ID: 1077021604

View in Genome Browser
Species Human (GRCh38)
Location 11:419491-419513
Sequence CATTCCCAGGAGAAAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 254}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077021596_1077021604 1 Left 1077021596 11:419467-419489 CCCAGGGGTACCAACAGGTCCAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021586_1077021604 24 Left 1077021586 11:419444-419466 CCAGGCCCCAGCCTCACTAAAGC 0: 1
1: 1
2: 1
3: 17
4: 253
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021587_1077021604 19 Left 1077021587 11:419449-419471 CCCCAGCCTCACTAAAGCCCCAG 0: 1
1: 0
2: 2
3: 33
4: 369
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021582_1077021604 30 Left 1077021582 11:419438-419460 CCACCCCCAGGCCCCAGCCTCAC 0: 1
1: 1
2: 20
3: 261
4: 2003
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021593_1077021604 13 Left 1077021593 11:419455-419477 CCTCACTAAAGCCCCAGGGGTAC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021595_1077021604 2 Left 1077021595 11:419466-419488 CCCCAGGGGTACCAACAGGTCCA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021584_1077021604 26 Left 1077021584 11:419442-419464 CCCCAGGCCCCAGCCTCACTAAA 0: 1
1: 0
2: 3
3: 37
4: 712
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021597_1077021604 0 Left 1077021597 11:419468-419490 CCAGGGGTACCAACAGGTCCAGC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021590_1077021604 17 Left 1077021590 11:419451-419473 CCAGCCTCACTAAAGCCCCAGGG 0: 1
1: 0
2: 1
3: 25
4: 234
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021583_1077021604 27 Left 1077021583 11:419441-419463 CCCCCAGGCCCCAGCCTCACTAA 0: 1
1: 0
2: 6
3: 42
4: 504
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021585_1077021604 25 Left 1077021585 11:419443-419465 CCCAGGCCCCAGCCTCACTAAAG 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021588_1077021604 18 Left 1077021588 11:419450-419472 CCCAGCCTCACTAAAGCCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 224
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
1077021598_1077021604 -9 Left 1077021598 11:419477-419499 CCAACAGGTCCAGCCATTCCCAG 0: 1
1: 0
2: 0
3: 23
4: 276
Right 1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077021604 Original CRISPR CATTCCCAGGAGAAAGGGTC TGG Intronic
901309679 1:8259390-8259412 TATTCCCAGAAGAAAGGGAATGG - Intergenic
901841446 1:11956550-11956572 AAGCCCCAAGAGAAAGGGTCTGG - Intronic
902688749 1:18096480-18096502 CATTCTCAGGAGATGGGGCCAGG + Intergenic
903363922 1:22794340-22794362 CAGTCCCAGGACGAAGGCTCGGG + Intronic
907109963 1:51918198-51918220 CACTCCCAGGAGAAAGGGGTTGG + Exonic
907489275 1:54798602-54798624 CATTCCCAGAAGAGGGGCTCAGG + Intronic
