ID: 1077024524

View in Genome Browser
Species Human (GRCh38)
Location 11:433324-433346
Sequence GGCCGCGCCGACCACCATCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077024524_1077024533 6 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024533 11:433353-433375 GCGTGGGGGGCAGGCCCCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 221
1077024524_1077024539 25 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024539 11:433372-433394 CAGGCTCCAGGAGGAGAGTGCGG 0: 1
1: 0
2: 4
3: 51
4: 579
1077024524_1077024535 16 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024535 11:433363-433385 CAGGCCCCTCAGGCTCCAGGAGG 0: 1
1: 0
2: 5
3: 59
4: 394
1077024524_1077024527 -10 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024527 11:433337-433359 CGGCGCGGCCAGCTCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1077024524_1077024534 13 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024534 11:433360-433382 GGGCAGGCCCCTCAGGCTCCAGG 0: 1
1: 0
2: 4
3: 59
4: 391
1077024524_1077024529 -8 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024529 11:433339-433361 GCGCGGCCAGCTCGGCGTGGGGG 0: 1
1: 0
2: 2
3: 8
4: 155
1077024524_1077024528 -9 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024528 11:433338-433360 GGCGCGGCCAGCTCGGCGTGGGG 0: 1
1: 0
2: 1
3: 8
4: 152
1077024524_1077024530 -7 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024530 11:433340-433362 CGCGGCCAGCTCGGCGTGGGGGG 0: 1
1: 0
2: 0
3: 19
4: 103
1077024524_1077024531 -3 Left 1077024524 11:433324-433346 CCGGGATGGTGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1077024531 11:433344-433366 GCCAGCTCGGCGTGGGGGGCAGG 0: 1
1: 0
2: 3
3: 34
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077024524 Original CRISPR GGCCGCGCCGACCACCATCC CGG (reversed) Exonic
900178109 1:1299532-1299554 AGCAGCCCCGGCCACCATCCCGG - Intronic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
905307789 1:37031554-37031576 GGCATCGCCGAGCACCAGCCCGG - Intronic
905807007 1:40884462-40884484 GGCCGCGCTCACCACCACCGCGG + Intergenic
910387956 1:86705054-86705076 GGCCTCGCCGACCACCCAGCGGG + Intronic
914249090 1:145907132-145907154 GGGGGCGCCCACCAGCATCCTGG + Exonic
922603006 1:226870975-226870997 CGCCGCGCCCACCCCCAGCCGGG - Intronic
1066388103 10:34957649-34957671 GGCCACTTCCACCACCATCCAGG - Intergenic
1076542115 10:131220907-131220929 GGCCAGGGCCACCACCATCCAGG + Intronic
1077024524 11:433324-433346 GGCCGCGCCGACCACCATCCCGG - Exonic
1077351291 11:2094389-2094411 GGCTGTGCCGCCCAGCATCCAGG - Intergenic
1077538319 11:3134883-3134905 GGCAGGGCCAACCACCAGCCTGG + Intronic
1078417865 11:11180494-11180516 GCCCCCGCGGACAACCATCCTGG + Intergenic
1084035945 11:66510517-66510539 GGACGCGCTGGCCACCTTCCTGG - Intronic
1097153450 12:56995863-56995885 GGCCCTGTCCACCACCATCCTGG + Exonic
1100309027 12:93377733-93377755 GGCCTCGCCGAACTCCAGCCCGG + Intergenic
1108484478 13:50910203-50910225 GGGCGCGCCGCCCCCCACCCCGG + Intronic
1113965669 13:114152112-114152134 GGCCACGCTGCCCTCCATCCAGG + Intergenic
1122750389 14:103928587-103928609 GGGCGCGCCGCCCGCCTTCCCGG + Exonic
1123048191 14:105528394-105528416 GCCCGCGCCGCCCTCCCTCCTGG - Intronic
1125859696 15:42987065-42987087 GGCCGAGCCCAGCACCATGCAGG - Intronic
1130115818 15:81003117-81003139 GGCGGTGCAGACCGCCATCCTGG + Exonic
