ID: 1077027686

View in Genome Browser
Species Human (GRCh38)
Location 11:448519-448541
Sequence TGGACGGGAGCTGGCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077027680_1077027686 6 Left 1077027680 11:448490-448512 CCTGTCGGGTGATTGCTGGAAAG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 208
1077027678_1077027686 11 Left 1077027678 11:448485-448507 CCAGGCCTGTCGGGTGATTGCTG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077027686 Original CRISPR TGGACGGGAGCTGGCTGCTC TGG Intronic
900092040 1:924830-924852 TGGACGGGCCCTTGCTGCCCTGG - Intergenic
900290884 1:1923132-1923154 TGGCCGGGAGCTGGCTGGAGGGG + Intronic
900391258 1:2434956-2434978 TGGCCCAGAGCTGGCTTCTCAGG + Intronic
901326072 1:8365912-8365934 GGCTCGGGAGCTGGCTGCTTCGG + Exonic
901547642 1:9971057-9971079 TGGACTGTAGTTGGCTGGTCGGG + Intronic
901804235 1:11727559-11727581 TGGAGGGCAGATGGCTGCACTGG + Intergenic
902878424 1:19354864-19354886 TGCAGGGGAGCTGGCTGCCTGGG + Intronic
903529628 1:24020321-24020343 TGGCTGGGAGCTGGTTGATCTGG + Intergenic
904325040 1:29722842-29722864 TGGAACAGAGCTGGCTGTTCTGG + Intergenic
904433984 1:30482390-30482412 TGGAACAGAGCTGGCTGTTCTGG - Intergenic
907495128 1:54838696-54838718 TGGCTGGGGGCTGGCTGGTCTGG + Intronic
910656703 1:89627019-89627041 AGGATGGGAGCTGGTTGCTATGG - Intergenic
917855987 1:179100244-179100266 TGGAGGAGAGCTGGTTTCTCTGG + Exonic
919757033 1:201072715-201072737 TGGACTGGAGCAGGGTGCTGGGG - Intronic
922472017 1:225882568-225882590 TGGACGTGAGCTGGCCGGTCCGG - Intergenic
922668470 1:227491896-227491918 TGGATGTGAGCTGGGTGCTCGGG - Intergenic
1066649141 10:37639073-37639095 GGAAAGGGAGCGGGCTGCTCAGG + Intergenic
1067031997 10:42884486-42884508 GGAAAGGGAGCGGGCTGCTCAGG + Intergenic
1067162998 10:43842818-43842840 AGGACGGGCCCTGGCAGCTCTGG - Intergenic
1067807587 10:49404030-49404052 TGGATGGGAGTGGGCTGGTCAGG - Intergenic
1075015710 10:118908739-118908761 TGGACGGGAGCTGGCGTTTCAGG + Intergenic
1076403107 10:130195995-130196017 TGGCTGGGGGCTGGCTGCTCTGG + Intergenic
1076668833 10:132108039-132108061 TGGGAAGGTGCTGGCTGCTCTGG + Intronic
1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG + Intronic
1078110282 11:8386610-8386632 AGGACGGGAGACGTCTGCTCTGG - Intergenic
1079839895 11:25383202-25383224 TGGAATGGAAATGGCTGCTCTGG - Intergenic
1079888772 11:26023839-26023861 TGGAGGGGAGGTAGCTGCTCAGG - Intergenic
1081940116 11:46934433-46934455 TTGGCGGGTGCTGGCTGCTGGGG - Intergenic
1084268861 11:68018704-68018726 TGGGTGGGAGCTGGCTGCTGAGG + Intronic
1084598423 11:70130906-70130928 TGGACGTGGCCTGGGTGCTCTGG - Intronic
1085688258 11:78645390-78645412 TGGCCGGTAGATGGCAGCTCAGG + Intergenic
1086405442 11:86495418-86495440 TGGAAGGGTGCTGTCTGCCCTGG - Intronic