907670812 1:56473416-56473438 TCTTCCCAGAAGGAAGGGTCAGG + Intergenic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
908887376 1:68804970-68804992 CAGTTCCAGGAGAAATGATCAGG - Intergenic
910515983 1:88060755-88060777 CCTTCCCAGCAGCAAGGGTACGG + Intergenic
915571351 1:156746933-156746955 CACACCCAGGAGAAGGGGTGGGG + Intronic
916344370 1:163771363-163771385 TATTACCAGGAGAAAGGGCAAGG + Intergenic
918015622 1:180630436-180630458 CCTTGCCAGGAGAAAGAGACAGG - Intergenic
918548116 1:185708252-185708274 GATACCCAGGCAAAAGGGTCTGG + Intergenic
918582375 1:186146149-186146171 CATTGACAGGAAAAAGGGTGAGG + Intronic
918699300 1:187587601-187587623 CAAGCCAAGGAGAAAGGCTCAGG - Intergenic
919377889 1:196817218-196817240 GATACCCAGGAAACAGGGTCTGG - Intergenic
919799109 1:201341684-201341706 CAATGACAGGAGAAAGAGTCAGG - Intergenic
919897140 1:202015940-202015962 CATTCACAGGAGAAAGGAGCTGG - Exonic
922066309 1:222146619-222146641 GATACCCAGGAAAAAGGGTCTGG + Intergenic
922089878 1:222385795-222385817 CAAAGCCAGGAGAAAGGGTAGGG + Intergenic
922688559 1:227667569-227667591 CATTCCCAGGAGAAAATTCCTGG - Intronic
924316412 1:242802131-242802153 AATTCCCAGGGGAAAGGGAATGG + Intergenic
1067036980 10:42928018-42928040 CAGACCCAGGAGACAGGCTCAGG - Intergenic
1067713761 10:48671550-48671572 CGTTCCCAGGCGGAAGGGACAGG - Intergenic
1069154436 10:65009263-65009285 CATTTCAAGGCGAAAGAGTCAGG - Intergenic
1071244338 10:83746472-83746494 GATACCCAGGCAAAAGGGTCTGG - Intergenic
1072548118 10:96456362-96456384 AGTTCCCAGGAGACAGGGGCAGG + Intronic
1073132421 10:101198180-101198202 AATGCCCAGGAGAAAGACTCTGG + Intergenic
1073694383 10:105848920-105848942 CAATACCTGGAGAAAGTGTCAGG + Intergenic
1073795361 10:106981815-106981837 CATTCACAGGAAAGAGGGACAGG - Intronic
1076598268 10:131639142-131639164 CATTCTGAGGACAAAGGGACAGG - Intergenic
1076818265 10:132925245-132925267 CCTTCCCAGGACAAAGGCTTTGG + Intronic
1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG + Intronic
1077910530 11:6568406-6568428 CAGTCCTTGGATAAAGGGTCAGG - Intronic
1079338813 11:19595275-19595297 CATCCTCAGGAGAAAGACTCAGG + Intronic
1081756427 11:45548057-45548079 CATGACCAGGAGAGAGGGACTGG + Intergenic
1082771580 11:57211632-57211654 CATTCCCAGGAGAAAGAAGGAGG - Intergenic
1082815627 11:57506651-57506673 GAGTCCCAGTAGAAAGGTTCTGG + Intronic
1084483456 11:69434945-69434967 CACTCCCTAGAGAAAGGGGCAGG + Intergenic
1084490764 11:69476924-69476946 CATTCCCAGGCTGAAGGCTCGGG + Intergenic
1085579783 11:77639911-77639933 CAGTCCCAGGAGATGGGGACGGG - Intergenic
1086757499 11:90582730-90582752 GATACCCAGGAAACAGGGTCTGG - Intergenic
1087205275 11:95387539-95387561 CCTTCCCAGATGAAAGGATCAGG + Intergenic
1087269155 11:96093265-96093287 CATTGCCAGGAGAATGTGTATGG + Exonic