1133311191 16:4847728-4847750 GGCCGCGCCGAGCTCCGTCAGGG - Intronic
1139527476 16:67525804-67525826 GGCCGAGCTGACCACGACCCAGG + Intronic
1141954726 16:87363016-87363038 GGCCGCTCTGACAACCATCCAGG + Intronic
1142210184 16:88804938-88804960 GGCCACGCCTGCCACCAACCCGG - Intronic
1143591494 17:7887985-7888007 GGCCTCGGCCACCACCAGCCAGG - Intronic
1144581039 17:16459781-16459803 GGCTGCTCCTACCACCAGCCTGG + Intronic
1144758569 17:17694627-17694649 GCCCGCGGCGCCCACCATCTTGG + Intronic
1144929594 17:18848578-18848600 GCCCTCGCAGCCCACCATCCAGG - Intronic
1146256009 17:31391848-31391870 GCCCGCGCCGCCCGCCATCCGGG - Exonic
1152922396 17:83072629-83072651 GGACGCACAGTCCACCATCCTGG + Intergenic
1152924175 17:83079925-83079947 GCCCGCGCCGCCCAGCAGCCCGG - Exonic
1158152351 18:54387319-54387341 GGAAGCGCCCACCACCATCTTGG + Intergenic
1160349741 18:78166661-78166683 GGCCGTGGAGAGCACCATCCAGG + Intergenic
1160706327 19:531841-531863 GGCCGGGCCGCGCACCGTCCGGG - Exonic
1160887748 19:1359364-1359386 GGCCGGGCTGACCATCATCTTGG + Intronic
1161703093 19:5805371-5805393 AGCCGCCGCGACCGCCATCCGGG - Intergenic
1162416903 19:10543881-10543903 GGCCACGCCCACCGTCATCCGGG + Intronic
1162573951 19:11487772-11487794 GGCAGCGACGCCCACCAGCCCGG - Exonic
1163323243 19:16586746-16586768 GGCAGTGCCGCCCACCGTCCAGG - Intronic
1166821759 19:45584747-45584769 GAACGCGCCCACCACCATCTTGG + Exonic
1167466292 19:49652441-49652463 GGCCGTGCCACCCTCCATCCAGG + Exonic
929559878 2:42949526-42949548 GGCAGCCCCCACCAACATCCAGG - Intergenic
945065769 2:205946557-205946579 GGCCCCTCCGAGCACCATCCTGG + Intergenic
948401889 2:237691361-237691383 GGCCGCGACGACCCCCTGCCAGG - Intronic
1171301070 20:24061007-24061029 GGCCACGCTGAGCTCCATCCTGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1185038178 22:48490276-48490298 GGCCGCGGCGAGCCCCCTCCGGG - Intronic
949461969 3:4303505-4303527 GGCCGCGCCGGCGCCCTTCCAGG + Exonic
956892199 3:73624067-73624089 GCCCGCCCCGACCTCCAGCCAGG - Intronic
959085856 3:101849896-101849918 GCCCGCGCCGAGCGCCAGCCAGG + Exonic
986323817 5:6656653-6656675 TGAGGCGCCGACCACCATGCTGG + Intronic
995142531 5:108749286-108749308 GGCCGCCCCTCCCACCATCCCGG + Intronic
996442999 5:123512632-123512654 GGCCGCGGCGCCCTCCCTCCCGG + Intronic
996811218 5:127517873-127517895 GGCCGGCCCGCCCACCTTCCAGG - Intronic
997694875 5:135852726-135852748 GACCACGCCGGCCACCATGCTGG - Exonic
1003552136 6:7108878-7108900 GGTCACGCCGACCACCGCCCCGG + Intronic
1006518744 6:34559271-34559293 GGCCTTGCTGACCACCAACCTGG + Intergenic
1019371903 7:666468-666490 GGCTGCACCTACCACCACCCTGG + Intronic
1022363255 7:29684622-29684644 GCCCGCGCCGGTCTCCATCCTGG - Intergenic
1022698141 7:32729165-32729187 GCCCGCGCCGGTCTCCATCCTGG + Intergenic
1023984324 7:45086074-45086096 GGCCGCTGCCACCACCATCCTGG - Exonic
1023994141 7:45148569-45148591 GCCGGCCCCGTCCACCATCCAGG + Intergenic
1037324657 8:17676389-17676411 GGCCGCGCCACCCACCAGTCGGG + Intronic
1045767808 8:105696183-105696205 GGCCCTGCCGTGCACCATCCTGG + Intronic
1047256072 8:123214490-123214512 GGGCACGCCGACCACACTCCAGG + Intergenic
1049682966 8:143927883-143927905 GGCCGTGCCGGCCACCCTCCCGG - Exonic
1062494831 9:136826812-136826834 GGCCGTCCTGACCCCCATCCTGG + Intronic
1189152043 X:38719182-38719204 GGGAGCGGCCACCACCATCCTGG - Intergenic