ID: 1077028146

View in Genome Browser
Species Human (GRCh38)
Location 11:450781-450803
Sequence GCTCCCCGGGACCCGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 10, 3: 22, 4: 318}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077028146_1077028166 15 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028166 11:450819-450841 CCGACGCCGGGTCGGGCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 66
1077028146_1077028160 7 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028160 11:450811-450833 CCGAGCTCCCGACGCCGGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1077028146_1077028169 27 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028169 11:450831-450853 CGGGCGGAGGGCGGCGCTGTAGG 0: 1
1: 0
2: 1
3: 26
4: 258
1077028146_1077028161 8 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028161 11:450812-450834 CGAGCTCCCGACGCCGGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1077028146_1077028162 11 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028162 11:450815-450837 GCTCCCGACGCCGGGTCGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 106
1077028146_1077028157 2 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028157 11:450806-450828 CCGGACCGAGCTCCCGACGCCGG 0: 1
1: 0
2: 0
3: 2
4: 45
1077028146_1077028170 30 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028170 11:450834-450856 GCGGAGGGCGGCGCTGTAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 217
1077028146_1077028158 3 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028158 11:450807-450829 CGGACCGAGCTCCCGACGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1077028146_1077028164 14 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028164 11:450818-450840 CCCGACGCCGGGTCGGGCGGAGG 0: 1
1: 0
2: 2
3: 26
4: 182
1077028146_1077028167 18 Left 1077028146 11:450781-450803 CCGCCCCCCGGGTCCCGGGGAGC 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1077028167 11:450822-450844 ACGCCGGGTCGGGCGGAGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077028146 Original CRISPR GCTCCCCGGGACCCGGGGGG CGG (reversed) Intronic
900372327 1:2337488-2337510 GCACCCTGGGACCCCGGGAGAGG - Intronic
900787087 1:4655789-4655811 CCTCCCCGGGGCCCGGGGCGAGG + Intronic
900935926 1:5766396-5766418 GCAGCCGGGGACCCGGGAGGAGG - Intergenic
901639131 1:10684518-10684540 GCTCTCCAGGACCCTGAGGGTGG + Intronic
902234358 1:15048140-15048162 GCTCCTCAGGACATGGGGGGAGG - Intronic
902517536 1:16997399-16997421 GCTCCCTGGAACCAGCGGGGGGG + Intronic
902600879 1:17539665-17539687 GCGCCCCGGGACCGGGCGGGCGG + Intergenic
902747191 1:18481942-18481964 GTTCCCAGGGACCCTGGCGGTGG - Exonic
902911023 1:19597247-19597269 GCCGCCCGGGCCCCGGCGGGAGG + Intronic
903679895 1:25089667-25089689 GCTCACGGGGACTCGGGGGCAGG - Intergenic
903883789 1:26529851-26529873 GGACCCCAGGACCCGGGAGGCGG + Intronic
904587669 1:31588975-31588997 GCTCCCTGGGGACCGGCGGGCGG - Intergenic
905044415 1:34984901-34984923 ACCCCCCCGGACCCTGGGGGAGG - Intronic
906047537 1:42843424-42843446 GCTCCCAGTGACCTGGAGGGAGG + Exonic
912520440 1:110241030-110241052 GCTCCCAGGGCGCCTGGGGGCGG + Intronic
914675571 1:149905025-149905047 GCTGCCTGAGACCCGGGGGCAGG - Exonic
