1
1: 0
2: 4
3: 30
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077020373 Original CRISPR GTGGTAATGGGAGGTGTGTG TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
901136971 1:7003842-7003864 GAGGTAATAGGAGTTGTGAGAGG + Intronic
901501948 1:9657852-9657874 GTGGCACTGGGAGGGGTTTGGGG + Intronic
901836966 1:11930428-11930450 GTGGAGACGGGAGGTGGGTGGGG + Intergenic
902405709 1:16182221-16182243 AAGGTCATGGGAGGTGTGGGGGG + Intergenic
902825745 1:18972984-18973006 GAGATAGTGGGAAGTGTGTGGGG - Intergenic
902932025 1:19738202-19738224 GTGGTAAGTGGAGTGGTGTGGGG - Intronic
903224359 1:21886459-21886481 GTGGTCCTGGGTGGTGTGTCTGG - Intronic
903645895 1:24896397-24896419 ATGGTGATGGGAGGTGGGAGAGG - Intergenic
903792615 1:25905628-25905650 GTGGGAAGGGGAGGGGTGGGCGG + Intronic
904619452 1:31766542-31766564 GGGGTTGTGGGAGCTGTGTGGGG + Intergenic
905292042 1:36928442-36928464 GTGGCAATGGCAAGTGTTTGGGG + Intronic
906634848 1:47402570-47402592 GTGGAGTTGGGAGCTGTGTGTGG - Intergenic
906655662 1:47546531-47546553 GTGGTGATGGCAGGTTTGTGTGG + Intergenic
907189953 1:52640257-52640279 GTGGCAAGGGCAGGTGTCTGGGG + Intronic
909676812 1:78247783-78247805 GTGTTGATGTGAGGTATGTGTGG + Intergenic
910545961 1:88419363-88419385 CTGGTAGTGGGAGGTGGGGGTGG + Intergenic
910793558 1:91075468-91075490 GTAGGAGTGGGAGGTGAGTGTGG + Intergenic
910793566 1:91075499-91075521 GTAGGAGTGGGAGGTGAGTGTGG + Intergenic
911672717 1:100625166-100625188 GTGGTAGCGGGAGGTCTGGGTGG - Intergenic
913385033 1:118250345-118250367 GAGGTAAAGGTAGGTGGGTGAGG + Intergenic
914423319 1:147550205-147550227 GTGGTAAAGGGAGATGGGTAGGG + Intronic
915841251 1:159215204-159215226 ATGGTAATGGGAGCTGTTGGTGG + Intergenic
916266286 1:162892623-162892645 GGGGTGAAGGGAGCTGTGTGGGG + Intergenic
916368564 1:164061861-164061883 GTGGCAGTGGGGGGTGTGTGTGG - Intergenic
916822209 1:168410461-168410483 GTGGTGGTGGGAGGTGCTTGTGG + Intergenic
917101357 1:171449034-171449056 GTGTTAAGGAGAGGTGTATGTGG + Intergenic
917414817 1:174797667-174797689 GGGGTATGGGGAGGTGTGGGGGG + Intronic
918425887 1:184409354-184409376 GTACTAATGGAAGGTTTGTGGGG + Intronic
919089396 1:192960282-192960304 GTGGGAAAGGGAGGGGAGTGTGG + Intergenic
920368231 1:205459867-205459889 CAGGTAATAGGAGATGTGTGGGG + Intergenic
920779793 1:208978055-208978077 GTGATGATGGGAGTTGTATGTGG + Intergenic
921278040 1:213538462-213538484 GTGGCTGTGGGTGGTGTGTGTGG + Intergenic
921866195 1:220090207-220090229 GTGGGAGGTGGAGGTGTGTGTGG - Intronic
922852771 1:228747873-228747895 GTGATAATGGGAGGTGATGGTGG + Intergenic
924643985 1:245860164-245860186 GTGGGAGTGGGAGGGGTGTGGGG - Intronic
924700211 1:246443955-246443977 GTGGTGATGGGTGGTGAGGGAGG - Intronic
1063174682 10:3540639-3540661 GTGGATGTGGGAGGTGTCTGTGG - Intergenic
1063348915 10:5336672-5336694 GGGGTATTGTGTGGTGTGTGTGG + Intergenic
1064048623 10:12042206-12042228 GTGGGAAGGGGAGTTGTGTCGGG - Intronic
1064710708 10:18121457-18121479 CTGTGAATGTGAGGTGTGTGAGG + Intergenic
1067013048 10:42732379-42732401 GTGGGCATGGGGTGTGTGTGTGG - Intergenic
1067065343 10:43101232-43101254 TTGGTAATGGGAGGGGTGGGGGG + Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067777079 10:49171589-49171611 GTGGGAATGGCAGCTGTGAGGGG - Intronic
1067842987 10:49696751-49696773 GTGGGATTGGGGGGTGTGGGGGG + Intronic
1068795038 10:61070057-61070079 GGCCTAATGGAAGGTGTGTGGGG - Intergenic
1068841498 10:61619756-61619778 TTGGTAAAGGGGGGTGGGTGGGG - Intergenic
1069273411 10:66559542-66559564 CTGCTAATTGGAGGTGGGTGTGG - Intronic
1070823606 10:79377932-79377954 GTGCGAATGTGAGATGTGTGAGG + Intergenic
1072499304 10:95996850-95996872 GGCCTAATGGGAGGTGTTTGAGG + Intronic
1074353416 10:112759772-112759794 GTGGCAATGGGAGACTTGTGGGG - Intronic
1075024686 10:118975883-118975905 GTGGTAATGGGGGATGGGTGAGG - Intergenic
