ID: 1077021977

View in Genome Browser
Species Human (GRCh38)
Location 11:420987-421009
Sequence GTGCAGATGGCCATCATCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077021977_1077021983 8 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021983 11:421018-421040 CCATCATGCAGCCGCTGGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1077021977_1077021984 16 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021984 11:421026-421048 CAGCCGCTGGCGTGGCACTGCGG 0: 1
1: 0
2: 0
3: 13
4: 214
1077021977_1077021981 3 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021981 11:421013-421035 GAGGTCCATCATGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 98
1077021977_1077021986 18 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021986 11:421028-421050 GCCGCTGGCGTGGCACTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 380
1077021977_1077021988 27 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021988 11:421037-421059 GTGGCACTGCGGGGCCAGACAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1077021977_1077021989 30 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021989 11:421040-421062 GCACTGCGGGGCCAGACAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 314
1077021977_1077021985 17 Left 1077021977 11:420987-421009 CCCATGATGATGGCCATCTGCAC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1077021985 11:421027-421049 AGCCGCTGGCGTGGCACTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077021977 Original CRISPR GTGCAGATGGCCATCATCAT GGG (reversed) Exonic
900851316 1:5145142-5145164 GCACAGATGGACATCAACATGGG - Intergenic
903579650 1:24361223-24361245 CTGCACATGGCAATCATGATGGG + Intronic
908822302 1:68101093-68101115 CTGCAGGTGGCCATCCTGATAGG - Intronic
915020491 1:152774857-152774879 GTGAAGAGAGCCATCTTCATAGG + Intronic
915274674 1:154779980-154780002 GTCCAGATGGCCTTCAGCGTTGG - Intronic
920353862 1:205356125-205356147 ATGCAGATGGACATCAAGATGGG - Intronic
922794458 1:228333225-228333247 GGGCAGCTGGCCCTCATCAGTGG - Exonic
924505131 1:244675575-244675597 GATCAGTTGGCCATCATTATAGG + Intronic
924829170 1:247574225-247574247 GTTCTCATAGCCATCATCATTGG - Exonic
1067427901 10:46223314-46223336 ATGGAGATGGCCATCCACATTGG + Intergenic
1067741613 10:48899814-48899836 GTGCAGCTGGGCAGCATCATGGG - Intronic
1074566353 10:114581804-114581826 GAGCACATGGCCCTCATCACTGG - Intronic
1075607669 10:123825612-123825634 GGACAGATGGGCATCATCAGTGG - Intronic
1077021977 11:420987-421009 GTGCAGATGGCCATCATCATGGG - Exonic
1078357920 11:10646650-10646672 GTGCAGATGCCACTCATCAGTGG + Intronic
1081993105 11:47348015-47348037 GGGCAGATGCCCAGCCTCATGGG - Intronic
1089476011 11:118762586-118762608 CTGCTGATGCCCAGCATCATGGG + Intronic
1090397906 11:126431499-126431521 GTGCCGATGGCCGTCATCATTGG - Exonic
1090420384 11:126571317-126571339 GGGCACTTGGCCATCAACATGGG + Intronic
1091760232 12:3082493-3082515 GTGGAGATAGCCATCAACCTTGG + Intronic
1092893064 12:12987265-12987287 CTGCAGAGAGCCATCTTCATTGG + Exonic
1093745586 12:22737229-22737251 GTCCAAATGGCCATTATGATTGG - Intergenic
1102896579 12:116603205-116603227 CTGCTCCTGGCCATCATCATTGG + Intergenic
1102994650 12:117339276-117339298 GGGAAGATTGACATCATCATAGG - Intronic