1089913603 11:122128757-122128779 AATTCTCAGGAGAGAAGGTCAGG + Intergenic
1090486476 11:127116907-127116929 AATTTCCAGGAGAAAGTGCCAGG - Intergenic
1090965024 11:131590971-131590993 CACTCCCAGGAGAAGGGCTCCGG + Intronic
1091093171 11:132792508-132792530 CATTTCCATGAAAAAGGGTGTGG + Intronic
1091369504 11:135046837-135046859 CCGTCTCAGGCGAAAGGGTCTGG + Intergenic
1091369519 11:135046888-135046910 CCGTCTCAGGCGAAAGGGTCTGG + Intergenic
1091369534 11:135046939-135046961 CCGTCTCAGGCGAAAGGGTCTGG + Intergenic
1091369549 11:135046990-135047012 CCGTCTCAGGCGAAAGGGTCTGG + Intergenic
1091369564 11:135047041-135047063 CCGTCTCAGGCGAAAGGGTCTGG + Intergenic
1092066345 12:5592714-5592736 AATTCCAAGGAGAAATGGTGAGG + Intronic
1093432151 12:19096188-19096210 TATTACCAGGAAAAAGGGTAGGG + Intergenic
1094297695 12:28926642-28926664 CATTCCCAGGTGATACGGTTTGG + Intergenic
1095152909 12:38817064-38817086 TATTCCCTGGAGAAAGGGAAGGG - Intronic
1095962373 12:47843842-47843864 CCTCCCCAGGGGAGAGGGTCTGG - Exonic
1096216059 12:49797869-49797891 CATCCCCAGCAGAAAGGGGTTGG + Intronic
1096876379 12:54633309-54633331 CATTCCCAGGAGATAAGCTTTGG - Intronic
1098874040 12:75848338-75848360 CTTTTCCAGGGGACAGGGTCTGG - Intergenic
1099273860 12:80550389-80550411 CGTTTCCAAGATAAAGGGTCTGG - Intronic
1099610126 12:84857516-84857538 CACCCCCAGGAGCTAGGGTCTGG + Intergenic
1100965815 12:100011556-100011578 GATACCCAGGAAACAGGGTCTGG + Intergenic
1107619355 13:42209966-42209988 GATTGCCAGGAGTAAGGGTAAGG - Intronic
1110689953 13:78421289-78421311 CCTTCCCAGGAGAAAGATGCCGG + Intergenic
1111467999 13:88643047-88643069 GATTCCTAGGAGAAAGGGATGGG + Intergenic
1112801169 13:103111040-103111062 CCTTCCTAGGTGAAAGGGGCAGG - Intergenic
1114529305 14:23385914-23385936 CATTCCCAGGTGAGGGGGTCAGG - Exonic
1115190366 14:30741710-30741732 TATTGCCTGGAGAAAGGTTCTGG + Intergenic
1115979445 14:39033658-39033680 AATGCCAGGGAGAAAGGGTCTGG - Intronic
1116227614 14:42171747-42171769 GATACCCAGGAAACAGGGTCTGG + Intergenic
1116605077 14:46981775-46981797 CATTCACAGTAGAGAGGGGCTGG + Intronic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1117028587 14:51646929-51646951 CCTTCCCAAGAGCAAGGGGCAGG + Intronic
1117424292 14:55579778-55579800 GATCCCCTGGAGAAAGGGACGGG + Intronic
1118747588 14:68785390-68785412 CATTCTCAGGAGGAAGGCTATGG - Intergenic
1119638234 14:76293894-76293916 ATTTCTCAGGAGAAAGGGCCAGG + Intergenic
1120450845 14:84665444-84665466 CATCCCCAGGAGAAAGGGGAGGG - Intergenic
1121231021 14:92358537-92358559 GATTCCCAGGAGGAGGTGTCTGG - Intronic
1121813698 14:96913213-96913235 CACACCCAGGAGAAAGGGAAAGG - Intronic
1122024009 14:98861391-98861413 CATTCCTAGGAGAAAGGCTTAGG + Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1124257294 15:28154705-28154727 CATTCTCAGTAGAGAGGGTAGGG - Intronic
