ID: 1077024313

View in Genome Browser
Species Human (GRCh38)
Location 11:432545-432567
Sequence CTGTAGGCACAGGGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 493}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077024313_1077024323 1 Left 1077024313 11:432545-432567 CCAGCCTCCCCCTGTGCCTACAG 0: 1
1: 0
2: 4
3: 35
4: 493
Right 1077024323 11:432569-432591 CATGGCTCCTGGACACCCCAGGG 0: 1
1: 0
2: 1
3: 33
4: 255
1077024313_1077024325 12 Left 1077024313 11:432545-432567 CCAGCCTCCCCCTGTGCCTACAG 0: 1
1: 0
2: 4
3: 35
4: 493
Right 1077024325 11:432580-432602 GACACCCCAGGGCACGTCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1077024313_1077024322 0 Left 1077024313 11:432545-432567 CCAGCCTCCCCCTGTGCCTACAG 0: 1
1: 0
2: 4
3: 35
4: 493
Right 1077024322 11:432568-432590 ACATGGCTCCTGGACACCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 203
1077024313_1077024320 -10 Left 1077024313 11:432545-432567 CCAGCCTCCCCCTGTGCCTACAG 0: 1
1: 0
2: 4
3: 35
4: 493
Right 1077024320 11:432558-432580 GTGCCTACAGACATGGCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077024313 Original CRISPR CTGTAGGCACAGGGGGAGGC TGG (reversed) Intronic
900395107 1:2450282-2450304 CTGGAGGCCCACGGGGAGGGAGG - Intronic
900822449 1:4899883-4899905 CTGCATGGACAGGGAGAGGCAGG + Intergenic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902657880 1:17881983-17882005 CTGCAGGCAGAGGAGGAGGGTGG + Intergenic
902686957 1:18083958-18083980 CTGAAGCTAGAGGGGGAGGCAGG + Intergenic
903420070 1:23212484-23212506 GTGTTGGCACAGAGAGAGGCTGG - Intergenic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903564084 1:24251426-24251448 GGGTAGGCACAGGGGCAGGGCGG + Intergenic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904756170 1:32770011-32770033 CTGGAGGCGGAGGCGGAGGCTGG + Exonic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905043212 1:34976986-34977008 CCGTAGGCACCGGGCCAGGCGGG + Intergenic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907388467 1:54141053-54141075 CAGTAGGCACAGGAGGATTCAGG + Intronic
909860125 1:80594340-80594362 GGGTGGGCACAGGGGGAGGTGGG + Intergenic
911527560 1:99004813-99004835 CTGGAGGAAGAGGCGGAGGCAGG + Exonic
912302205 1:108529810-108529832 AGGAAGGCATAGGGGGAGGCAGG - Intergenic
912867110 1:113267367-113267389 GTGTGGGCACAGGGAGAGTCAGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913587418 1:120289388-120289410 GAGTAGGCACAGAGCGAGGCTGG + Intergenic
913620767 1:120608981-120609003 GAGTAGGCACAGAGCGAGGCTGG - Intergenic
914193637 1:145431935-145431957 CTGTAAGCTCAGGGGGGAGCGGG - Intergenic
914376793 1:147079479-147079501 CTGTAAGCTCAGGGGGGAGCCGG + Intergenic
914474965 1:148014825-148014847 CTGTAAGCTCAGGGGGGAGCGGG - Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
914932998 1:151950915-151950937 GTGTAGGCAGAAGTGGAGGCAGG + Intergenic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
916207756 1:162331903-162331925 AGGTAGGAACAAGGGGAGGCTGG - Intronic
916619895 1:166485960-166485982 CAGTTGGCTCAGGGTGAGGCTGG - Intergenic
916744422 1:167673792-167673814 TTGTAGGCACAGGGGCTGGCTGG - Intronic
918044759 1:180935217-180935239 CGGTGGGCACAGGCCGAGGCGGG + Exonic
918168983 1:181977037-181977059 CTGTGGGGTCGGGGGGAGGCAGG + Intergenic
919843009 1:201623015-201623037 CTGTGGGCTCAGGGCCAGGCCGG - Intronic
920257725 1:204667288-204667310 ATGTTGGCACTGGGGGATGCTGG + Intronic
920263284 1:204704045-204704067 CGGTGGCCACAGGAGGAGGCTGG + Intergenic
920267728 1:204736877-204736899 CTCTAGGCACAGGAAGAGGCAGG + Intergenic
920319607 1:205109021-205109043 CTCTAGGAACAGAGGAAGGCAGG + Intronic
920400016 1:205670570-205670592 CTCCAGGCCCTGGGGGAGGCAGG - Intronic
920579798 1:207095893-207095915 CAGAAGGCAAAGGGGGAGGGAGG - Intronic