1089202018 11:116730255-116730277 GGGGCTGGAGCTGGCTGCACAGG - Intergenic
1089299471 11:117489951-117489973 TGGACTGGGGCAGGCTGCCCTGG - Intronic
1090839603 11:130476578-130476600 TACAAGGGAGCTGGCTGCTGAGG + Exonic
1091303496 11:134522971-134522993 GGGACTGGAGCCGGCTGCCCTGG - Intergenic
1091305870 11:134535761-134535783 TGGAGGGGTGCAGGCTGCTGGGG + Intergenic
1091796684 12:3301257-3301279 TGAAGGGGAGCAGGCTGGTCTGG + Intergenic
1092388596 12:8055056-8055078 TGGAAGGGAGCTGGAATCTCAGG - Exonic
1096592782 12:52672792-52672814 TAAAAGGCAGCTGGCTGCTCAGG - Intergenic
1097280879 12:57845185-57845207 GGGGCGGGAGCTGGCTCCTGGGG - Intronic
1101648927 12:106657032-106657054 AGGACAGGAGCTGCCTGCTAAGG + Intronic
1102740827 12:115206048-115206070 TGGCTGGGGGCTGGCTGATCAGG - Intergenic
1103062834 12:117872891-117872913 TGGACAGGTGCTGACTGCTTTGG - Intronic
1103504521 12:121432908-121432930 GGCATGGGAGCTGCCTGCTCTGG - Intronic
1104363739 12:128157474-128157496 TGGATCTGTGCTGGCTGCTCTGG + Intergenic
1104690023 12:130818632-130818654 TGCACGGGAGCAGGCGGCGCTGG + Intronic
1106009933 13:25810313-25810335 TGGCCAGGAGCTGGCTGCATGGG - Intronic
1106452501 13:29895553-29895575 AGGATGGGAGCTGGCTTCTGGGG + Intergenic
1107102524 13:36609533-36609555 TGGGCAAGAGCTGGCTCCTCTGG + Intergenic
1111047113 13:82828896-82828918 TGGTATCGAGCTGGCTGCTCTGG + Intergenic
1112503199 13:99957591-99957613 TGTGCGGGAGTGGGCTGCTCTGG + Intergenic
1118386689 14:65261534-65261556 AGGCCAGGAGCTGGCTGCTGGGG + Intergenic
1122901022 14:104782408-104782430 GGCACGGGAGCTGCGTGCTCGGG - Intronic
1125521673 15:40351347-40351369 GGGACAGGAGTTGGCAGCTCTGG - Intronic
1127559095 15:60118194-60118216 TGAGCAGAAGCTGGCTGCTCTGG - Intergenic
1128386686 15:67154113-67154135 TGGACCTGAGCCGGCTGCTCTGG + Intronic
1129152410 15:73697237-73697259 TGGAAAGGAAGTGGCTGCTCAGG + Intronic
1130897318 15:88181537-88181559 AGGACAGGGGCTGGGTGCTCAGG - Intronic
1132395225 15:101467954-101467976 TGGACGGGTGGTGGCTTCACAGG + Intronic
1133750742 16:8723361-8723383 TAGAAGGGAGCTGGGTGCCCAGG - Intronic
1138048756 16:53753863-53753885 TGCAGGAGAACTGGCTGCTCAGG + Intronic
1139471251 16:67179273-67179295 AGGGCGGGAGGTGGCTGCTCAGG + Intronic
1139477032 16:67207920-67207942 TGGCCAGGAGCTGGCTGCCTGGG + Exonic
1139584575 16:67893525-67893547 AGGCCGGGCGATGGCTGCTCGGG + Intronic
1140923060 16:79557098-79557120 TGTACGTGAGCTGGGTGCTGTGG - Intergenic
1141659026 16:85431698-85431720 TGGACAGGAGCTGGCCTGTCTGG + Intergenic
1142164298 16:88577526-88577548 ACGGCGGGAGCTGGCTCCTCAGG - Exonic
1142317739 16:89359308-89359330 TGTATGGGAAATGGCTGCTCTGG - Intronic
1142399958 16:89853435-89853457 TGGCCAGGAGCGGCCTGCTCAGG + Intronic
1146057083 17:29586900-29586922 TGGACATGACATGGCTGCTCTGG - Intronic