1124414443 15:29463310-29463332 CAGTCCCTGGAGAAAGTATCAGG + Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1126901387 15:53318231-53318253 CATTCCCAGGCTAAAGGCTGGGG + Intergenic
1128487535 15:68109643-68109665 CATTCCCAGGAAAAAGACTGAGG + Intronic
1128522481 15:68384990-68385012 TATGCCCTGGAGAAAGGGTATGG - Intronic
1129889979 15:79065537-79065559 CATTGGCAGGAGGAAGGGGCAGG + Intronic
1130661445 15:85834179-85834201 CATTTCCTGGAGAAAGGTTATGG + Intergenic
1130729405 15:86474948-86474970 AATACCCAGGCAAAAGGGTCTGG + Intronic
1132464448 16:71322-71344 CATTCTCAGGAAAAGGGGCCCGG + Intronic
1133217134 16:4299386-4299408 CAGTTCCAGGAGAAAGTCTCTGG - Intergenic
1133968971 16:10553485-10553507 CATGCCCAGGAGAAGGTGCCGGG - Intronic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134487005 16:14666597-14666619 TATTTCCAGAAGAAAGGGACAGG + Intronic
1135804836 16:25533434-25533456 CATTCCCAGGAAAAATGGACAGG + Intergenic
1136088133 16:27900123-27900145 CATTCCCAGGAAACAGTGTCTGG - Intronic
1137744850 16:50812983-50813005 CATGCCAAGGAGAAAGGGACTGG - Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1140872899 16:79123065-79123087 CCTTCCAAGGGGAAAAGGTCTGG + Intronic
1141122800 16:81374524-81374546 CATTAACAGGAAAAAGGGACAGG - Intronic
1141879575 16:86848831-86848853 CATTCCTAGGAGAAGGGCACTGG + Intergenic
1142045681 16:87923658-87923680 AATTCCCAAGGCAAAGGGTCTGG - Intronic
1143386546 17:6534458-6534480 CATTGCCAGGCCAAAGGGTTGGG + Intronic
1145767938 17:27472163-27472185 CAGTCAGGGGAGAAAGGGTCAGG - Intronic
1146623992 17:34422261-34422283 CATTCCCATCAAAAAGGGTGTGG + Intergenic
1148242911 17:46012042-46012064 CAATCCCAGGAACAAGGGCCCGG - Intronic
1149574500 17:57702158-57702180 CATACCCAGGAGAGAGCCTCTGG - Intergenic
1152211600 17:79005339-79005361 CTTTCCCAGGAGAAGGGCTCAGG + Intronic
1152408645 17:80111151-80111173 GATCCCCAGGAGAAAGGCTCAGG + Intergenic
1155069878 18:22305609-22305631 AATGCCCAGGAGGAGGGGTCAGG - Intergenic
1156444422 18:37224659-37224681 CTATCCCAAGAGAAAGGATCTGG + Exonic
1156945977 18:42832071-42832093 CATTCACAGGAGAAAGCTTCAGG + Intronic
1157390257 18:47296260-47296282 CTTTCCCAGAAGAAAAGGTTGGG + Intergenic
1157765017 18:50289655-50289677 CCTTCCAAGGAGAAAGAGACAGG + Intergenic
1158503884 18:58028783-58028805 CATTCCCTGAAGAAAGGTACTGG - Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1161622948 19:5308926-5308948 CATTACCAGGAGCACGGGTGGGG + Intronic
1162038886 19:7957563-7957585 TGAACCCAGGAGAAAGGGTCCGG - Intergenic
1164112827 19:22185210-22185232 GATACCCAGGAAAAAGGGTCTGG + Intronic
1164716204 19:30392166-30392188 AATTCCCAAGGGAAAGGGTGTGG - Intronic