921068833 1:211642482-211642504 CCTTGGGAACAGGGGGAGGCTGG + Intergenic
921117879 1:212111668-212111690 CAGCAAGCACAGGGGCAGGCAGG - Intergenic
922362791 1:224838601-224838623 GTGGGGGCACAGGGGGAGTCAGG - Intergenic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
923966133 1:239140983-239141005 CGGAAGCCACAGGTGGAGGCAGG - Intergenic
924385844 1:243497324-243497346 CTGTAGGCACGGGTGGGGGGGGG + Intronic
924543789 1:245006421-245006443 CTGTAATCACAGGCTGAGGCAGG - Intronic
1063105132 10:2986051-2986073 CTGCAGGCACAGGGCAAGGGTGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063910170 10:10821312-10821334 CTGAAGGCACACGTGGATGCTGG + Intergenic
1067219306 10:44332422-44332444 CAGCAGGCACATGGGGAAGCTGG + Intergenic
1067234850 10:44438961-44438983 CTGTAGGCTCTGGGGGAGGGTGG + Intergenic
1069819116 10:71216890-71216912 CTGCAGGCCCTGGGGGAGGGAGG - Intronic
1069995696 10:72340903-72340925 CTGTTGGGAAAGGGAGAGGCTGG + Intronic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1071511976 10:86267750-86267772 GTGTGGGCAGAGGAGGAGGCTGG - Intronic
1072331167 10:94353402-94353424 CAGAAGGCAAAGGGGGAGCCAGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072789642 10:98308925-98308947 CCGGCGGCGCAGGGGGAGGCAGG + Intergenic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1074431571 10:113399215-113399237 CTGCAGGCACAGGGAGAATCAGG + Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074776291 10:116770524-116770546 CAGGTGGCACAGGGGGCGGCAGG + Intergenic
1075587461 10:123667991-123668013 CTGTTGTCCCAGGGGAAGGCAGG + Intronic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1075707139 10:124508104-124508126 CTGTACCCCTAGGGGGAGGCTGG + Intronic
1075737527 10:124673199-124673221 CTGTAGGTTCTGGGGGAGGTGGG - Intronic
1075777041 10:124995880-124995902 CTGCAGGAACGGGGGAAGGCAGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077219258 11:1408172-1408194 CTCTAGGAACAGGCGGAGGGAGG - Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1077326566 11:1966606-1966628 CAGCAGGCACCGGGGGAGGAGGG - Intronic
1077444783 11:2585861-2585883 CTGGAGGCAGGTGGGGAGGCAGG + Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1081643842 11:44776675-44776697 CTGTAGTCACACGGAGAGTCGGG - Intronic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083169302 11:60913417-60913439 TTCTAGGCACAGGATGAGGCAGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083592754 11:63904958-63904980 CTGTGGCCAGAGGGAGAGGCTGG - Exonic
1083719848 11:64598764-64598786 CTGTTGGCACTGGGGGCGCCAGG - Intronic
1083862555 11:65430224-65430246 CGCTAGGCACCAGGGGAGGCGGG - Intergenic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084226111 11:67715699-67715721 CTGTGGGCACTGGAGGGGGCGGG - Intergenic
1084263946 11:67995578-67995600 CTGTGGGCACTGGGGGGGGGGGG - Intronic
1084411534 11:69008893-69008915 TTGGAGTCAGAGGGGGAGGCCGG + Intronic
1084556570 11:69879472-69879494 CTGCTGGCCCAGGGGGAGGTGGG + Intergenic
1084667331 11:70583437-70583459 CTGTAGGCACAGGGCAGGACTGG - Intronic
1084809469 11:71603545-71603567 CTGTGGGCACTGGGGGGGGCGGG + Intergenic
1085527669 11:77173637-77173659 AGGGAGGCACAGGGGGAAGCTGG + Intronic
1087433470 11:98082056-98082078 CAGAAGGCAAAGGGGGAAGCAGG - Intergenic
1088926953 11:114312317-114312339 CTCCCGGCCCAGGGGGAGGCTGG - Exonic
1089759757 11:120714780-120714802 ATGTAGGGAGAGGGGGAGGTGGG + Intronic
1090751611 11:129750841-129750863 CTGGAGGCACAGGGAGCGGCTGG + Intergenic
1090902189 11:131042922-131042944 AGGAAGGAACAGGGGGAGGCTGG + Intergenic
1091079475 11:132653372-132653394 CTGGAGGCACAAGCGCAGGCAGG - Intronic
