ID: 1077021862

View in Genome Browser
Species Human (GRCh38)
Location 11:420520-420542
Sequence CGTCCAGGCGGATCTCCACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077021858_1077021862 -6 Left 1077021858 11:420503-420525 CCAGACCATCTTGATGGCGTCCA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
1077021855_1077021862 10 Left 1077021855 11:420487-420509 CCAGGCGCCGCTGCAACCAGACC 0: 1
1: 1
2: 1
3: 5
4: 111
Right 1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
1077021852_1077021862 28 Left 1077021852 11:420469-420491 CCTTGGCCTTGCGCGGCACCAGG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
1077021856_1077021862 3 Left 1077021856 11:420494-420516 CCGCTGCAACCAGACCATCTTGA 0: 1
1: 0
2: 1
3: 25
4: 307
Right 1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
1077021854_1077021862 22 Left 1077021854 11:420475-420497 CCTTGCGCGGCACCAGGCGCCGC 0: 1
1: 0
2: 1
3: 3
4: 111
Right 1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG 0: 1
1: 0
2: 0
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077021862 Original CRISPR CGTCCAGGCGGATCTCCACG AGG Exonic
900031666 1:377247-377269 CCTCCACGCGGAACCCCACGCGG + Intergenic
900052214 1:605439-605461 CCTCCACGCGGAACCCCACGCGG + Intergenic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
922554907 1:226525462-226525484 CGTCCAAACGGATCTGGACGTGG + Intergenic
1069798917 10:71070359-71070381 TGTCCAGGTGGCTCTCCAGGCGG + Intergenic
1076922111 10:133459536-133459558 CATCCAGGGAGACCTCCACGCGG - Intergenic
1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG + Exonic
1084859223 11:72007278-72007300 AGTCCAGGCTGCTCTCCAGGGGG + Exonic
1113214302 13:108020220-108020242 CACCCAGGCTGATCTCCAGGCGG + Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1132883766 16:2173518-2173540 CGTCCCGCCGGAACTCCATGAGG - Exonic
1133261967 16:4556735-4556757 TGTCGAGGCGGCTCACCACGTGG - Exonic
1141945007 16:87303776-87303798 CATGCAGGCGGGTCTCCACCTGG + Intronic
1152947987 17:83208466-83208488 CCTCCACGCGGAACCCCACGCGG - Intergenic
1161560520 19:4970042-4970064 CTCCCAGGGGGATGTCCACGGGG - Intronic
1161978724 19:7619786-7619808 CGCCCAGCTGGATCTCCTCGGGG + Exonic
1162385378 19:10357799-10357821 CGTCAAAGCAGATCTCCAGGAGG + Exonic
926217197 2:10912855-10912877 CGTCCAGGATGAGCTGCACGCGG - Exonic
947727645 2:232409935-232409957 CGTCCTGCCGGACCTCCACCTGG + Exonic
1169145601 20:3250227-3250249 CCTCCAGGCGGCGCTCCAGGTGG - Exonic
1174217037 20:48923657-48923679 AGTCCAGGCAGATTTCAACGTGG - Intronic
1179105090 21:38392407-38392429 GGTCCAGGCTGATCTCCTGGGGG + Exonic
986052078 5:4099514-4099536 CGACCATGCGGACCACCACGGGG + Intergenic
989165245 5:38427205-38427227 AGTCAAAGCGGAACTCCACGTGG - Exonic
1002742154 5:181441621-181441643 CCTCCACGCGGAACCCCACGCGG - Intergenic
1006904903 6:37526656-37526678 CATCCATGCTGAGCTCCACGAGG + Intergenic
1007406462 6:41638607-41638629 CTTCCAGCCGGATCCCCGCGCGG - Exonic
1015369040 6:132429739-132429761 CGACCAGTCAGATCTCCACACGG + Intergenic
1017246591 6:152233780-152233802 CGTCCAGGAGAAGCTCCACCAGG - Exonic
1019159187 6:170057935-170057957 CCTCCAAGCTGAGCTCCACGTGG + Intergenic
1019247289 6:170717359-170717381 CCTCCACGCGGAACCCCACGCGG - Intergenic
1019435329 7:1019667-1019689 CCTCCAGGCCCATCACCACGAGG + Intronic
1020105739 7:5421452-5421474 CGGCCAGGCGGAGCTGCGCGAGG + Exonic
1035500847 8:90576-90598 CCTCCACGCGGAACCCCACGCGG + Intergenic
1045575348 8:103414784-103414806 CGGCGAAGCGGATCTTCACGAGG + Exonic
1049801626 8:144520397-144520419 GGTCCACGCGCACCTCCACGGGG - Exonic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1062651902 9:137582121-137582143 CGTGCAGGCCGCGCTCCACGGGG + Exonic
1203608063 Un_KI270748v1:72836-72858 CCTCCACGCGGAACCCCACGCGG - Intergenic
1187685533 X:21812119-21812141 CGTCCATGAGGATCTCAACTGGG + Intergenic