1164923057 19:32103996-32104018 CATTCCCAAGAAGAAGGGTTTGG - Intergenic
1167402574 19:49282676-49282698 CCTTCCCAGGTGAAAAGGTTAGG - Intergenic
1167618527 19:50548979-50549001 CATGCCCAGAACAAAGGGACAGG + Intronic
1168102573 19:54148837-54148859 CATTCCCAGCAGCAAGGGCGGGG - Intronic
925868002 2:8245822-8245844 AATTCCCAGGAGAGAGATTCTGG + Intergenic
927181594 2:20450405-20450427 CATTCCCAGGACAAAGGTGGAGG + Intergenic
928739805 2:34338149-34338171 GATTTATAGGAGAAAGGGTCTGG - Intergenic
929777278 2:44937270-44937292 CATTCCCAAGAGAGAGGGGCTGG - Intergenic
929968361 2:46552351-46552373 CCTTCCCAGAAGAGAGGGACAGG + Intronic
931582982 2:63797054-63797076 CATGTCCAGGAGATAGGGCCTGG - Intronic
932615062 2:73226496-73226518 CATTCCCAGGAGACAGCCTCAGG - Exonic
933627453 2:84617833-84617855 TATGCCCACGAGAAAGGGTGGGG - Intronic
933880506 2:86664526-86664548 GATACCCAGGAAACAGGGTCTGG + Intronic
934947506 2:98552384-98552406 CATTTACAGAAGAAGGGGTCAGG - Intronic
937974933 2:127576853-127576875 GATTCCCAGCAGAGAGGGGCTGG - Intronic
938069956 2:128303081-128303103 CATTCCCAGGAGGAAATGCCAGG + Intronic
939120182 2:138107101-138107123 AATTTCCAGGATAAAGGGTAAGG + Intergenic
939618359 2:144386580-144386602 CTTTCCAAGGAGAAAGAGTTAGG + Intergenic
940194652 2:151080303-151080325 CATTCACATGAGAACAGGTCAGG + Intergenic
941573049 2:167195619-167195641 GATTCCCATGATAAACGGTCTGG - Intronic
943132195 2:183867809-183867831 GATTCCAAGAAGAAAGAGTCAGG + Intergenic
944954542 2:204793255-204793277 CATTCCCATGATAAAGGGACTGG - Intronic
945183508 2:207115913-207115935 CCTTCACAGCAGAAAGGATCTGG - Intronic
945997038 2:216446463-216446485 CATTCCCAAGAGGAAGTGTCAGG - Intronic
946355247 2:219180441-219180463 CCTTGGCAGGAGAAAGTGTCAGG - Intronic
947205092 2:227653642-227653664 CATTGCCAGGAAAAACGGGCAGG - Intergenic
948407519 2:237733479-237733501 CATTCCTGGAAGAAAGGGTCAGG - Intronic
1169961522 20:11165442-11165464 GATTCTCTGGAGAAAGAGTCTGG - Intergenic
1170422722 20:16208577-16208599 AATTCCCAGGAGGAAGAGTGTGG + Intergenic
1171029657 20:21665929-21665951 AATACACAGCAGAAAGGGTCGGG - Intergenic
1175128692 20:56772817-56772839 CATTCCGAGGAGAAAGGGCCAGG - Intergenic
1176342843 21:5714288-5714310 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1176475097 21:7146439-7146461 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1176501984 21:7610168-7610190 CAGCCCCAGGAGAAAAGGGCTGG - Intergenic
1176537164 21:8112357-8112379 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1177763864 21:25434298-25434320 GATACCCAGGAAACAGGGTCTGG + Intergenic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1182050540 22:27309735-27309757 CATTCCTGGAAGGAAGGGTCTGG - Intergenic
1183312137 22:37116006-37116028 CATTCATAGGTTAAAGGGTCAGG + Intergenic