1202809547 11_KI270721v1_random:21785-21807 CAGCAGGCACCGGGGGAGGAGGG - Intergenic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1092063179 12:5567158-5567180 CTGTTGGGAGAGGGGGAGTCGGG - Intronic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1093546980 12:20360059-20360081 CAGAAGGCACAGGGGGAGTGAGG + Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095158310 12:38885910-38885932 TGGAAGGCACAAGGGGAGGCAGG - Intronic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098099706 12:67001748-67001770 CTATAGGTACAGTGGGATGCAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102032839 12:109752988-109753010 CTGCTGGCCCAGGGGTAGGCAGG - Intronic
1102481874 12:113229455-113229477 CAGCAGGGACAGGGGGACGCTGG - Intronic
1103182871 12:118929238-118929260 GTGGAGGCAAAAGGGGAGGCAGG + Intergenic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1104068659 12:125326658-125326680 CTGTCTGCACCGGGGGAGGTCGG + Exonic
1104300556 12:127560907-127560929 GTGTAAACACAGGGAGAGGCAGG + Intergenic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104608294 12:130205752-130205774 CTGTAGAGTCAGGGTGAGGCCGG + Intergenic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104747642 12:131220029-131220051 CTGTAGGCACAGGGGGTGTTTGG + Intergenic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1105634350 13:22203062-22203084 CTGAAGCCACAGGGGCAGACTGG - Intergenic
1106433297 13:29703021-29703043 CTGTCCGCAGAGGGAGAGGCTGG - Intergenic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1110859009 13:80327428-80327450 CTGTAATCCCAGGGTGAGGCAGG - Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1111937760 13:94573851-94573873 CCCTAAGCACAGTGGGAGGCTGG + Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112639789 13:101260005-101260027 CTGGGGGGACGGGGGGAGGCAGG - Intronic
1113828057 13:113272226-113272248 CTGAAGGCTCAGTGGGTGGCTGG - Intergenic
1114670791 14:24409934-24409956 CTGAAGGGCCAGGGGCAGGCTGG + Exonic
1119436962 14:74603800-74603822 CTGGAGGAACATGGAGAGGCTGG + Intronic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1122716326 14:103698847-103698869 GTGTAGGAACAGGAGGAGGGGGG + Exonic
1122849031 14:104516714-104516736 CAGGAGGCTGAGGGGGAGGCAGG + Intronic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1125407518 15:39369213-39369235 CAGAAGGCAAAGGGGGAAGCAGG + Intergenic
1125599397 15:40907103-40907125 CTGTTCACACAGGGGGGGGCGGG - Intergenic
1125758480 15:42081757-42081779 CTGTGGGGACAGTGAGAGGCGGG - Intronic
1128229362 15:66024062-66024084 CTGCAGGCTCAGGGTGGGGCTGG + Intronic
1128267507 15:66279601-66279623 CTGTAGGCACTGGGGAACCCTGG - Intergenic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129519776 15:76178311-76178333 CTTTAGGCAGAGGGGGCTGCAGG + Intronic
1130839502 15:87684497-87684519 CTGCAGGCACAAGGGCAGTCTGG - Intergenic
1131159333 15:90094346-90094368 CTGTGGGCAGAGGAGCAGGCTGG - Intronic
1131487284 15:92831902-92831924 CTGCAGCCTCTGGGGGAGGCAGG + Intergenic
1131937652 15:97524214-97524236 CTGGAAGCAGAGGGTGAGGCTGG - Intergenic
1132251828 15:100340843-100340865 CTATAGGCAAAGGGGGTGGGAGG - Intronic
1132755494 16:1482533-1482555 CAGGTGGCACTGGGGGAGGCGGG + Intergenic
1132826360 16:1907541-1907563 CTGGAGGGTCAGGGTGAGGCGGG - Intergenic
1132838957 16:1968948-1968970 CCGCAGGCACAGAGGCAGGCAGG - Exonic
1133003018 16:2860614-2860636 CGGGAGGCAGAGAGGGAGGCTGG - Intergenic
1133172831 16:3992499-3992521 CTGTAGGCGCAGGGGGGTGGGGG - Intronic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134672823 16:16068297-16068319 GTGCAGGTACAGGGGGAAGCTGG + Exonic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135298321 16:21301925-21301947 CTGCAAGCGCAGGGGGACGCCGG - Intronic
1136169822 16:28482246-28482268 CAGTAGGCACCGGGGGGAGCGGG - Intronic
1136469851 16:30472897-30472919 CGGTAGGCAAGGGAGGAGGCAGG + Exonic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137397569 16:48126953-48126975 TTGGAGGCACATGGGAAGGCAGG + Intronic
