ID: 1077026888

View in Genome Browser
Species Human (GRCh38)
Location 11:443895-443917
Sequence GTTCAGAAACAGAATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077026886_1077026888 8 Left 1077026886 11:443864-443886 CCAGGGGGTCACAGCTGCCAAGT No data
Right 1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG No data
1077026885_1077026888 20 Left 1077026885 11:443852-443874 CCGGCAGTCTCACCAGGGGGTCA No data
Right 1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG No data
1077026887_1077026888 -9 Left 1077026887 11:443881-443903 CCAAGTTAGATCTAGTTCAGAAA No data
Right 1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077026888 Original CRISPR GTTCAGAAACAGAATGTGCA AGG Intergenic
No off target data available for this crispr