1075041968 10:119115213-119115235 GAGGTCACGGGAGTTGTGTGGGG - Intronic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075602879 10:123783560-123783582 ATGTGAGTGGGAGGTGTGTGTGG + Intronic
1075776889 10:124994993-124995015 GTGGTGATGGGAGGGGCATGTGG - Intronic
1076338260 10:129725135-129725157 GTGGCCTTGGGAGGTGAGTGTGG + Intronic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1077306151 11:1869510-1869532 GTGCGAATGGAAGCTGTGTGAGG + Intronic
1078103485 11:8343881-8343903 GGGGGAATGGGAGCTATGTGAGG - Intergenic
1079088735 11:17465676-17465698 TTGTTAATGGGAGAGGTGTGGGG - Intronic
1079840233 11:25388040-25388062 GTGCTAATGGGAGGGATGTGGGG + Intergenic
1081599497 11:44483555-44483577 GTTGTAGTGGGAGGTGGGGGTGG - Intergenic
1083183535 11:61004167-61004189 GTGTGAATGTGATGTGTGTGGGG - Intronic
1083200228 11:61116759-61116781 GTGGTGGTGCGTGGTGTGTGTGG - Intronic
1083380440 11:62263927-62263949 GTGGTCTTGGGAGGTGTCCGTGG - Intergenic
1083399413 11:62413624-62413646 GTGGCAATGGCAGGTGGGAGGGG - Intronic
1084944793 11:72632773-72632795 GGGGTGGTGGGAGGTGTGAGGGG - Intronic
1085608136 11:77921629-77921651 TTGGTAATTGGGGGTGTGGGTGG - Intronic
1087848436 11:103000061-103000083 ATGGCAAGGGGAGGTGTGGGAGG - Intergenic
1089013320 11:115147626-115147648 GTGGGAAGGTGAGGTGTGTGTGG + Intergenic
1089254306 11:117186258-117186280 GTGGTTTGGGCAGGTGTGTGGGG + Intronic
1089923082 11:122229374-122229396 GTGGTAATGGTAGGTCACTGGGG - Intergenic
1091104376 11:132904796-132904818 GTGGTAATTAGAGCTGTGTGTGG + Intronic
1091108658 11:132944670-132944692 GTGGTGCTGGGAGGTGACTGGGG + Intronic
1091251161 11:134145455-134145477 GTGGTGGTGGGAGGTGGGGGAGG + Intronic
1091290555 11:134437135-134437157 GTGGTAAGGAGAGGTCTTTGGGG - Intergenic
1094201337 12:27797512-27797534 TTGGGAGTGGGAGGTGAGTGCGG + Intronic
1095517419 12:43021654-43021676 CTGGTAAAAGGAGGTGGGTGTGG + Intergenic
1096972986 12:55682262-55682284 GTGGGAAGGGGATGGGTGTGGGG + Intronic
1097693700 12:62757330-62757352 GTTGAAATGGGAGGTGTCTCAGG - Intronic
1098607261 12:72406486-72406508 GTTTTAATAGGAGGTGAGTGGGG + Intronic
1100555406 12:95688234-95688256 GTGGGAATGGGAGGTAAGTTTGG + Intronic
1101095181 12:101331275-101331297 GTGGGAATGGGAGATGGATGGGG + Intronic
1101514132 12:105418875-105418897 GTGTTAATGGAAGGAATGTGTGG - Intergenic
1102217382 12:111170982-111171004 ATGGGAATGGGAGGGGAGTGGGG + Intronic
1103716232 12:122947018-122947040 TTGGCCATGGGCGGTGTGTGTGG + Intronic
1104878885 12:132055591-132055613 GTGGTATAGGGGTGTGTGTGAGG + Intronic
1105938689 13:25127588-25127610 GTGGGAAGGGGAGGGGAGTGGGG + Intergenic
1105946514 13:25194993-25195015 ATAGTAAGGGGAGGTTTGTGGGG + Intergenic
1107502537 13:40995014-40995036 GTGGGAATTGGAGGTGGGGGAGG - Intronic
1107717172 13:43211883-43211905 ATGGTAAGGGAAGGTGTGTAGGG + Intergenic
1108535481 13:51372192-51372214 GGGGTTATGGGAGGAGTGAGAGG - Intronic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1109272711 13:60272331-60272353 GTAGAAATGGGAAGTGTGTGGGG - Intergenic
1109975746 13:69829270-69829292 GTGGTACTGGGGAGTGTCTGTGG - Intronic
1110728103 13:78849610-78849632 GTGGAAATCGGAAGTGTGTGAGG + Intergenic
1111102481 13:83606178-83606200 GTGGCAAAGGGTGGTGTGTCAGG - Intergenic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1111673851 13:91362818-91362840 GAGGTAAAGGGAGGTATCTGGGG - Intergenic
1112338331 13:98532514-98532536 ATGGGTATGGGATGTGTGTGTGG - Intronic
1113661591 13:112110018-112110040 GTCGCAGTGAGAGGTGTGTGTGG - Intergenic
1115443585 14:33463888-33463910 GTGGGGATGGGAGGTTTTTGTGG + Intronic
1117301372 14:54431727-54431749 GTGGTCTTGGGAGGTGTGGAGGG + Intronic
1117968164 14:61226859-61226881 GTGGTAATGGGAAGTGGAAGGGG - Intronic
1118158658 14:63266964-63266986 GGGGTAGTGTGAGGGGTGTGGGG - Intronic
1119717087 14:76867044-76867066 GTGGTAGTGTGTGGGGTGTGTGG + Intronic
1119771207 14:77221432-77221454 GTGTGAGTGGGAGGTGAGTGGGG - Intronic
1119995814 14:79252576-79252598 GTGGTGGTGGGAGGTGGGTAGGG + Intronic