1184402623 22:44282588-44282610 CATTCGCAGGAGAAAGAGCTGGG + Intronic
1184886676 22:47350787-47350809 GATACCCAGGCAAAAGGGTCTGG - Intergenic
949155107 3:817341-817363 GATTCTCAGGAAACAGGGTCTGG + Intergenic
949242053 3:1885227-1885249 GATTCCCAGGAAGAAGGGACTGG - Intergenic
950497938 3:13345418-13345440 ACTTCCCAGGAGAATGGGGCTGG + Intronic
950640947 3:14347573-14347595 CATCCCCAGGAGAAGGAGTGTGG + Intergenic
952312095 3:32199587-32199609 TATTCCCAGGAGACAGGGAAGGG + Intergenic
953364723 3:42334061-42334083 CATTCCCAGAAGACAGTGACAGG - Intergenic
953918289 3:46934720-46934742 TATTCCCAAGAAACAGGGTCAGG + Intronic
954109224 3:48424926-48424948 CATGCCCAGGAAGCAGGGTCTGG + Intronic
954198924 3:49012824-49012846 CCTTCCCAGGAAACAGGGTCTGG - Exonic
955231310 3:57101284-57101306 CACTCCCAAGAGAGAGGCTCCGG - Exonic
956888315 3:73583453-73583475 TGTTCCCAGGTGAAAAGGTCTGG - Intronic
959368020 3:105488169-105488191 CATTCACAGCAGAAAGGGAAGGG - Intronic
961319967 3:126065989-126066011 CAGTACCAGGAGGCAGGGTCGGG - Intronic
961435074 3:126911358-126911380 CCTTCCCAGGAGATGGAGTCTGG + Intronic
962216680 3:133528612-133528634 CTCTCCCAGGAGAAAGAATCAGG + Intergenic
963230194 3:142901635-142901657 CATTTCCAAGAGGAAGGGTATGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965665280 3:171087349-171087371 CATTCCCAGGAGATGGACTCTGG - Exonic
966906128 3:184527097-184527119 CATCCCCAGAAGGAAAGGTCAGG - Intronic
969105364 4:4803416-4803438 CAATCCCAGGGGACAGAGTCTGG + Intergenic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
973220443 4:47720484-47720506 CATTCCCAGGAAAAAGAGTGGGG + Intronic
974814052 4:66982561-66982583 GATACCCAGGAAACAGGGTCTGG + Intergenic
975394863 4:73863158-73863180 CCCTCCCAAGAAAAAGGGTCAGG + Intergenic
977182520 4:93894479-93894501 CATTCCCAAGAGAGATGCTCAGG - Intergenic
978269800 4:106875393-106875415 GATACCCAGGAAATAGGGTCTGG - Intergenic
981305402 4:143241783-143241805 CAGTACCAGGAGATAGGGTAAGG + Intergenic
982596358 4:157389795-157389817 CATTCCCAGGAGGCAGAGTTAGG + Intergenic
983524213 4:168744028-168744050 CCTTCCCTGGAAAAGGGGTCGGG + Intronic
985889582 5:2705292-2705314 CACTTCCAGGAGAGAGGGGCAGG + Intergenic
987509151 5:18813972-18813994 CATTCCCAGGAAAATGGTTAAGG + Intergenic
988938331 5:36113983-36114005 CATGGCCAGCACAAAGGGTCAGG - Intronic
989192977 5:38689362-38689384 CATATCGAGGAGAAATGGTCTGG - Intergenic
990440644 5:55841691-55841713 CATTCCCATGTGAGAGGATCCGG + Intergenic
991449804 5:66739995-66740017 CATTCCCAAGACAAAGGATATGG - Intronic
991660353 5:68944871-68944893 CCTACACAGGAGAAAGGGCCGGG + Intergenic
995587516 5:113663506-113663528 CATTCCCAGTACCAAGGGTGTGG - Intergenic
996731870 5:126724742-126724764 CATTCTCAGGAGAATGGACCAGG - Intergenic