1107589821 13:41891299-41891321 GTTCAGATGGCCCTTATCTTGGG - Intronic
1108737888 13:53304877-53304899 TTGCAGATGGACATCAGCAGTGG - Intergenic
1111189617 13:84790572-84790594 GTGGAGATGCCCAAGATCATGGG + Intergenic
1112975685 13:105314662-105314684 GAGGAGATGGCCATCTTCACAGG + Intergenic
1118292925 14:64541981-64542003 GTGCAGGCGGCCATCCTCATCGG + Exonic
1119601164 14:75978323-75978345 GAGCAGAGAGCCATCATCAGGGG - Intronic
1120320161 14:82949462-82949484 TTGCTCATGGCCATCTTCATTGG - Intergenic
1122570056 14:102691260-102691282 GTGCACATGGCCATAAAGATGGG + Intronic
1124033465 15:26032199-26032221 GTGCGGATGTCCATGACCATAGG - Intergenic
1124198852 15:27659119-27659141 CTGCAGATGGCCTTCATCTGTGG - Intergenic
1124198992 15:27660402-27660424 CTGCAGATGGCCTTCATCTGTGG - Intergenic
1125462395 15:39919866-39919888 GTGCAGGTCGTCATCTTCATAGG - Exonic
1127052981 15:55104018-55104040 GTGCACATGGGCACCATAATGGG - Intergenic
1127312434 15:57764674-57764696 GTGCAGATCGAACTCATCATAGG + Intronic
1127569057 15:60223114-60223136 GAACACATGGCCTTCATCATTGG - Intergenic
1131706600 15:95002722-95002744 GTGCAGATGGCACTGATCCTGGG + Intergenic
1132481622 16:169120-169142 GGGCAGCTGGCCTTCCTCATAGG + Intergenic
1135674310 16:24402309-24402331 GTGCAGATGGTCATATCCATGGG + Intergenic
1136990532 16:35148838-35148860 GTGCTCAGGGCCATCATCATGGG - Intergenic
1138580240 16:57936218-57936240 GTGCAGATAGTCATCCTCAGAGG - Intronic
1140250630 16:73291296-73291318 GGGCCCATGGCCATCATCAAAGG + Intergenic
1142225223 16:88873868-88873890 GGGCAGATGGCATTCATCTTTGG + Intergenic
1142327180 16:89423290-89423312 GGGCAGATGCCCATCGTCAGTGG - Intronic
1143447625 17:7018560-7018582 GTCCAGATGGCCCTCTTCCTGGG - Intergenic
1144269061 17:13600654-13600676 CTGCCGCAGGCCATCATCATCGG - Exonic
1144339812 17:14301927-14301949 CTGCCGCAGGCCATCATCATCGG + Exonic
1146253631 17:31374492-31374514 GTGCAAATGGCTTTCATCACTGG - Exonic
1147860839 17:43522090-43522112 GTGCAGAAGGCCATCTGCAGTGG + Exonic
1149117747 17:53118102-53118124 GAGCTGATGGTCTTCATCATGGG - Intergenic
1150160968 17:62897626-62897648 GTTCAGATGGCCATCTTTATTGG - Intergenic
1151553751 17:74836418-74836440 GTGCAGAAGGCCACCAGCACAGG - Exonic
1152068634 17:78124600-78124622 CTGCTGGTGGCCTTCATCATGGG - Exonic
1156829277 18:41470846-41470868 GTGCAGATGGCCGTATTCAGAGG + Intergenic
1167451761 19:49574673-49574695 TTGCAGATGGCTATCTTCAGTGG + Intronic
1168276055 19:55279442-55279464 CTGCAGATGGCCATCACCGCGGG - Exonic
926310211 2:11669606-11669628 CTGCCCATGGCCGTCATCATGGG - Exonic
928451991 2:31385773-31385795 GGGCAGGTGGCCATGGTCATAGG + Intronic
937067066 2:119025512-119025534 GTTCCGATGTCCATCAACATTGG - Intergenic
940019147 2:149138838-149138860 CTGCACATGGCCATCAGCAGAGG + Intronic
942155055 2:173119740-173119762 GGGCAGCTGACCTTCATCATAGG - Intronic
1171163303 20:22948321-22948343 ATATAGATAGCCATCATCATGGG + Intergenic
1175045425 20:56100466-56100488 GTGCAGATGGGAATCAGGATGGG + Intergenic
1175727958 20:61332347-61332369 GTGCAGTGGGCCAGCATCATGGG - Intronic
1177692567 21:24530694-24530716 GTCCAGATGCACATCATAATCGG + Intergenic
1181639268 22:24188239-24188261 GTGCTGTTGGGCATCATCTTTGG + Exonic
1181751143 22:24990031-24990053 ATTCAGAAGCCCATCATCATTGG + Intronic