915530643 1:156500532-156500554 GATCCCCCGGACCAGGGGCGAGG - Exonic
916651675 1:166839641-166839663 GCCGCCCGGGACCCGGGGGAGGG - Intronic
917456778 1:175192705-175192727 GCGCCCCGGGCCCTGGAGGGAGG + Exonic
918282841 1:183023188-183023210 GCGGCGCGCGACCCGGGGGGAGG - Intergenic
920260503 1:204685148-204685170 GCTCCGCCTGACCCGGGTGGGGG - Intronic
920352153 1:205344206-205344228 GCTGCACGGGAGCCGGGGAGAGG + Exonic
922950850 1:229558068-229558090 GCGCCCCGGGACCCCGCGTGTGG + Intronic
923093104 1:230754161-230754183 GCTGCCCTGGACGCGGAGGGCGG - Intronic
923630952 1:235649441-235649463 CTTCCCCGGGGCCCGGCGGGAGG + Intronic
924477616 1:244395516-244395538 GCTTCCCCGGCCCCAGGGGGAGG + Intergenic
1064119387 10:12605856-12605878 GCTCCACAGGCCCCGGGGAGAGG - Intronic
1069930525 10:71878582-71878604 GGGCCCGGGGACCTGGGGGGTGG + Intergenic
1072679786 10:97498633-97498655 GCTCCCCGGGAGACGGGCTGCGG + Exonic
1073122558 10:101131565-101131587 GCTCTGCGTGACCCGGGTGGAGG - Exonic
1073268301 10:102241433-102241455 GCGGCCCGGGAGCAGGGGGGCGG - Exonic
1073287875 10:102399360-102399382 GCTACCCGGGAGGCGGGGGCGGG + Exonic
1075318127 10:121468351-121468373 TCTCCCCTGGAAACGGGGGGTGG + Intergenic
1076035627 10:127196585-127196607 GAGCCCCGGGCCCCGCGGGGCGG + Intronic
1076372786 10:129965548-129965570 GCTGCCCCAGACCCGGCGGGAGG - Intergenic
1076744098 10:132504143-132504165 GCTGCCCAGGACCCTGGGGCTGG + Intergenic
1077028146 11:450781-450803 GCTCCCCGGGACCCGGGGGGCGG - Intronic
1077028147 11:450783-450805 GCCCCCCGGGTCCCGGGGAGCGG + Intronic
1077200782 11:1306447-1306469 GCTCCCCAGGGTCCGGGGGCAGG - Intronic
1077211106 11:1371324-1371346 GCTCCCCGGGGGGCGGGCGGGGG + Intergenic
1077228572 11:1448818-1448840 GCTCCCGGACACCCGGGGGCTGG - Intronic
1077267631 11:1659921-1659943 TCCCCACGGGACCCGGGCGGGGG - Intergenic
1077374098 11:2197549-2197571 GGTCCCCAGGACCCCGAGGGAGG + Intergenic
1078153501 11:8778651-8778673 GCTCCCACGTACCCGGGGGCTGG + Intronic
1079090474 11:17476886-17476908 GCTGGGCGGGGCCCGGGGGGCGG - Intergenic
1080665538 11:34332644-34332666 ACTCCCCTGGGCTCGGGGGGTGG - Intronic
1081674456 11:44960431-44960453 GCTGCCCCGGACCCCTGGGGAGG - Intergenic
1083259502 11:61515594-61515616 GCTCCCCGGAGCCCCAGGGGTGG - Intronic
1083259928 11:61517399-61517421 GCTCCCGGGGACCAGGGAGTGGG + Intronic
1083342556 11:61967910-61967932 GCGCCCCTAGACCGGGGGGGGGG - Intergenic
1083541042 11:63511671-63511693 GCTCCCCTGGCCCCCGGGGATGG + Intronic
1083710051 11:64542613-64542635 GCCCTCAGGGACACGGGGGGTGG - Intergenic
1083747810 11:64745092-64745114 GCCGCCCGGGACGCGGAGGGGGG + Intronic
1083922358 11:65787630-65787652 TCGACCCGGGACTCGGGGGGCGG + Intronic
1084325587 11:68397910-68397932 GCTCCCAGGGATCTGGGGAGAGG + Intronic
1084387921 11:68855576-68855598 GAGCCCCGAGACCCGGAGGGAGG + Intergenic
1084621210 11:70271141-70271163 GCGCCCCGTGACCCGGGCGCTGG + Intronic
1084706834 11:70820600-70820622 GCGCAGCAGGACCCGGGGGGCGG + Intronic
1084756412 11:71241658-71241680 GCTCCCTGGGAACCTGGTGGGGG - Intronic
1084972974 11:72781528-72781550 ACTGGCCGGGACCCGAGGGGAGG + Intronic
1085280023 11:75324228-75324250 GTTCCCCTAGACCTGGGGGGAGG - Intronic
1090263935 11:125342425-125342447 GCTCACTGGGAGCTGGGGGGAGG - Intronic