997360592 5:133292255-133292277 CAGCCCCAGGAGGAAGGGTTGGG - Intronic
998796513 5:145825309-145825331 CATGCCCATGACAGAGGGTCAGG + Intronic
999156955 5:149464896-149464918 GATTCCCAGGGGTGAGGGTCTGG - Intergenic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003345084 6:5259742-5259764 TATTCCCATGAGAAAGAATCTGG - Intronic
1005111476 6:22286386-22286408 CTTTCCCAGGGGAAATGCTCTGG - Intergenic
1005955274 6:30659329-30659351 CAGTCCCAGGAACAAGGGACTGG + Intronic
1007064948 6:38980572-38980594 AATTCCTGGGAGAAGGGGTCTGG + Intronic
1007308587 6:40926742-40926764 CATTCCAAAGAGCCAGGGTCAGG - Intergenic
1007828699 6:44621516-44621538 CCTTCCCAGGTGGAAGGGGCAGG + Intergenic
1008401886 6:51072690-51072712 CAGACTCAGGAGAAAGGGTAAGG - Intergenic
1008759400 6:54835467-54835489 CATTGTCAGGAGAAAGAGCCAGG - Intergenic
1012299147 6:97563219-97563241 CATTCCTAGGGGAAAGGGGGTGG - Intergenic
1013435177 6:110097580-110097602 CCTTCCCAGGAGAATGAGACAGG - Intergenic
1013920053 6:115393886-115393908 GATACCCAGGAAACAGGGTCTGG - Intergenic
1013939462 6:115644478-115644500 CATTACCTGGAGATAGAGTCAGG - Intergenic
1017701494 6:157077448-157077470 GATGCCCAGGAGAGAGGGTGAGG - Intronic
1017939847 6:159042195-159042217 CCTTCTCATGAGAAAGGGCCAGG + Exonic
1018174238 6:161165004-161165026 CCTGCCCAGGAGGAAGGGTATGG - Intronic
1019044357 6:169131805-169131827 AATGTCCAGGAGATAGGGTCTGG - Intergenic
1019168956 6:170117807-170117829 CTTTCTCTGGAGAAGGGGTCAGG - Intergenic
1019550347 7:1599278-1599300 CTTGCACAGGAGAAAGGGTGGGG + Intergenic
1020287421 7:6695233-6695255 CCTTCCTAGGAGAAAGGTTGTGG - Intronic
1020485321 7:8714171-8714193 CTCTCCCAGGAGAAAGGGAAGGG - Intronic
1021550411 7:21865628-21865650 CATTCCCACGAGAAAGAGCTGGG + Intronic
1022820912 7:33960160-33960182 CAGTCCCAAGAGAAAGAATCAGG - Intronic
1023625716 7:42113364-42113386 CATGCCCAAGAGAAAGGCTGAGG + Intronic
1023835682 7:44065955-44065977 CAATCACAGGAGAAAGGGGTTGG - Intronic
1025158730 7:56634813-56634835 CATACCCATGAGAAAGAGGCGGG + Intergenic
1027836916 7:83255579-83255601 CAATCCCAGGAGAGAGCATCTGG - Intergenic
1027881883 7:83849867-83849889 AAATCCCAGGAAAAGGGGTCTGG + Intergenic
1028746773 7:94336343-94336365 AAGTCCCAGAAGTAAGGGTCAGG + Intergenic
1029378899 7:100199758-100199780 CATTTCCAGAAAAAAGGGCCAGG + Intronic
1032945612 7:136848851-136848873 CATTCCCAGTTCAAAGGGTTGGG - Intergenic
1034533660 7:151713247-151713269 CATTCCCAGAAGACAGTGTGAGG - Intronic
1035205011 7:157289542-157289564 CATTTCCAGGAGAACCAGTCTGG - Intergenic
1036727911 8:11236602-11236624 CATTCCCTGGGGTAAGAGTCAGG + Intergenic
1038400010 8:27277406-27277428 CATTCCCAGAAGACAGGGAGAGG - Intergenic
1040410151 8:47145693-47145715 CTCTCCTAGGAGAAAGCGTCTGG + Intergenic