951563266 3:23988806-23988828 GTACTGATGGCCATCATCAGCGG + Intergenic
953931698 3:47009014-47009036 CTGCGGATGGCCACCTTCATGGG - Exonic
955700785 3:61680151-61680173 GGGCAGATGGCCATCCTATTGGG - Intronic
958173990 3:89972085-89972107 GTGCACATGGACATAAACATGGG + Intergenic
960963937 3:123091603-123091625 GTGCAGATGTCAATCCTGATGGG - Intronic
961743249 3:129046848-129046870 GAGCAGATGGCCTTCGTCGTCGG + Intergenic
963105376 3:141642775-141642797 GTGCAGATGGCCAACCACAGTGG - Intergenic
963559154 3:146838922-146838944 GTGCACATGGTCATAATGATGGG + Intergenic
969732756 4:8966419-8966441 GTGCACATGGCCAAAATCAGAGG - Intergenic
969830905 4:9795860-9795882 GAGCAGAGGGCCATGGTCATGGG + Intronic
972573290 4:40329803-40329825 GTGCAGATGGCAGTCAGCAATGG + Intergenic
983567354 4:169167536-169167558 ATCCAGATGTCCATCAACATGGG + Intronic
985616070 5:922746-922768 GTGCAGGTGGCCCTCATAGTTGG + Intergenic
986106880 5:4668116-4668138 GGGCCCATGGCCTTCATCATGGG + Intergenic
986350856 5:6878248-6878270 GTGCAGGTACTCATCATCATGGG + Intergenic
996177644 5:120378947-120378969 GTGAAGCTGCCCAACATCATGGG + Intergenic
998730691 5:145072714-145072736 GTGCACATGACCATCACTATGGG + Intergenic
1000400883 5:160825846-160825868 GTGCACATGGACATAAACATGGG - Intronic
1000853488 5:166369562-166369584 GTGCAGATGGCTATCACTAAAGG + Intergenic
1006122711 6:31816879-31816901 GTGCAGGCGGCCATCCTGATGGG + Exonic
1006124574 6:31829073-31829095 GTGCAGGCGGCCATCCTGATGGG + Exonic
1010454927 6:76043872-76043894 TTGCTGCTGGCCATCATCAGGGG - Intronic
1012098261 6:94993814-94993836 TGGCAGATGGACATCACCATGGG + Intergenic
1013490881 6:110645592-110645614 GTTCAGATGCACATCATCCTCGG + Intronic
1014055407 6:117008816-117008838 GTGCAAATGGCCATCATCCTGGG - Intergenic
1015688402 6:135892756-135892778 GTTCAGCTAGCCATCTTCATAGG + Intronic
1027073530 7:75174794-75174816 ATACAGATGGAAATCATCATAGG - Intergenic
1029490053 7:100866105-100866127 CTGCAGATGGCAACCATCTTGGG + Exonic
1029529773 7:101117571-101117593 GTGCAGATGGAATTCACCATGGG - Intergenic
1030223148 7:107119306-107119328 GTGAACATGGCCAGCTTCATGGG + Intronic
1030333697 7:108300306-108300328 TTGAAGAAGGCCATCACCATTGG + Intronic
1030585329 7:111411689-111411711 GTGCAGGTGCCCATCTTCAAGGG + Intronic
1035663872 8:1365962-1365984 GCTCAGATGTCCATCATCCTTGG + Intergenic
1038320119 8:26518085-26518107 GAGCAGATGGCTTTAATCATTGG - Intronic
1041861953 8:62524501-62524523 CTGCTGATGGCAATCAGCATAGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043761038 8:84068634-84068656 GAGCTGGAGGCCATCATCATAGG - Intergenic
1055583351 9:77731353-77731375 GTGCAGATGGGCAGCACCCTGGG - Intronic
1056834212 9:89941650-89941672 GTGCAGTTTGCCATGATCCTGGG + Intergenic
1191648818 X:63513518-63513540 GTGAAGATGTCCCTCATCATTGG - Intergenic
1195714675 X:107807182-107807204 GTGCAGATGGACAGAATCAGAGG - Intergenic
1199015763 X:142813256-142813278 GTGCACATGGACATAAACATGGG + Intergenic
1199938927 X:152605336-152605358 GTGCATATGGACATAAACATGGG - Intergenic
1201542681 Y:15125033-15125055 GTGCAAATAGCAATCAGCATTGG - Intergenic
1201766322 Y:17576537-17576559 CTGCACCTGGCCACCATCATTGG - Intergenic
1201835230 Y:18329452-18329474 CTGCACCTGGCCACCATCATTGG + Intergenic