1122329913 14:100904964-100904986 GGGGTAGAGGGAGGTGGGTGTGG + Intergenic
1122770024 14:104093740-104093762 GTGGGAATGGGGAGTGTGGGTGG + Intronic
1122849412 14:104519358-104519380 GGGGGAATGGGACGTGGGTGTGG + Intronic
1123055547 14:105567651-105567673 GTGGTATGGACAGGTGTGTGGGG + Intergenic
1123055595 14:105567851-105567873 GTGGTGTGGGCAGGTGTGTGGGG + Intergenic
1123625223 15:22222720-22222742 GTGGTTTTGGGAGGTGAGGGAGG - Intergenic
1123762969 15:23446829-23446851 GGGGTAATAGGAGGTGAGGGCGG + Intronic
1124496875 15:30192424-30192446 AGGGGAAGGGGAGGTGTGTGCGG + Intergenic
1124746701 15:32346223-32346245 AGGGGAAGGGGAGGTGTGTGCGG - Intergenic
1125476374 15:40050645-40050667 GTGGTTGTGTGTGGTGTGTGGGG + Intergenic
1125796077 15:42404843-42404865 GTTTTAGTGGTAGGTGTGTGGGG + Intronic
1125846501 15:42859595-42859617 GTGGTAATGGGTGGAGAGAGGGG - Intronic
1125926679 15:43568785-43568807 TTGGGAATGGGAGGGCTGTGGGG - Intronic
1125939823 15:43668350-43668372 TTGGGAATGGGAGGGCTGTGGGG - Intergenic
1126097835 15:45101779-45101801 GTGGAAATGGTGAGTGTGTGAGG - Exonic
1126139319 15:45424485-45424507 CTGGTAACTGGAGGTGGGTGGGG + Intergenic
1126854254 15:52822676-52822698 GTGGTGATTGGTGGGGTGTGGGG + Intergenic
1127790496 15:62394216-62394238 GTGGTGTTGTGATGTGTGTGTGG + Intronic
1127797239 15:62449221-62449243 GTGGTATGGGGAGGGGTGTCTGG + Intronic
1127881199 15:63159766-63159788 GTGGTAATGGAAGGTCTGAGAGG + Intergenic
1128707240 15:69845562-69845584 TTGGTAGTAGGAGGTGTGTGTGG + Intergenic
1130324992 15:82872667-82872689 GTGGCACTGTGAGGTGTGTGAGG - Intronic
1130723101 15:86409445-86409467 GTGGGAATGGGGTGTATGTGAGG - Intronic
1130909395 15:88260787-88260809 GTGATACTGGGAGGTGACTGGGG + Intergenic
1131859483 15:96637236-96637258 ATGATAATGGCAGGTGGGTGGGG + Intergenic
1132043390 15:98544816-98544838 GTTTTAATGGGAGGTATGTGAGG - Intergenic
1133319493 16:4904093-4904115 GTGGCAATGGGAGGGGTGGGAGG + Intronic
1133365809 16:5208769-5208791 TTGGTACTGGGAGGTATGTATGG - Intergenic
1133521221 16:6559398-6559420 GTGGTACTAGCAGCTGTGTGTGG - Intronic
1135249834 16:20891616-20891638 GTGGTGATGGGTGGTGGGTGTGG + Intronic
1135394781 16:22122914-22122936 GTGGTATTGGGGTGTGTGTGTGG + Intronic
1135886487 16:26313749-26313771 GCTGTAATGAGAGGTGTGTGAGG + Intergenic
1135990348 16:27215087-27215109 GTTGTAATGGGAGGTTTTGGAGG + Intronic
1138188579 16:54996026-54996048 AGGGAAATGGCAGGTGTGTGGGG + Intergenic
1138276310 16:55737380-55737402 GAGGTAATGGGAAGTGGGAGAGG + Intergenic
1138535468 16:57657606-57657628 GTGGTTAGGGGAGCTGTTTGGGG + Intronic
1138703716 16:58892705-58892727 GTGGTGGTGGTAGCTGTGTGGGG - Intergenic
1138703732 16:58892800-58892822 GTGGTGGTGGCAGCTGTGTGGGG - Intergenic
1138703749 16:58892886-58892908 GTGGTCATGATAGCTGTGTGGGG - Intergenic
1139554335 16:67697057-67697079 GTGGTGATGGGAAATGTATGTGG - Intronic
1140899633 16:79355789-79355811 GTGGCTATGGGCGGCGTGTGGGG + Intergenic
1141194009 16:81846056-81846078 CTGGTAATGGGAGCTGAGTGGGG - Intronic
1142238323 16:88933311-88933333 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238328 16:88933374-88933396 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238333 16:88933437-88933459 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238338 16:88933500-88933522 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238343 16:88933563-88933585 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238348 16:88933626-88933648 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238353 16:88933689-88933711 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142238358 16:88933752-88933774 GTGGCACTGTGAGGCGTGTGAGG - Intronic
1142427316 16:90008052-90008074 GACGTCCTGGGAGGTGTGTGTGG - Intronic
1142427329 16:90008093-90008115 GACGTCCTGGGAGGTGTGTGTGG - Intronic
1142427544 16:90008703-90008725 GAAGTCCTGGGAGGTGTGTGTGG - Intronic
1142970224 17:3606385-3606407 GTGGCAAAGGGAAGGGTGTGTGG + Intergenic