1137672575 16:50287944-50287966 CTGGATGCACAGGAGGATGCTGG + Exonic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138341314 16:56290795-56290817 CTGCAGGCAGAGGGGTAGGGAGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138590062 16:57994967-57994989 CTGTGGCCACAGGGAGGGGCTGG - Exonic
1139403034 16:66696932-66696954 CTCTAGGCGCAGGTGGGGGCGGG - Intergenic
1139518130 16:67463932-67463954 CTGAAGCCACTGGGGGAGGTGGG + Intronic
1139659562 16:68411482-68411504 CTGCAGGCATGGGTGGAGGCTGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1141912697 16:87070837-87070859 CTGTGCACACAGGGAGAGGCTGG + Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142136251 16:88453259-88453281 CTGGAGGCACGGGGCGGGGCCGG - Intergenic
1142150235 16:88509445-88509467 CATTAGGCACACAGGGAGGCTGG + Intronic
1142262564 16:89049752-89049774 CGGGAGGCACAGTGGGCGGCCGG + Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143431939 17:6894147-6894169 CGGCAGGCCCGGGGGGAGGCTGG + Intronic
1144795653 17:17889419-17889441 CTATAGGCACAGGGGGACTTTGG + Intronic
1146186130 17:30725437-30725459 GTGAGGGCACAGGGGAAGGCGGG + Intergenic
1146362004 17:32184742-32184764 TTGGAGGCAGAGGTGGAGGCGGG - Intronic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1146911767 17:36652972-36652994 CTGTGGGTACAGGGTGTGGCTGG + Intergenic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1147056111 17:37836419-37836441 GTGGAGGCACGGTGGGAGGCAGG - Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147997111 17:44366259-44366281 CTGTTGGCCCAGGGTGAGGTAGG + Intergenic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148859127 17:50594970-50594992 CTACAGGGAAAGGGGGAGGCAGG - Intronic
1149237252 17:54607018-54607040 TTATAGGCACAGGGTGGGGCAGG - Intergenic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151280272 17:73068819-73068841 GCGTGTGCACAGGGGGAGGCTGG - Intronic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151376352 17:73691488-73691510 CTGTAGGAGAAGGGGGAAGCTGG - Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151470193 17:74313281-74313303 CTTTAGACCCAGGGGGAGGGAGG - Intronic
1151556950 17:74851506-74851528 CTGTGGGCACAAGAGGAGGCGGG + Intronic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152199377 17:78936120-78936142 CTGTCGGCACAGGGGGCTGAAGG + Intergenic
1152293384 17:79453389-79453411 CTGGCGGCAGATGGGGAGGCTGG + Intronic
1152621414 17:81366766-81366788 CTGGAGGCGCCCGGGGAGGCGGG + Intergenic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155138282 18:23018161-23018183 CGGGAGGCAGAGGGAGAGGCAGG - Intronic
1155400594 18:25434876-25434898 CTGTAAGGACAGTGGCAGGCAGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1156806259 18:41185801-41185823 CTGTAGGCAGAGGGCGAGGGAGG + Intergenic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1158523149 18:58188500-58188522 CTGAAGTGACATGGGGAGGCAGG + Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159096309 18:63906321-63906343 CAGAAGGCAAAGGGGGGGGCAGG - Intronic
1159961476 18:74558816-74558838 CTAGAGGCACAGGGAGGGGCAGG + Intronic
1160007327 18:75076897-75076919 CTGCAGGCACTGTGGGATGCGGG + Intergenic
1160922145 19:1526039-1526061 AGGTAGGCACAGGGGCATGCTGG - Intronic
1160953916 19:1680938-1680960 TTGGAGGCAGATGGGGAGGCTGG + Intergenic
1160956030 19:1692076-1692098 CCCTAGGCACAGGGGCAGCCGGG - Intergenic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161951830 19:7471750-7471772 CTGTGGGCTCAGGAGGGGGCGGG + Exonic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162341494 19:10093881-10093903 CTGTGGGCACAGGGATAGGGGGG + Intronic
1162956880 19:14103679-14103701 CATTAGCCACAGGGGGATGCTGG + Intronic
1162972704 19:14190617-14190639 GTGAGGGCACAGGGGAAGGCGGG - Intronic