1146908365 17:36632312-36632334 TGGCCGGGAGCTGGCTCTCCTGG - Intergenic
1147608385 17:41786667-41786689 TGGTCGGGCGGCGGCTGCTCCGG + Exonic
1148693511 17:49546030-49546052 GGGGCGGCAGCTGTCTGCTCGGG + Intergenic
1151244467 17:72783902-72783924 TGGGTGGGGGCTGGCTGCCCTGG - Intronic
1151898503 17:76996619-76996641 TGGACTGGAGCAGGCTGAGCTGG - Intergenic
1152067295 17:78118842-78118864 TGGAGTGGGGCTGGCGGCTCGGG - Intronic
1152332266 17:79680103-79680125 AGGAGGGGGTCTGGCTGCTCAGG - Intergenic
1153139960 18:1960084-1960106 GGGACTGGAACTGGCTGCTTTGG + Intergenic
1155242052 18:23873013-23873035 TGGACGTCCGCTGGCTGCGCAGG - Intronic
1155720087 18:29000841-29000863 TAGATGGGACCTGGCTTCTCAGG - Intergenic
1158966770 18:62629142-62629164 TGGGCGGGGGCTGGATGATCTGG + Intergenic
1160870000 19:1273354-1273376 GGGACGGGAGCGGGCAGCTCAGG + Intronic
1161120804 19:2525213-2525235 GGGGCGGGAGCAGGCAGCTCCGG + Intronic
1161120889 19:2525616-2525638 AGGACAGGAGCTGGCAGCACCGG + Intronic
1162164555 19:8743428-8743450 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1162165627 19:8750896-8750918 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1162166692 19:8758352-8758374 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1162167758 19:8765808-8765830 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1162168697 19:8772106-8772128 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1162170443 19:8784870-8784892 TGGTGGGGAGCTGGCTGTACCGG + Intergenic
1163124745 19:15238805-15238827 TGGACTGGGGCTGGGAGCTCTGG + Exonic
1163447789 19:17357725-17357747 TGGGCTGGGGCTGTCTGCTCTGG - Intronic
1163641493 19:18464966-18464988 TGGGCAGGAGCTGGCTGGTCAGG + Intronic
1165376957 19:35449644-35449666 TGAAGGAGAGCTGGCTGCGCGGG + Intronic
1165635309 19:37335033-37335055 TGGATGGGAATTGGCTGCTCTGG + Intronic
1165773936 19:38394232-38394254 AGGAAGGCAGCTGGCTGCCCAGG + Intronic
1166130770 19:40744389-40744411 TGGACTTGAGCTGGCTGCCTAGG - Intronic
1166944334 19:46387844-46387866 TGGGCTGGTGCTGGGTGCTCAGG + Intronic
1167112195 19:47469028-47469050 GGGCTGGGAGCTGGCTCCTCTGG + Intronic
1167341863 19:48921201-48921223 TGAAGAGGAGCTGGCTGCCCGGG + Exonic
925013483 2:503806-503828 TGGACGGAAGGCTGCTGCTCTGG - Intergenic
925406987 2:3612440-3612462 TGGACAGGAGCCGGCTGACCAGG + Intronic
925871900 2:8278907-8278929 TGGAAGGCAGCTTGCTGCTGAGG - Intergenic
926341746 2:11909810-11909832 TGGGTGGCAGCTGGCAGCTCTGG - Intergenic
926349003 2:11978310-11978332 GGCACGGGGGCTGGCTGCACAGG - Intergenic
927460431 2:23293990-23294012 TGGAGGAGGGCTGGCAGCTCCGG + Intergenic
928074936 2:28255560-28255582 TGGATGGCAGCTGGGTGCTGTGG - Intronic
929779269 2:44947215-44947237 TGGAGGTCAGCTGGATGCTCTGG - Intergenic