1146810371 17:35898429-35898451 GTGGTAAAGGGTGGGGTGAGGGG - Intergenic
1147649681 17:42054897-42054919 GTGGGCATGGGAGGGGTGTCAGG - Intronic
1148104930 17:45113979-45114001 GTGGGACTGCCAGGTGTGTGGGG + Intronic
1148228362 17:45915412-45915434 GTGGGCATGTGATGTGTGTGTGG + Intronic
1149580676 17:57748517-57748539 GTGGTACTGGGATCTCTGTGGGG - Intergenic
1149751774 17:59153582-59153604 GTGGGAATGGGGGGTGGGTGAGG + Intronic
1150566028 17:66340944-66340966 GTGGGAATCAGAGGAGTGTGGGG + Intronic
1151127251 17:71858258-71858280 GTAATAATGTGAGGTGTGGGTGG + Intergenic
1151381077 17:73726130-73726152 GTGGGACAGGGTGGTGTGTGGGG + Intergenic
1151805985 17:76405717-76405739 GTGCTGGTCGGAGGTGTGTGCGG - Intronic
1152027793 17:77822938-77822960 GTGGCAATGCCAGGTGGGTGCGG - Intergenic
1152695673 17:81792958-81792980 GTGGGGGTGGGTGGTGTGTGTGG - Intergenic
1154290945 18:13106285-13106307 GTGGTGGTGGTAGTTGTGTGGGG - Intronic
1154291002 18:13106574-13106596 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1154291031 18:13106737-13106759 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1157240309 18:46003265-46003287 GTGTTATTGGGAGCTATGTGGGG - Intronic
1157701034 18:49761699-49761721 GTGGGGATGTGGGGTGTGTGGGG - Intergenic
1158560923 18:58513002-58513024 GTGTTTATGTGGGGTGTGTGTGG + Intronic
1159919194 18:74212513-74212535 GTGGCGATGGGAGCTATGTGTGG - Intergenic
1160357153 18:78238172-78238194 GTTGTAAGCGCAGGTGTGTGTGG + Intergenic
1161056876 19:2195124-2195146 GTGGCAGTGGGATGGGTGTGGGG + Intronic
1161085468 19:2333043-2333065 GTGGGGATGGCAGGTGTGGGCGG + Intronic
1162174629 19:8822160-8822182 GTGGGTGTGGGAGGTGGGTGTGG - Intronic
1163039686 19:14593071-14593093 GTGGTAATGAGAGGAGATTGAGG - Intronic
1163773939 19:19206947-19206969 GTGGGAGTGGGAGGGGTGTCTGG + Intergenic
1163953446 19:20612460-20612482 GTCGTAAAGGGAGGAGTGCGAGG + Intronic
1164701673 19:30289142-30289164 GTGGTCATGGTGGGTGGGTGGGG + Intronic
1165745253 19:38226765-38226787 GAGCTAATGGGAGGTGAGAGAGG - Intronic
1168567783 19:57439239-57439261 GTGGAAGTGGGAGGAGTGGGGGG + Intronic
925016279 2:526836-526858 TTTGTAATGTGTGGTGTGTGTGG + Intergenic
925016289 2:526965-526987 GGTGTAATGTGTGGTGTGTGTGG + Intergenic
925451299 2:3971387-3971409 GTGTGAATGTGTGGTGTGTGTGG + Intergenic
925618039 2:5762506-5762528 GGGGTAATGTGAGGTGTCCGAGG - Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927953589 2:27191289-27191311 GTGTTAATGGGGGCTCTGTGGGG + Intergenic
928169682 2:28995243-28995265 GGGGTAGTGGGAGCAGTGTGTGG + Intronic
929472559 2:42210031-42210053 AAGGGAATGGGGGGTGTGTGTGG - Intronic
930934385 2:56929745-56929767 GGGGCAATGGGTGGTGAGTGAGG + Intergenic
931251049 2:60530812-60530834 GGGGTAGTGGGAGGTGGGGGAGG - Intronic
932424085 2:71618340-71618362 GTGGTAGAGGGGTGTGTGTGTGG + Intronic
932454157 2:71835578-71835600 ATGGGAATGGGAAGTGTGTTAGG - Intergenic
933172340 2:79137929-79137951 GGGGTTGTGGGAGGTATGTGTGG + Intergenic
933933590 2:87180648-87180670 GTGATAATTGGAGATGTCTGTGG + Intergenic
936359521 2:111784796-111784818 GTGATAATTGGAGATGTCTGTGG - Intronic
937100892 2:119267511-119267533 TGGGTAATGGGAGGGGTATGTGG + Intergenic
938323761 2:130383386-130383408 GTGGAAATGGGGGCTGTTTGGGG + Intergenic
938399482 2:130977070-130977092 GTGTTACTGTGTGGTGTGTGTGG + Intronic
938680656 2:133686621-133686643 CTAGAAATGGGAGGTGTTTGTGG - Intergenic
939342644 2:140918716-140918738 ATGGTATTGGGAGGTTTGGGAGG + Intronic
939371224 2:141303435-141303457 CTGGTAAGGAAAGGTGTGTGGGG - Intronic
941001139 2:160204937-160204959 TTGGTAATGGGAGGTGAGGCTGG + Intronic
941203249 2:162540923-162540945 GTGGTAATGAGGGGTCTGTTTGG + Intronic
941349950 2:164419676-164419698 GGGGCAATGGGAGGTGGGTTGGG - Intergenic
942390959 2:175492552-175492574 GGCCTAATGGGAGGTGTCTGGGG - Intergenic
943745661 2:191460366-191460388 ATGGTAGTGGGGTGTGTGTGTGG - Intergenic
