ID: 1077027587

View in Genome Browser
Species Human (GRCh38)
Location 11:448165-448187
Sequence CCGCCCACAGACCATGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077027577_1077027587 -1 Left 1077027577 11:448143-448165 CCCAAGGCCCCGCCCTCAGGCCC No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027575_1077027587 5 Left 1077027575 11:448137-448159 CCGGGTCCCAAGGCCCCGCCCTC No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027578_1077027587 -2 Left 1077027578 11:448144-448166 CCAAGGCCCCGCCCTCAGGCCCC No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027581_1077027587 -10 Left 1077027581 11:448152-448174 CCGCCCTCAGGCCCCGCCCACAG No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027579_1077027587 -8 Left 1077027579 11:448150-448172 CCCCGCCCTCAGGCCCCGCCCAC No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027580_1077027587 -9 Left 1077027580 11:448151-448173 CCCGCCCTCAGGCCCCGCCCACA No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data
1077027571_1077027587 29 Left 1077027571 11:448113-448135 CCGCGCGGTCTAGATCACGCTAC No data
Right 1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077027587 Original CRISPR CCGCCCACAGACCATGTCCT CGG Intergenic
No off target data available for this crispr