1163443124 19:17331582-17331604 TTGTAGGTGCAGGGGCAGGCGGG + Intronic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1164648250 19:29874210-29874232 CTGTAGGCTCGGGGCGAGGGGGG + Intergenic
1165287226 19:34852333-34852355 CAGGAGGCAGAGGCGGAGGCGGG - Intergenic
1166079448 19:40434389-40434411 CTGCAGGGAAAGGGGGAGGGCGG + Intergenic
1166356049 19:42228088-42228110 CTGGAGGCTGAGGCGGAGGCAGG + Exonic
1167271862 19:48510593-48510615 CTGTGGGCACAGGGCTGGGCTGG + Intronic
1167626381 19:50592476-50592498 CTGTAGGCACAGGGAGGAGCAGG - Intergenic
1167924921 19:52813583-52813605 CTGGAGGGACAGGAGCAGGCAGG - Intronic
1168137042 19:54359119-54359141 CTGAAGCCACATGGGGAGGTGGG - Intronic
1168161039 19:54510010-54510032 CTGAAGCCACATGGGGAGGTGGG + Intronic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925295070 2:2770894-2770916 CTGTAGTCTCAGGCTGAGGCAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
926994240 2:18716734-18716756 CTGAAGGTGGAGGGGGAGGCTGG - Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
927885035 2:26713078-26713100 CTGTGGGCACTGGGCAAGGCAGG + Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929624929 2:43396659-43396681 CTGTGGGGACAGGGGGGTGCAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
932692071 2:73921577-73921599 GAGAAGGCACAGGAGGAGGCGGG + Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
934970839 2:98762857-98762879 TGGGAGGCACATGGGGAGGCGGG - Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935697416 2:105782214-105782236 CTGTAGGCAGGCGGGGTGGCCGG + Intronic
935702571 2:105825093-105825115 CTGGAGGGAGAGGAGGAGGCAGG - Intronic
936019636 2:108984900-108984922 CTGCATGCACAGGAGGAAGCAGG - Intronic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936308717 2:111366387-111366409 CTGCAGGCATAGGCGGAGGGAGG + Intergenic
937116894 2:119413021-119413043 CTGTAGTCCCAGGCAGAGGCAGG - Intergenic
937888559 2:126917047-126917069 CCGTAGGAACAGGCTGAGGCTGG + Intergenic
937927372 2:127177463-127177485 CTGTGGGCACAGGAGGCTGCTGG - Intergenic
938695900 2:133835318-133835340 CTGTAGGATCAGGCTGAGGCTGG - Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939115923 2:138060376-138060398 CTGTGGGCACATGGCCAGGCAGG - Intergenic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
943485129 2:188469539-188469561 CAGTAGGCAAAGGGGGAGTGAGG + Intronic
946525646 2:220516513-220516535 CTTTAAGAACATGGGGAGGCTGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948487658 2:238291099-238291121 CTGTTGGCACTGTGGGAGGCAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1169210794 20:3765312-3765334 TGGTTGGCACAGGAGGAGGCTGG - Intronic
1169681063 20:8214429-8214451 CAGAAGGCAAAGGGGGAGGAGGG - Intronic
1170085291 20:12524675-12524697 CAGAAGGCAAAGGGGGAAGCTGG - Intergenic
1170928545 20:20747623-20747645 CTGTAGGCTCTGGGGAAGGGAGG - Intergenic
1171351080 20:24503832-24503854 CAGTAGGCGCTGGGGGTGGCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1173620780 20:44434414-44434436 GGGAAGGCACAGGGGAAGGCGGG - Intergenic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1173988422 20:47280787-47280809 CTGGAGTCAGAGGGGTAGGCAGG - Intronic
1174293512 20:49526432-49526454 CTGTAGGCACAGGGGAAAAGTGG - Intronic
1174447021 20:50597342-50597364 CAGAAGGCTCAGGGGCAGGCTGG + Intronic
1175913601 20:62415762-62415784 CTGTGGGGACCGGGTGAGGCTGG - Intronic
1176000383 20:62828911-62828933 CTGTCCTCACAGGGAGAGGCTGG + Exonic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176235954 20:64053637-64053659 CTGAATGCACAGGGTGATGCTGG + Intronic
1178601007 21:33994064-33994086 CTGAGGGCACAGGGGCAGACAGG + Intergenic
1179805200 21:43832852-43832874 CTGTGGGCAACGGGGAAGGCAGG + Intergenic
1179955159 21:44734461-44734483 TTGTAGGAACTCGGGGAGGCAGG - Intergenic