944068701 2:195646614-195646636 GTGGTGGGGGGAGGTGGGTGGGG - Intronic
944523411 2:200594374-200594396 GTGTTGAAGGGAGGTCTGTGAGG + Intronic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946225160 2:218260671-218260693 GTGGCAGTGGCAGGTGTTTGGGG - Intronic
946694004 2:222333743-222333765 GTGGTAGTGGCAGGTTGGTGGGG - Intergenic
947516970 2:230814450-230814472 GTGGCACAGGCAGGTGTGTGAGG + Intronic
947520184 2:230839539-230839561 GTGGTATTCAGGGGTGTGTGAGG + Intergenic
947590665 2:231383304-231383326 GTGCTAAGCTGAGGTGTGTGAGG + Intergenic
947977267 2:234377671-234377693 GGGGAAATGGGCGGTGTGTCAGG + Intergenic
948367237 2:237464933-237464955 GTGGTTGTGTGTGGTGTGTGCGG + Intergenic
948605011 2:239129436-239129458 GTGGTGCTGGGCGGGGTGTGGGG + Intronic
948797714 2:240413182-240413204 GTGGAAATGGGAGGGCTGAGAGG + Intergenic
1170168466 20:13385110-13385132 TTGGAAATGGGTGTTGTGTGAGG + Intergenic
1170411427 20:16096279-16096301 GGGGGATTGGGAGGGGTGTGGGG + Intergenic
1170470647 20:16664636-16664658 GTGGCATCAGGAGGTGTGTGTGG + Intergenic
1170881967 20:20304749-20304771 GGGGAAATGGGAGCTGTGGGTGG + Intronic
1171428978 20:25067265-25067287 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
1172983997 20:38967928-38967950 GTTGTAATGGGGGGTGGGGGAGG - Intronic
1173069036 20:39743655-39743677 GTGGTAATTGTATGTGTGTCTGG + Intergenic
1173946880 20:46958679-46958701 GTGGTGGTGGGAGGTGGGAGAGG - Intronic
1175172626 20:57091063-57091085 GTGTGCATGGGTGGTGTGTGTGG - Intergenic
1175172644 20:57091149-57091171 GTGTGCATGGGTGGTGTGTGTGG - Intergenic
1175172662 20:57091234-57091256 GTGCACATGGGTGGTGTGTGTGG - Intergenic
1175611761 20:60357603-60357625 GGGGAAATGGGGGGAGTGTGAGG + Intergenic
1176372405 21:6070121-6070143 GTGGTTGTGTGAGGTATGTGGGG + Intergenic
1179583642 21:42361181-42361203 GAGGTAAGAGGAGGTGTCTGTGG + Intergenic
1179603604 21:42497163-42497185 GAGGAAATGGGAGATGTGAGGGG - Intronic
1179751113 21:43468418-43468440 GTGGTTGTGTGAGGTATGTGGGG - Intergenic
1179769692 21:43605509-43605531 GTGTTTGTGGGAGGTGCGTGGGG - Intronic
1180790681 22:18573987-18574009 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1181025110 22:20123424-20123446 GTGGTGTTGGGGGGGGTGTGTGG + Intronic
1181231056 22:21421327-21421349 GTGGGGATGGGAGCTCTGTGTGG + Intronic
1181247592 22:21513541-21513563 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1181691998 22:24568284-24568306 GTGGCAGTGGGTGGTGGGTGTGG - Intronic
1182018331 22:27059964-27059986 TAGGTACTTGGAGGTGTGTGAGG + Intergenic
1182096846 22:27631168-27631190 GGGGTGGTGGGAGGTGGGTGGGG - Intergenic
1182150608 22:28024597-28024619 GTGGTAATGGGATCAGTGTGAGG + Intronic
1182884139 22:33758919-33758941 GCGGTTATGGGAGGGGAGTGAGG - Intronic
1183062140 22:35342710-35342732 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183062188 22:35343024-35343046 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183062207 22:35343147-35343169 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183933015 22:41246823-41246845 GTGGGGATGGGAGGTGCGAGAGG + Intronic
1184776619 22:46626591-46626613 GTGGGGCTTGGAGGTGTGTGTGG + Intronic
1185351137 22:50339749-50339771 GTGGTGGTGTGTGGTGTGTGTGG + Intergenic
1185409357 22:50674231-50674253 GTGGGGGCGGGAGGTGTGTGCGG - Intergenic
949480558 3:4490831-4490853 GTTTTAATGGAAGGTGTGTCAGG - Intergenic
949576358 3:5342537-5342559 GAGGTATAGGGATGTGTGTGAGG + Intergenic
950801023 3:15551973-15551995 GTGGAAATGGGAGGGAAGTGTGG - Intergenic
950891762 3:16410404-16410426 GTGGTGATGGTATGGGTGTGGGG + Intronic
951116299 3:18866740-18866762 GTGGTAATGGGAGATGATGGGGG + Intergenic
952976944 3:38704729-38704751 GAGGTGAGAGGAGGTGTGTGAGG + Intronic
953554035 3:43928203-43928225 GAGAGAGTGGGAGGTGTGTGAGG - Intergenic
953688688 3:45098643-45098665 ATGGGAATGGGAAGTGTGTGTGG - Intronic
953949391 3:47176997-47177019 GGTGTAATGGCAGGTGGGTGTGG + Intergenic
954445286 3:50543012-50543034 GTGGAGCTGGGAGGTGGGTGCGG + Intergenic