1091616377 12:2053679-2053701 GCTCCCCGCGGCCCCGGGGCCGG + Intronic
1092054067 12:5494416-5494438 GCTCCCCGAGAGCCGGAGCGGGG + Exonic
1093435479 12:19130214-19130236 GCGCCGCGGGCCCCGGGAGGCGG + Intronic
1093931134 12:24956091-24956113 GCTCCCCGGGGCGGGGGCGGAGG - Intergenic
1096502008 12:52069947-52069969 GCTTCCCGGCGCGCGGGGGGCGG + Intronic
1098827648 12:75318000-75318022 GTTGCCAGGGACTCGGGGGGAGG - Intronic
1099106226 12:78499404-78499426 GCTCCCTTGAACCCGGGAGGTGG + Intergenic
1100565517 12:95790528-95790550 GGTCCCGGGCACCTGGGGGGCGG + Exonic
1101023121 12:100573583-100573605 GCTTCCCGGCAGCCCGGGGGCGG + Intergenic
1101813603 12:108129197-108129219 GCTCCCCGGGAGGCTGCGGGAGG + Intergenic
1102043336 12:109814754-109814776 CCTCCCCGGGCCCCGCGCGGGGG + Exonic
1102518128 12:113463615-113463637 GGGACCCGGGACCCGGGGAGGGG + Intronic
1102646164 12:114405350-114405372 GCTCCCCGGGACCCTGGCGAGGG - Intronic
1103342070 12:120226013-120226035 CCTCCATGGGACCCGGAGGGCGG - Intronic
1103433007 12:120904055-120904077 GCTCCCTGGGCCCCGGGGCGGGG + Exonic
1103562802 12:121800876-121800898 GCTCCCCACGACCGGGGGGACGG + Intronic
1103595910 12:122024066-122024088 CCGCCCCGGGGCCCGCGGGGTGG - Intronic
1103692574 12:122787362-122787384 GATCCCCGGAAGCCGGGAGGTGG + Intronic
1103927270 12:124429841-124429863 CCTCCCCAGGACCCCGGGTGTGG - Intronic
1104485784 12:129150270-129150292 GCTTCCCAGGACCCCGTGGGTGG + Intronic
1104676548 12:130715392-130715414 GCTCCCCGGGGACAGGAGGGAGG + Intronic
1105019974 12:132809442-132809464 GCAGACCGGGAACCGGGGGGCGG - Intronic
1105210687 13:18255055-18255077 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1106422658 13:29596073-29596095 GCTCCCTGGGGCCCGCCGGGAGG - Intergenic
1107359492 13:39603256-39603278 GTTCCCCGGGGCGCGAGGGGAGG - Intronic
1110318550 13:74135433-74135455 GCTCCCCGGGGCGCGGAGGCGGG - Intergenic
1112693022 13:101917058-101917080 GCTCCCCGGGCGCCGGCTGGAGG + Intronic
1114265081 14:21069187-21069209 TCTCCCAGGAGCCCGGGGGGAGG - Intronic
1114461069 14:22886558-22886580 GCTGTACGGGACCCGGGGCGAGG - Intronic
1114514044 14:23286062-23286084 GCTCCCGGGGACGGTGGGGGGGG - Exonic
1114672880 14:24421742-24421764 ACTCCCTGGAACCCGGGAGGCGG - Intergenic
1115048657 14:29028989-29029011 TCTCCCTGGGACCTGGGGGAAGG - Intergenic
1120829244 14:88983537-88983559 GCTCCCCTGGACTTGGGGGAGGG - Intergenic
1121103377 14:91264769-91264791 GCCCCTCGAGCCCCGGGGGGAGG - Intergenic
1121137126 14:91509651-91509673 GCCGCCCGGGAACCGGGGCGGGG + Exonic
1121776292 14:96593171-96593193 GCTCCCCTGGACACGGAGGGTGG + Intergenic
1122542763 14:102507220-102507242 GCTCCCCGGGAGCTGAGGCGGGG + Exonic
1122893085 14:104742014-104742036 GCCCCTCGGGACCCCGTGGGAGG + Intronic
1122899595 14:104776867-104776889 GCTTCCCAGGACCTGGTGGGTGG - Intronic
1122974575 14:105165821-105165843 GCTCCCTGGGACCTGAGGAGGGG - Intronic
1123630792 15:22258308-22258330 GCGCCCCGGGGCCCGCGCGGGGG - Intergenic
1124045793 15:26148754-26148776 GCTCCTGGGGACCAGGTGGGTGG + Intergenic
1124360725 15:29034993-29035015 CCTCCCCGGGAGCCTGTGGGTGG - Intronic
1127893802 15:63277510-63277532 GCTAAGCGGGACGCGGGGGGCGG - Intronic