1180657232 22:17432837-17432859 CTGTAATCACAGGGTGAGGTGGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181014417 22:20061056-20061078 CAGTGGGCACAGGTGTAGGCTGG - Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181647889 22:24243638-24243660 TTGTGGGCCCAGTGGGAGGCAGG + Intronic
1182063008 22:27411148-27411170 TAGGAGGCACTGGGGGAGGCTGG - Intergenic
1182340897 22:29620005-29620027 CTGTAATCCCAGTGGGAGGCCGG + Intronic
1182390060 22:29986196-29986218 CTGATGGCACATGGGAAGGCTGG + Intronic
1182736724 22:32536127-32536149 CAGGAGGCACTGGGGAAGGCTGG + Intronic
1183317625 22:37145644-37145666 GAGCAGGCAAAGGGGGAGGCAGG + Intronic
1183369529 22:37424661-37424683 CTGTAGCCACTGAGGGCGGCGGG + Intronic
1183477012 22:38041247-38041269 GGGCAGGCACAGGGGGAGGGAGG + Intronic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184299041 22:43544086-43544108 CAGTAAGCTCAGGGGGAGGCTGG - Intronic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184462318 22:44646131-44646153 CTGTAAGGAAATGGGGAGGCGGG - Intergenic
1185056422 22:48580971-48580993 CTGGAGGGTCAGGGAGAGGCAGG - Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
951049368 3:18077221-18077243 CTATAGGCCCACGGGGAGTCGGG - Intronic
951661313 3:25069697-25069719 CTGAAAGCGGAGGGGGAGGCAGG + Intergenic
952128553 3:30332646-30332668 CTGTGGGATCACGGGGAGGCTGG - Intergenic
952749716 3:36815433-36815455 CTGTTAGGAAAGGGGGAGGCTGG + Intergenic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953356592 3:42261491-42261513 CTGAAGGCAAAGGGAGAGGGGGG + Intronic
954634026 3:52061910-52061932 ATGAAGGCACATGTGGAGGCAGG - Intergenic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
954748888 3:52802819-52802841 GGGTAGGCACAGGTGGGGGCTGG - Intronic
956748074 3:72325153-72325175 GTGAAGGGACAGGGGGAGGGAGG + Intergenic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
965102962 3:164326328-164326350 CTGTGGGGAACGGGGGAGGCAGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
968331950 3:197878403-197878425 TGGTAGGAACAGGGGCAGGCTGG - Intronic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
968935625 4:3608677-3608699 CTGGAGGCACTGGGGCAGGGAGG + Intergenic
969022465 4:4147488-4147510 CTGTGGGCACTGGGGGGGGGGGG - Intergenic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
970423283 4:15924561-15924583 CTGTAGGCAGAGGGCTAGCCTGG - Intergenic
970667587 4:18354893-18354915 CTCTAGGCACCGGGGGAAGGAGG - Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
972800880 4:42474568-42474590 CTGAAGGCACAGAGCCAGGCAGG + Intronic
974118678 4:57611810-57611832 CTGTAGTCCCAGGGGGATGAGGG + Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
976561323 4:86504899-86504921 CTGTAGGCAAACTGGGAGGCAGG - Intronic
979487340 4:121283843-121283865 CTGAAGCCACAGGGGCTGGCCGG - Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980709963 4:136552930-136552952 ATTTAGGCACTGGGAGAGGCAGG - Intergenic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
985136221 4:186788572-186788594 CTTTAGGCAAATGGGGAGGCTGG - Intergenic
985763375 5:1763365-1763387 CTCTAGACACAGAGGGTGGCCGG + Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
985999807 5:3621378-3621400 CTCTAGGCACAGGAGGAGTGGGG + Intergenic
988514344 5:31891771-31891793 ATCTGGGCACAGGGTGAGGCTGG - Intronic
990607206 5:57422999-57423021 CGCCAGGCACAGGGGCAGGCAGG - Intergenic
991970172 5:72133236-72133258 CTGTAAGTACAGGCAGAGGCAGG - Intronic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
992625735 5:78634476-78634498 CCATAGGCACAGGGGCAGGTGGG - Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998184292 5:139966976-139966998 GTGGAGCCACTGGGGGAGGCTGG - Intronic
998373147 5:141673770-141673792 CTGGAGGCACGGGAGGATGCTGG - Exonic
998379602 5:141714737-141714759 CTCTAGGCAAAGGAGGAGCCAGG - Intergenic
998603844 5:143613752-143613774 CTGATGGAACAGGGGCAGGCTGG + Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1002033090 5:176445396-176445418 CTGTAGTCCCAGGCCGAGGCAGG - Intergenic