954969881 3:54642642-54642664 GTGGTAATGGGGGCCGTGGGAGG - Intronic
956339293 3:68203951-68203973 GTGGTCATGGGGGGTGGGGGGGG - Intronic
956485131 3:69714584-69714606 GTGGTATTTGAGGGTGTGTGTGG - Intergenic
956771917 3:72534169-72534191 GTGGTTGTGTGTGGTGTGTGTGG + Intergenic
959558190 3:107747583-107747605 GTGGTATTGGGAAGAGAGTGAGG + Intronic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
961231302 3:125313540-125313562 GTTGTAATGGGTGGAGTGTCTGG - Exonic
962990090 3:140569966-140569988 GTGGTAATGAGGGCTGGGTGCGG - Exonic
963709289 3:148728006-148728028 GTGGGAGAGGGAGGTGTGGGGGG - Intronic
964209552 3:154211951-154211973 GTGGTAAAGGGAGGAGAGTTTGG + Intronic
966332127 3:178826166-178826188 GTGGAAAAGGGAGGAGGGTGGGG - Intronic
966336059 3:178869578-178869600 GTGGTTAGTGGAGGTGTGAGAGG - Intergenic
966642425 3:182205638-182205660 GAGGGAGAGGGAGGTGTGTGTGG - Intergenic
967089746 3:186125451-186125473 GTGGTGTGGGGGGGTGTGTGTGG + Intronic
967089818 3:186125947-186125969 GTGGTGATGGTATGTTTGTGTGG + Intronic
967089851 3:186126174-186126196 GTGGTGATGGTATGTTTGTGTGG + Intronic
967117507 3:186355224-186355246 GCGGTGATGGTAGTTGTGTGGGG - Intronic
967256489 3:187597985-187598007 GTGGTAATGGGCGTTGTGGGTGG - Intergenic
967770304 3:193326960-193326982 GTGAAAATGGAAGGTGTGTTTGG - Intronic
967884923 3:194326577-194326599 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
967884962 3:194327080-194327102 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
967885014 3:194327618-194327640 GTGGTTGTGTGTGGTGTGTGTGG - Intergenic
967886646 3:194337899-194337921 GTGGTGTTGGGAGATGTGAGAGG + Intergenic
968547658 4:1206966-1206988 GGGGCAATTGGAGGTGGGTGGGG + Intronic
968669187 4:1839616-1839638 GTGATAATGTTAGGTGTGTCAGG + Intronic
969105105 4:4801603-4801625 GTGGTAATGGGAGGAGGCTGGGG - Intergenic
969881487 4:10177911-10177933 GTGGTCATGGGAGGCATCTGGGG - Intergenic
970514564 4:16815321-16815343 AGGGTATGGGGAGGTGTGTGTGG + Intronic
972096809 4:35358147-35358169 ATGGGGATGGGAGGTTTGTGTGG - Intergenic
972169749 4:36331594-36331616 GTGGGAATGGGAGGAGTGTGAGG + Intronic
975983426 4:80183684-80183706 GTGGTGTGGGGAGGTGTGTGAGG - Intergenic
975986863 4:80208115-80208137 GTGGGTATGTGATGTGTGTGTGG - Intergenic
979013079 4:115396052-115396074 CTGGTAATGAGTGGTGTGGGTGG + Intergenic
979113879 4:116796239-116796261 GTGGTGCTCTGAGGTGTGTGAGG - Intergenic
981048533 4:140289051-140289073 GTGTTAATGGTCTGTGTGTGAGG - Intronic
981069822 4:140523399-140523421 GGGGTAATGGGGAGTCTGTGGGG - Intergenic
981872540 4:149504476-149504498 GGGGTCATGGGGGGTGGGTGTGG - Intergenic
984757836 4:183340397-183340419 GGGGTAATGGGAGGAGGATGAGG - Intergenic
984887528 4:184463880-184463902 CTGGTAAAGGCAGGTGTGAGGGG + Intronic
985776740 5:1848296-1848318 GTGGTAGGAGGAGGTGGGTGGGG + Intergenic
986297000 5:6447912-6447934 GTGTGAATGTGTGGTGTGTGTGG - Intergenic
986524982 5:8664100-8664122 GTTGGAATGGGATGTGTGGGAGG + Intergenic
986806317 5:11311853-11311875 GTGGGAAGGGGGAGTGTGTGGGG - Intronic
988081044 5:26416076-26416098 GTGGAGAGGCGAGGTGTGTGTGG + Intergenic
988171368 5:27661014-27661036 ATGGTAATGGGAGGTTTGTGGGG - Intergenic
990213202 5:53502645-53502667 GTGGTAATGGGGGGTGAGGGGGG + Intergenic
991527830 5:67581916-67581938 GTGGTAATGGCAAGGTTGTGTGG - Intergenic
993723036 5:91340587-91340609 TTGGGAATGGGAGGTGGCTGGGG - Intergenic
994340091 5:98616987-98617009 GAGGGAATGTGGGGTGTGTGGGG - Intergenic
994958109 5:106561638-106561660 GTGGAATTGGGATGTGTGGGAGG + Intergenic
996017279 5:118553850-118553872 TTGCCAATGGGATGTGTGTGAGG + Intergenic
996017919 5:118561597-118561619 ATGGCATTGAGAGGTGTGTGAGG - Intergenic
998232949 5:140373095-140373117 GTGGAAATGGGTGTTGTGGGGGG + Intronic
1000858634 5:166430510-166430532 GTGGGAAGGGGAGGTGTGCAGGG - Intergenic
1001562104 5:172676549-172676571 GAGGCAATGGGAGGTGGGGGTGG + Intronic