931256877 2:60581763-60581785 ACGAGGGGAGCTGGCGGCTCCGG - Intergenic
932461225 2:71883189-71883211 TGGCAGGGAGGAGGCTGCTCAGG + Intergenic
932766660 2:74474818-74474840 TGGAAGGTAGGTGGCTGCTGGGG + Intronic
933851218 2:86368297-86368319 TGGACAGGAGCCGTCTGCTTGGG - Intergenic
934654621 2:96110725-96110747 TGGACGGGAGCTGTCTCAGCCGG - Intergenic
934773053 2:96920152-96920174 TGGATGGGAGTGGTCTGCTCCGG + Intronic
934991361 2:98924250-98924272 TGGGCTGGAGCTGCCAGCTCGGG + Intronic
935356197 2:102202192-102202214 TTCAAGAGAGCTGGCTGCTCTGG - Intronic
940919585 2:159292275-159292297 TGCACGGTGGCTGGCTGCTGAGG - Intergenic
948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG + Intronic
948255644 2:236566669-236566691 TGGACGCGAACTGCTTGCTCGGG + Intergenic
948874417 2:240819421-240819443 TGGAAGGGAGCTGGGGTCTCTGG + Intronic
1169496698 20:6122761-6122783 TGGAAAGGAGGTGGGTGCTCCGG - Exonic
1170642371 20:18165823-18165845 TGGAAGGAAGCTGTCAGCTCAGG - Intronic
1172700781 20:36852402-36852424 GGGACGGCAGATGGCTGCCCTGG - Intronic
1173204865 20:40984914-40984936 TGGACAGGCTCTGGCAGCTCTGG + Intergenic
1173513187 20:43646353-43646375 TGGAAGGAAGCTGGCTGTGCCGG + Intronic
1176304535 21:5116195-5116217 TGGCCTGGCCCTGGCTGCTCAGG + Intergenic
1176386601 21:6141170-6141192 TGGAGAGGAGCTGGCAGGTCAGG - Intergenic
1176407890 21:6431345-6431367 TGGAAGGGAGTGGGCTGCCCCGG + Intergenic
1179683381 21:43039676-43039698 TGGAAGGGAGTGGGCTGCCCCGG + Intergenic
1179736872 21:43397082-43397104 TGGAGAGGAGCTGGCAGGTCAGG + Intergenic
1179828144 21:43979787-43979809 AGGCAGGGAGCTGGGTGCTCAGG + Intronic
1179852521 21:44145835-44145857 TGGCCTGGCCCTGGCTGCTCAGG - Intergenic
1180820273 22:18822390-18822412 CGGTCTGGAGCTTGCTGCTCAGG - Intergenic
1181116615 22:20635697-20635719 GGGAGGGGAGGTGGCTGCTTGGG + Intergenic
1181132499 22:20741392-20741414 TTGATGGGAGCAGGCTGGTCAGG + Intronic
1181206498 22:21256862-21256884 CGGTCTGGAGCTTGCTGCTCAGG - Intergenic
1181803436 22:25361531-25361553 TGGACGGGGTCCTGCTGCTCAGG + Exonic
1183374389 22:37454540-37454562 AGGATGGAAGCTGGCTGCTAAGG + Intergenic
1183708599 22:39489562-39489584 AGGACAGGACCTGGCTGCCCTGG + Exonic
1183739315 22:39661332-39661354 TGGACGGGCGCTTCCTGCTGGGG + Intronic
1184732541 22:46378668-46378690 TGGACAGGAGCTCGCAGCCCCGG + Exonic
1184792068 22:46706276-46706298 TGGCCGGGAGCAGACGGCTCGGG - Intronic
1185048955 22:48543799-48543821 TGGAGGGAAGCTGCCTGCTGGGG - Intronic
1185295032 22:50049003-50049025 TGGAGGGGAGCTGGGAGCACCGG + Intronic
1185319712 22:50194970-50194992 TGGACGAGAGCACGCTGCTGCGG + Exonic
1185328363 22:50239040-50239062 TGGCTGGGAGCTGAGTGCTCTGG - Intronic
1203220422 22_KI270731v1_random:38561-38583 CGGTCTGGAGCTTGCTGCTCAGG + Intergenic