1041042377 8:53860620-53860642 AATTCCCAGGAGAGAGGATCTGG + Intronic
1042642426 8:70951121-70951143 CAGGCTCAGGAGAAAGGGCCTGG + Intergenic
1045071597 8:98511667-98511689 CATTTCCAGGAGAAAGTGGATGG - Intronic
1046563957 8:115874615-115874637 CCTGCCCAAGAGAAAAGGTCTGG - Intergenic
1046723430 8:117648403-117648425 CATTGCCTCCAGAAAGGGTCAGG - Intergenic
1047599354 8:126410734-126410756 CATTCCCAGAAGAACAGCTCTGG - Intergenic
1048201080 8:132374251-132374273 CATCACCATGAGAAAGGGGCTGG - Intronic
1048402396 8:134083910-134083932 AATTCCCAGCTGAAGGGGTCTGG + Intergenic
1048987760 8:139744377-139744399 CCTTCCCAGCAGTCAGGGTCTGG - Intronic
1049536116 8:143183292-143183314 CCTTCCAAGGAGAAATGGTGTGG + Intergenic
1049606404 8:143531297-143531319 CATCCCCAGGAGAAAAGGGAAGG + Intronic
1049616849 8:143579258-143579280 CAGTCCCTGGAGCAAGGGGCAGG + Intergenic
1050077948 9:1884319-1884341 CATGCCCAGGAGCCAGGGTGAGG + Intergenic
1050259243 9:3823852-3823874 GATTCCCTGGAGAAAGGGGCAGG - Intergenic
1050283615 9:4078348-4078370 GTTTCCCAGAAGAATGGGTCAGG - Intronic
1050297691 9:4222470-4222492 GATTCACAAAAGAAAGGGTCAGG - Intronic
1050645388 9:7713749-7713771 GATACCCAGGAAAAAGGGTCTGG + Intergenic
1052083316 9:24233296-24233318 CCTTCCAAAGAGTAAGGGTCTGG - Intergenic
1052697167 9:31892443-31892465 GATTCCCAGGACAAAGGCTGTGG + Intergenic
1052887811 9:33666868-33666890 GATACCCAGGAAACAGGGTCTGG + Intergenic
1056169015 9:83964744-83964766 AAATCTCAGGAGAAAGAGTCTGG + Intergenic
1057575818 9:96241612-96241634 TATTCCCAGAACAAAGGGTTTGG + Intronic
1059236530 9:112764972-112764994 TCTTCCCAGGGGAAAAGGTCAGG + Intronic
1059926397 9:119213791-119213813 CACTCCAAAGTGAAAGGGTCAGG + Intronic
1061085340 9:128394770-128394792 CATTCCCAGGAGTTGGGATCTGG - Intergenic
1061178333 9:129010295-129010317 TGTTCCCAGGGGAAAGGGACAGG - Intronic
1062448838 9:136607133-136607155 CAGGCCCGGGAGAAAGGGCCCGG - Intergenic
1203458432 Un_GL000220v1:11838-11860 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1186853937 X:13607869-13607891 GACTGCCAGGAGAAAGGGTCAGG - Intronic
1188630034 X:32344624-32344646 CTTTGCCAGGAGAAAGGGCTTGG + Intronic
1189560597 X:42187909-42187931 CATGCCCAGGGGAGAGGCTCAGG - Intergenic
1190598470 X:52067912-52067934 CATTCACAGGGGAAAGGCCCAGG + Intronic
1190610354 X:52186161-52186183 CATTCACAGGGGAAAGGCCCAGG - Intronic
1190790362 X:53694316-53694338 CATTCCCAGAAGAAATTGTAAGG - Intergenic
1196122889 X:112069431-112069453 GAGTCCCAGGACAAAAGGTCAGG + Intronic
1197160790 X:123319780-123319802 CATGACCAGCAGAAAGGTTCTGG - Intronic
1197492194 X:127131006-127131028 CATTTCTGGGAGAATGGGTCTGG - Intergenic
1199691050 X:150309201-150309223 CATTCTCAGGAGGAAGGCACAGG + Intergenic
1201219922 Y:11758687-11758709 AATTCCCAGGGGAAAGGGAATGG + Intergenic