1001640840 5:173243013-173243035 GTGGTTACGTGTGGTGTGTGTGG - Intergenic
1002258995 5:177981460-177981482 GAGGTCACGGCAGGTGTGTGAGG + Intergenic
1003002800 6:2351683-2351705 GGGGAAGTGGGAGGTGGGTGGGG - Intergenic
1003135720 6:3433423-3433445 GGAGTGATGGGAGGAGTGTGGGG - Intronic
1004617073 6:17300823-17300845 GTGGGAGTGAGAGGAGTGTGGGG + Intergenic
1004860909 6:19804024-19804046 GTGGAAACTGGAGGTGTGGGGGG + Intergenic
1006389403 6:33749658-33749680 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006389772 6:33751526-33751548 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006460310 6:34154253-34154275 GCGGTGAGGGGAGGTGTGTGCGG - Intronic
1007102778 6:39261528-39261550 GTGGCAAAGGGATGTGTGTTCGG + Intergenic
1007320813 6:41027865-41027887 GTGGTTAGGGGAGGTGGGTGTGG - Exonic
1008033662 6:46723982-46724004 GTGGGGATGGAAGGTGGGTGTGG - Intronic
1008540028 6:52538367-52538389 GTGGGCATAGGATGTGTGTGGGG + Intronic
1008621559 6:53276482-53276504 GTGGTAAAGGAAGGTCTCTGAGG - Intronic
1008849732 6:56010775-56010797 GTGGTAAGGGGTGATATGTGGGG + Intergenic
1011000469 6:82582883-82582905 GGGGGCATGGGAGGTGAGTGTGG - Intergenic
1011547876 6:88500603-88500625 GTGGCAAGGGGATGTGGGTGTGG + Intergenic
1012132231 6:95511402-95511424 TTGGTAATGGCAGTTGTTTGAGG - Intergenic
1012256271 6:97036549-97036571 GTGATGATGGGTGGGGTGTGTGG + Intronic
1013042951 6:106454363-106454385 GTGGTAGTGGGGTGTGTGTGTGG - Intergenic
1013078660 6:106793260-106793282 GTTGGAATGGGAGCTGGGTGTGG - Intergenic
1013305837 6:108846626-108846648 GTGGAAAGGGAAGATGTGTGGGG + Intergenic
1013369516 6:109456542-109456564 TGGGGAATGGGAGGGGTGTGTGG + Intergenic
1014627814 6:123751195-123751217 GTGGTCAAGAGAGGTCTGTGTGG + Intergenic
1015384909 6:132610837-132610859 TTGGTGATGGGAGGTGTGCAGGG + Intergenic
1015407566 6:132855040-132855062 GGCCTAATGGGAGGTGTTTGGGG + Intergenic
1015555685 6:134459246-134459268 GAGGAAATGGGAGGAGTGTGGGG - Intergenic
1016745049 6:147570337-147570359 GTGGTAAGAGGGGCTGTGTGTGG + Intronic
1017019186 6:150126814-150126836 GTGGGAATGGCAGGGGTGTGTGG + Intergenic
1019127965 6:169853827-169853849 GGGATAATTGGAGGAGTGTGTGG + Intergenic
1019137619 6:169921010-169921032 GTGGTAGTGTCTGGTGTGTGGGG + Intergenic
1019335697 7:481571-481593 GTGGGGAGGGGAGGAGTGTGGGG - Intergenic
1021620863 7:22550068-22550090 GTGGTGATGGCGGGGGTGTGTGG + Intronic
1021836507 7:24681785-24681807 GTGGTAGGGGGAAGGGTGTGGGG - Intronic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022518407 7:30989802-30989824 GAGGCAATGGTGGGTGTGTGGGG + Intronic
1022528821 7:31054306-31054328 GTGGTGAGGGGAGGTGTCTGTGG + Intronic
1022629143 7:32069446-32069468 GTAGTAATGGAAGGTGTCTTTGG + Intronic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024098289 7:46003942-46003964 GTGGCCATGGGAGGGGTGGGTGG + Intergenic
1025844767 7:65186212-65186234 TTGGTAATTGGGGGTGTGGGTGG + Intergenic
1025895095 7:65692545-65692567 TTGGTAATTGGGGGTGTGGGTGG + Intergenic
1027885123 7:83894350-83894372 GGGGGAAGGGGAGGTGTGAGTGG + Intergenic
1028404507 7:90461093-90461115 GTGATAATGTTAGGTGTGTGAGG - Intronic
1031589378 7:123570784-123570806 GTGGTAATGGGAAATGGATGGGG - Intronic
1031779470 7:125942942-125942964 CTTGTAATGGGATGTGTGGGAGG - Intergenic
1032094810 7:128932718-128932740 TAGGTCATGGGAGGGGTGTGGGG - Intergenic
1032551327 7:132787053-132787075 GTGGGACTGGGAGGAGTGAGGGG + Intronic
1033574876 7:142671205-142671227 GAGGTACTGAGAGGTATGTGAGG - Intergenic
1034068676 7:148161534-148161556 GTGTGTATGGGAGGTGGGTGAGG - Intronic
1035605828 8:929253-929275 GGGGGAATGGCAGGGGTGTGTGG - Intergenic
1035605879 8:929415-929437 GGGGGAATGGCAGGGGTGTGTGG - Intergenic
1035678664 8:1471653-1471675 CTCATAAAGGGAGGTGTGTGGGG - Intergenic
1036014046 8:4760979-4761001 ATGATAAAGGGAGGTGAGTGTGG - Intronic
1036691239 8:10946120-10946142 GTGACACAGGGAGGTGTGTGTGG - Intronic
1037352442 8:17975487-17975509 GTGGTAAATAGAGGTGGGTGGGG + Intronic