1203270403 22_KI270734v1_random:48265-48287 CGGTCTGGAGCTTGCTGCTCAGG - Intergenic
950578880 3:13850219-13850241 TGGGCGGGGCCTGGCTCCTCAGG + Intronic
950712272 3:14820859-14820881 TGGACGGAAGGTGGTTTCTCTGG - Exonic
950897236 3:16464236-16464258 TGGACGGAATGTTGCTGCTCTGG - Intronic
954435971 3:50496531-50496553 TGGATGGGTGCTGGGTGCTATGG + Intronic
955080837 3:55656574-55656596 GAGACAGGAGCTGGCTACTCTGG - Intronic
955489424 3:59467663-59467685 TGGCTGGCAGCTGGCTGCTTCGG - Intergenic
957078939 3:75621314-75621336 TGAAGGGGAGCAGGCTCCTCAGG - Intergenic
961448547 3:126992232-126992254 TGGAGGGGAGCTGCCTGGGCTGG + Intronic
962972885 3:140421201-140421223 TGGACAGAAGCCCGCTGCTCAGG + Exonic
968332304 3:197881422-197881444 TGGGCTGGAGCTGGCCTCTCAGG + Intronic
968668263 4:1833500-1833522 TGGCCGGGACCCTGCTGCTCTGG + Intronic
968967489 4:3776463-3776485 CGGGCAGGAGCTGGCTGCTGAGG + Intergenic
970553184 4:17204816-17204838 TGGTGGGGAGCTCTCTGCTCTGG - Intergenic
970895669 4:21100610-21100632 TGGATGGCTGCTGGCTGATCAGG - Intronic
972331293 4:38066695-38066717 TGGAGGGGAGCTGGGGGCTCTGG + Intronic
972375384 4:38464928-38464950 TGGACGGGGCCTGGCTCCTCTGG - Intergenic
973932114 4:55803562-55803584 TGGAAAGGAGCTGGCAGCCCTGG + Intergenic
978361101 4:107931780-107931802 TGGGCTGGAGCTGGCTGCGGAGG + Exonic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
985754842 5:1707490-1707512 GGGAGGGGAGCTGGCTGCAAAGG + Intergenic
987058782 5:14222042-14222064 TGGATGGCTGCTGACTGCTCAGG - Intronic
988303936 5:29470248-29470270 TAGACGGGAGGTGGATGCTGTGG + Intergenic
989433468 5:41382462-41382484 TGGACAGTTTCTGGCTGCTCAGG + Exonic
990289475 5:54334058-54334080 TGCATGGGTGCTGGCTGCTGTGG - Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
997120116 5:131164968-131164990 GGGAGGGGACCTGGCTGCCCTGG - Intronic
997625082 5:135326186-135326208 TGGGCATGAGCTGGCTGCTCTGG + Intronic
999255897 5:150209945-150209967 GGAAAGGGAGCTGGCTGGTCAGG - Exonic
1001475014 5:172044365-172044387 AGGCCTGCAGCTGGCTGCTCAGG - Exonic
1002047554 5:176550377-176550399 TGGCGGGGAGCTGCGTGCTCAGG + Intronic
1003308964 6:4952286-4952308 TGGACGGAAGCTGACAGCGCAGG + Exonic
1003327119 6:5100420-5100442 TGGATGGAAGATGACTGCTCTGG + Intergenic
1008161021 6:48075841-48075863 TTGATGGCAGCTGACTGCTCAGG + Intergenic
1012426619 6:99121984-99122006 TGGCTGGCTGCTGGCTGCTCTGG + Intergenic
1013422287 6:109978090-109978112 TGGACTGGAGGTGGTTGCTCTGG + Intergenic
1014457295 6:121650648-121650670 TGGTTGGGAGCTGGATGCTCAGG - Intergenic
1016901658 6:149108799-149108821 TGGACGTGGGCAGGCTGCTGAGG - Intergenic
1017962166 6:159232525-159232547 TGGACGGGGACTGGCGGCTGGGG - Exonic
1021343110 7:19488931-19488953 TGGATAGGAGCTACCTGCTCTGG - Intergenic