1002089610 5:176796764-176796786 CTGGAGCCACAGGGTGTGGCCGG - Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002448296 5:179303335-179303357 CTGCAGGCAGTGGGGGATGCAGG - Intronic
1002477014 5:179472787-179472809 CCATAGGCACAGGCAGAGGCCGG - Intergenic
1002528055 5:179826107-179826129 CTGTAGCCACAGGAGGCAGCAGG - Intronic
1002638952 5:180621532-180621554 CTGTCGGTGCAGGGTGAGGCTGG - Exonic
1003168728 6:3703703-3703725 CTGTCAGCACAGGGTCAGGCAGG - Intergenic
1003193603 6:3895439-3895461 GTGTAAGCACAGGGAGAAGCTGG - Intergenic
1003487351 6:6591146-6591168 CTGCAGGCAGAGGGTGAGTCTGG - Intronic
1003835595 6:10069372-10069394 CAGGAGGCAGAGGGGGAGGGTGG - Intronic
1003974707 6:11331359-11331381 CTGAAGCAACAGGGTGAGGCGGG + Intronic
1004155999 6:13168830-13168852 CTGTAAGGAAAGGGGGAGTCAGG + Intronic
1007323166 6:41041453-41041475 CAGGAGGCACTGGGAGAGGCAGG + Intronic
1007479210 6:42139051-42139073 CTGTTTGCACAAGGGTAGGCTGG - Intronic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1011607585 6:89119174-89119196 CTGCAGGCACAGGGCTAGACTGG + Intergenic
1012549994 6:100457320-100457342 TTGTAGGCAATGGGGGAGGGTGG + Intronic
1012979343 6:105813252-105813274 CTGTAGGTACAGGGAGAAGCAGG + Intergenic
1013166942 6:107603252-107603274 CAGAAGGCACACTGGGAGGCAGG - Intronic
1013650296 6:112187990-112188012 ACGTGGGCACATGGGGAGGCAGG + Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1016015214 6:139176952-139176974 CTGTAAGCACTGTGGGAAGCCGG + Exonic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016834301 6:148461982-148462004 GTGCATGTACAGGGGGAGGCAGG - Intronic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1017313322 6:153000557-153000579 TTATAGGCAAAGGGGAAGGCAGG - Intronic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1017569633 6:155730969-155730991 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569641 6:155731010-155731032 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569672 6:155731174-155731196 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569754 6:155731584-155731606 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569771 6:155731666-155731688 CTATAGGAACAGGGGAAGGATGG + Intergenic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1018631569 6:165826781-165826803 GGGGACGCACAGGGGGAGGCTGG + Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019357804 7:590085-590107 CTCCAGGCACCGGGGGAGGCAGG - Intronic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019731809 7:2632928-2632950 CTGTAGCCCCCGGGGGAGGGAGG + Intronic
1019736620 7:2653024-2653046 GGGTAGGCACTGGGGCAGGCAGG + Intronic
1019740453 7:2670409-2670431 GTGGAGGCAGAGTGGGAGGCGGG + Intergenic
1019906998 7:4072464-4072486 CTGGGGGCACAGGGTGATGCTGG - Intronic
1020078860 7:5275772-5275794 CTGCAGGAACAGGGAGGGGCTGG - Intronic
1020362824 7:7347913-7347935 ATGTAGGCAATGGGGGAGGGGGG + Intergenic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1025200029 7:56956394-56956416 CTGCAGGAACAGGGAGGGGCTGG + Intergenic
1025671915 7:63620538-63620560 CTGCAGGAACAGGGAGGGGCTGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027053238 7:75032617-75032639 CTGTGGGCCAAGGGTGAGGCAGG - Intronic
1027408535 7:77888501-77888523 CTGGAGGCATTGGGGGAGGGAGG + Intronic
1029109144 7:98203390-98203412 CTGCAGGCAGAGGGAGAGACAGG + Intronic
1029318823 7:99739032-99739054 CTCTAGGCACTGGAGGAGGTAGG + Intergenic
1030914092 7:115291014-115291036 CTGCAGGCACTCTGGGAGGCTGG + Intergenic
1032215187 7:129952364-129952386 CCGTAGGCACTGGGGGAGGAGGG + Intronic
1032458835 7:132094367-132094389 CTGGAGGCTCAAGGGGAGGCTGG - Intergenic
1032504130 7:132423107-132423129 GTGTTCGCACAGGAGGAGGCTGG - Intronic