1038417039 8:27404620-27404642 GTGGTGAGGACAGGTGTGTGTGG - Intronic
1039074590 8:33678430-33678452 GTGGTAGTGGGTGGTGGTTGAGG + Intergenic
1039132365 8:34280702-34280724 TGTGTAATGGGAAGTGTGTGTGG + Intergenic
1039911993 8:41833324-41833346 GTGGTGATAGCAGGTGTCTGGGG + Intronic
1040046289 8:42967269-42967291 TAAGTCATGGGAGGTGTGTGTGG - Intronic
1043766953 8:84147624-84147646 GTGGTAAATGAAGGTGTGAGAGG - Intergenic
1044316121 8:90751468-90751490 GTAGTTATGGGATGTATGTGTGG + Intronic
1047247048 8:123155201-123155223 ATGGCATTGGGAGGTGAGTGAGG - Intergenic
1047643418 8:126844831-126844853 GTGGGAATGTGTGGTGTGTATGG - Intergenic
1048292999 8:133194565-133194587 GTGGTATGGAGGGGTGTGTGGGG + Intronic
1048363955 8:133722034-133722056 GTGTTAATTAGAGGTGTGAGAGG + Intergenic
1048638560 8:136326965-136326987 TTGCTAATGGCACGTGTGTGGGG - Intergenic
1048885247 8:138904336-138904358 GTGGTAAGGGTGTGTGTGTGGGG - Intronic
1049548382 8:143245439-143245461 GTGGAAATGGGAAGTGTTGGGGG + Intergenic
1049569802 8:143363986-143364008 GTGATACTGGAACGTGTGTGAGG - Intergenic
1049690101 8:143954545-143954567 GTGGTCGTGGGGGGTGGGTGAGG - Intronic
1049930636 9:453216-453238 TTGGTAATAGGATGTTTGTGTGG + Intronic
1051125697 9:13802768-13802790 GTGTTAATGGCAGGTAGGTGGGG - Intergenic
1052887343 9:33662625-33662647 GAGGTACTGAGAGGTATGTGAGG - Intergenic
1053148584 9:35728620-35728642 GTCGTGATGGGATCTGTGTGGGG - Intronic
1054825414 9:69567973-69567995 GTGGTGATGGGAGTTTTCTGGGG - Intronic
1056464190 9:86837906-86837928 CTGGTAATTGGAGGAGTTTGTGG + Intergenic
1056558951 9:87713098-87713120 GTGTTTATGTGATGTGTGTGTGG + Intergenic
1056713547 9:89010453-89010475 GGGGTTAGGGGAGGTGGGTGGGG + Intergenic
1056910291 9:90693988-90694010 GTGTGTATGGGTGGTGTGTGGGG + Intergenic
1057222312 9:93263836-93263858 GGGGTACTTGGGGGTGTGTGGGG + Intronic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1060158617 9:121338828-121338850 GTGGTGGTGGAGGGTGTGTGTGG + Intergenic
1060846150 9:126839193-126839215 GTGGTAACAGAAGGTTTGTGTGG - Intergenic
1061024607 9:128040214-128040236 GTTATAATGTTAGGTGTGTGAGG + Intergenic
1061628038 9:131853597-131853619 GAGGGAAGAGGAGGTGTGTGTGG + Intergenic
1062311604 9:135940925-135940947 GTGGTGCTGGGAGCTGTGTGGGG - Intronic
1062386165 9:136312353-136312375 GTAGTAACGGGAGGGCTGTGGGG + Intergenic
1062663619 9:137654358-137654380 GTGGTAAGGGGTGGGGGGTGGGG - Intronic
1062716667 9:138013983-138014005 TGGGGAATGGGAGGTGTGGGGGG - Intronic
1186190415 X:7062461-7062483 TGGGAAATGGAAGGTGTGTGTGG + Intronic
1186297745 X:8169186-8169208 GGGGGAAGAGGAGGTGTGTGGGG - Intergenic
1186325126 X:8467318-8467340 GGGGGAAGAGGAGGTGTGTGGGG + Intergenic
1186407109 X:9313751-9313773 GTGGTGATGGGAAGTGGATGGGG + Intergenic
1187552910 X:20323907-20323929 AAGGCAATGGGAGGTGGGTGTGG - Intergenic
1190542717 X:51495636-51495658 CTGCTTTTGGGAGGTGTGTGTGG - Intronic
1191685949 X:63891094-63891116 GTGGCAGTGGGAGGAGGGTGAGG + Intergenic
1192249753 X:69402030-69402052 GTGGAATTGGGAGGTGTTTCTGG - Intergenic
1192840026 X:74845256-74845278 GTGGCAGTGCAAGGTGTGTGGGG - Intronic
1193416083 X:81226067-81226089 GTGCCAATGGGAGGTGGTTGGGG - Intronic
1195732858 X:107982838-107982860 GGGGTGATGGGAGGAGTGTGGGG - Intergenic
1196871414 X:120116238-120116260 GTGGAGATGGGAGGTGTGGGTGG + Intergenic
1198087374 X:133293891-133293913 GTGGTGGTGGGATGGGTGTGGGG - Intergenic
1199966878 X:152827725-152827747 GTGATAAAGGGAGGTCCGTGGGG + Exonic
1200042901 X:153382540-153382562 GTGTTCATGTGTGGTGTGTGTGG - Intergenic
1200042956 X:153383087-153383109 GTGTTCAAGTGAGGTGTGTGTGG - Intergenic
1200043018 X:153383613-153383635 GTGTTCATGTGGGGTGTGTGTGG - Intergenic
1200212990 X:154355150-154355172 GTGGCAATGAGAGGCCTGTGTGG - Intronic
1200837844 Y:7750212-7750234 GTGGTGACGGTAGGTGTGTGGGG + Intergenic
1200951150 Y:8901559-8901581 ATGGTAGTGGAAGTTGTGTGTGG - Intergenic