1024089708 7:45924992-45925014 TGGAAGGGAGGTTTCTGCTCAGG + Intergenic
1025147275 7:56515695-56515717 TGGAAGTGAGCTGGGAGCTCAGG + Intergenic
1026214356 7:68335149-68335171 TCTCCGGGAACTGGCTGCTCTGG + Intergenic
1032494496 7:132350694-132350716 TGGAAGTGAGGTGGCTGCTTTGG + Intronic
1032504615 7:132425821-132425843 GGGGCGGGAGCTGGGGGCTCTGG + Intronic
1032783155 7:135180227-135180249 TCGACTGAAGCTGGCTGCGCAGG + Intergenic
1033019217 7:137705564-137705586 TGGAGGGGAGATGGCTGATTGGG + Intronic
1034103771 7:148473242-148473264 AGGACTGCAGCTGGCTGCTTAGG - Intergenic
1034963020 7:155374169-155374191 TGGACTGGAGCTGGGTGCCGAGG - Intergenic
1035201238 7:157268098-157268120 TGGAGTGGCGCTGCCTGCTCAGG - Exonic
1037290120 8:17341464-17341486 CGGACAGGGGCTGGCTGCTCCGG + Exonic
1042390403 8:68227709-68227731 TGGACTGGAGATGGTTGTTCTGG + Intronic
1043229518 8:77784221-77784243 TGAAGGGGATCTGGCTGCTTAGG - Intergenic
1048038558 8:130701927-130701949 TGGTTGGGAGTTGGCTGCTCTGG - Intergenic
1049037150 8:140085698-140085720 TGGACGGCAGCAGCCTGCTGAGG + Intronic
1049253662 8:141602757-141602779 TGGAAGGCAGCTGTCTCCTCAGG + Intergenic
1049300047 8:141864761-141864783 TTCACAGGTGCTGGCTGCTCAGG + Intergenic
1049707625 8:144050226-144050248 GAGACGGGAGCTGACTGCCCAGG + Intergenic
1050305598 9:4302368-4302390 TGGACTGGAGCTGGCAGCAGGGG - Intronic
1057560802 9:96126711-96126733 CGGAGGGGGCCTGGCTGCTCGGG - Intergenic
1058684033 9:107465334-107465356 TGGACCCCAGCTGGGTGCTCAGG + Intergenic
1062042887 9:134412224-134412246 AGGATGGGAGCTGTCGGCTCTGG + Intronic
1062331679 9:136047678-136047700 GGGACGGGAGGCAGCTGCTCTGG - Intronic
1062500972 9:136851875-136851897 CGGACAGCACCTGGCTGCTCAGG + Intronic
1062636683 9:137495150-137495172 AGGACAGGAGCCGGCTGCTGGGG + Intronic
1185708610 X:2283549-2283571 AAGACAGGAGATGGCTGCTCAGG + Intronic
1186704889 X:12130401-12130423 TGGATGGGAGGTGGGTCCTCAGG + Intergenic
1190776003 X:53552718-53552740 AGGAGTGGAGCTGCCTGCTCTGG + Exonic
1192266060 X:69538772-69538794 TGGACGGGACCGGCCGGCTCAGG - Intergenic
1192301750 X:69911841-69911863 TTGATGGCAGCTGACTGCTCGGG + Intronic
1192554227 X:72077348-72077370 GGGATGGGAGCTGTCTGCCCAGG + Intergenic
1194345035 X:92752108-92752130 TGGTTGGGGGCTGGCTGCTGGGG - Intergenic
1194346520 X:92772693-92772715 TGGTTGGGGGCTGGCTGCTGAGG + Intergenic
1197571613 X:128156900-128156922 TGGTGGGGACCTGGCTGCACTGG + Intergenic
1199886442 X:152025990-152026012 TGGCCGTGTGCTGGCTGTTCTGG + Intergenic
1199987683 X:152964235-152964257 CGGACTGGAGCTGGCTTCCCAGG - Intronic
1200653377 Y:5868750-5868772 TGGTTGGGGGCTGGCTGCTGGGG - Intergenic
1200654856 Y:5889341-5889363 TGGTTGGGGGCTGGCTGCTGAGG + Intergenic
1201743218 Y:17345128-17345150 TGGAAGGGAGCTTAATGCTCAGG + Intergenic