1033283658 7:140023004-140023026 CTGTTGGCAGAGGGGCTGGCGGG - Intergenic
1033814677 7:145057437-145057459 CTGGAGGCTCTGGGGGAGGATGG + Intergenic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034265237 7:149777520-149777542 CTCCCGGCACAGCGGGAGGCAGG - Intergenic
1034964259 7:155381907-155381929 CTGTAGCCGCCAGGGGAGGCCGG - Intergenic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1035487312 7:159236187-159236209 CTGCAGGCCCAGGAGGAGTCAGG + Intergenic
1036677251 8:10844845-10844867 TTGTAGACATTGGGGGAGGCAGG + Intergenic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037491001 8:19397125-19397147 CTGTAGGCACAGGGGGGTATTGG - Intergenic
1037644230 8:20775762-20775784 CTGAAGGAACAGGTGGTGGCTGG + Intergenic
1038038008 8:23702653-23702675 CTGTAGGGGCTGGGGAAGGCAGG + Exonic
1038562366 8:28591348-28591370 CTTCAGGCACATGCGGAGGCGGG + Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1039862369 8:41469690-41469712 CTGAAGAGACAGGGCGAGGCTGG - Intergenic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041212220 8:55563828-55563850 CTGAAGTCACAGGGGTAGCCAGG - Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047339379 8:123966084-123966106 CAGGAAGCACTGGGGGAGGCTGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047707763 8:127517809-127517831 CAGAAGGCAAAGGAGGAGGCAGG - Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049707048 8:144047823-144047845 CTGTGGCCACAGGGTGAGACAGG + Intergenic
1049707955 8:144051473-144051495 CTGTTGGCGCGGGGGGGGGCGGG + Intronic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1050935033 9:11385703-11385725 TGGAAGGCAAAGGGGGAGGCAGG - Intergenic
1051278342 9:15418056-15418078 CAGTAGAGACAGGGGGAGGGGGG - Intergenic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1052893180 9:33722113-33722135 CTGGAGGCACAGGGAGCTGCTGG + Intergenic
1054454559 9:65423194-65423216 CTGGAGGCACTGGGGCAGGGAGG - Intergenic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1054861088 9:69954252-69954274 CTGTAGGCACATGGGATGGTTGG - Intergenic
1055376148 9:75649609-75649631 TTATAGGCACAGGATGAGGCAGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057078636 9:92155357-92155379 GTGCAGGCTCAGGGGTAGGCTGG - Intergenic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057580953 9:96287287-96287309 CTGGACCCACAGGGGCAGGCAGG + Intronic
1058324412 9:103677788-103677810 GTGTAGGCACAGAGGGACGGTGG - Intergenic
1058957706 9:109964371-109964393 CTGCAGGCAGAGGCAGAGGCAGG + Intronic
1060044050 9:120326059-120326081 CAGAAGGCTCAGGGGGAGGCGGG - Intergenic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1061927482 9:133813090-133813112 CTGTGGGAACAGGGGGTGGTTGG - Intronic
1062285236 9:135769924-135769946 CTGCGGGCAGTGGGGGAGGCCGG - Intronic
1185784172 X:2875866-2875888 CTGCAGGCTGAGGGGAAGGCTGG - Exonic
1185877422 X:3712644-3712666 CTCTGGGCACACAGGGAGGCTGG + Intronic
1188057266 X:25555731-25555753 CTGTGGGAGCAGGGAGAGGCGGG - Intergenic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1189682293 X:43529225-43529247 GAGTAGGCAGAGGGAGAGGCTGG - Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190817422 X:53940342-53940364 GTTTAGGCTCAGGAGGAGGCAGG + Exonic
1193640941 X:84009007-84009029 CTGGAGGCACAGGGGGTAGGGGG + Intergenic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1195920747 X:109981165-109981187 TTATAGGCACAGGTGCAGGCAGG + Intergenic
1197288486 X:124625663-124625685 CAGAAGGCAAAGGGGGAGGAAGG + Intronic
1199062442 X:143375448-143375470 CAGAAAGCACAGGGGAAGGCAGG + Intergenic
1199855163 X:151753713-151753735 CTGCAGGCACAGGGCATGGCAGG + Intergenic
1199994430 X:153011687-153011709 TTGGAGGCAGAGGCGGAGGCGGG - Intergenic
1200163719 X:154022145-154022167 CTTGGGGCACAGGGAGAGGCCGG - Intronic
1200787871 Y:7274874-7274896 CGCTGGGCACACGGGGAGGCTGG - Intergenic