1128453661 15:67821322-67821344 GCCCCCAGGGTGCCGGGGGGTGG - Intronic
1128651168 15:69414646-69414668 GCTCCGCGGGAGCCTGGGCGCGG + Intronic
1132575390 16:661531-661553 GCTTCCCTAGACCCCGGGGGGGG + Intronic
1132578462 16:674627-674649 GCTTCTCGGGACCCAGGGCGTGG + Intronic
1132589644 16:721065-721087 GCTCGCCGGAACCCGCGGGAGGG + Exonic
1132793567 16:1706900-1706922 GGTCCCCGGGAGTCGGGGTGGGG - Intronic
1132850787 16:2024005-2024027 GCTCCCCGGGCCCCAGCAGGAGG - Intergenic
1132884860 16:2178254-2178276 GCGCCCCGGGACCAGGGATGGGG - Exonic
1134136396 16:11679264-11679286 GCTGCCAGGGAGCTGGGGGGTGG + Exonic
1136268144 16:29132631-29132653 CCTCCCCGGATCCCGGGGTGGGG + Intergenic
1136268913 16:29137102-29137124 GCTCCCAGGGACTCCCGGGGTGG - Intergenic
1136281745 16:29217560-29217582 GCTTCGCGGGACCCGTGTGGTGG - Intergenic
1136540058 16:30923951-30923973 CCTCCCCGGGAACCGGCGGTGGG + Intronic
1137655161 16:50153225-50153247 GCTCCTCCGGCCCCGGGGCGGGG - Intronic
1138580999 16:57940317-57940339 GCACCCTGTGACCCGGGGCGGGG + Exonic
1140322527 16:73967038-73967060 GTCCCCCGGGACCCTGGTGGTGG - Intergenic
1140469858 16:75207882-75207904 GCTCGCCGGGTCCCAGGGGATGG + Intergenic
1141921908 16:87141069-87141091 TCTCCCCGGGACCCTGGCGCCGG + Intronic
1142071455 16:88092969-88092991 CCTCCCCGGATCCCGGGGTGGGG + Intronic
1142086123 16:88183476-88183498 GCTTCGCGGGACCCGTGTGGTGG - Intergenic
1142121180 16:88387385-88387407 GTCCCCCGGCACCCGGGGGTGGG - Intergenic
1142243177 16:88956341-88956363 TGTCCCGGGGACCCGGCGGGTGG - Intronic
1142305278 16:89281018-89281040 TCTCCGCGGGAACCGGGGGCAGG + Exonic
1142590260 17:1001730-1001752 GCTCCCAGGGAAGCGGGGGATGG + Exonic
1142688526 17:1591500-1591522 GCTGCCCGGGACCCCGGCTGGGG + Intronic
1142812077 17:2400098-2400120 GCTTCCCTGGCCCCGTGGGGAGG - Intronic
1143030492 17:3964533-3964555 GCGCCCCGGGGCGCGGAGGGCGG - Intergenic
1143495178 17:7308322-7308344 GGTGGCCGGGACCTGGGGGGAGG - Intronic
1143519427 17:7437167-7437189 GGTGGCCGGGACCCGGGCGGCGG + Exonic
1144756076 17:17681516-17681538 GCGCCCGGGGACGCGGGGAGCGG - Exonic
1146053000 17:29567439-29567461 GCTCCCGGGACCCCGTGGGGCGG + Intronic
1146271386 17:31487992-31488014 GGGCCCCGGGACTCGGGGGCGGG - Intronic
1146357126 17:32143197-32143219 GCTCCCGGGGAAGCTGGGGGAGG + Intronic
1147200705 17:38799601-38799623 GCTCCCCGGGGCGGGGCGGGAGG - Exonic
1147643566 17:42020145-42020167 GCTCGCGGGGACCAGGGGAGGGG - Intronic
1147970981 17:44219090-44219112 GCTCCCCGGAGGCCGGGGCGGGG - Intronic
1148747068 17:49924405-49924427 ACCCCCCGGGGCCCGGGAGGAGG + Intergenic
1148899444 17:50865664-50865686 GCTCCCAGGAGCCCGGGGCGGGG - Intronic
1149630245 17:58116157-58116179 GCTCCTCGTGACCTTGGGGGAGG + Intergenic
1150248321 17:63692159-63692181 GCTCTCAGTGACCCGGGGGTGGG + Intronic
1150285237 17:63950436-63950458 GCTCCCCGGGGCCGGGGCCGGGG - Intronic
1151337257 17:73447321-73447343 GCTACCAGGGACCCAGGGAGGGG - Intronic
1151591389 17:75047099-75047121 GCGCCCGGGGACCCGCGCGGGGG - Intronic
1152625075 17:81384310-81384332 GCTCCCCGGGCACCTAGGGGAGG + Intergenic
1152707652 17:81853239-81853261 ACTCCCCGGGACCAGGTAGGAGG - Intronic
1154279599 18:12991095-12991117 GCTGCGTGGGACCCGGGGGACGG - Intergenic
1155053869 18:22169211-22169233 GAGCCCAGGGACCCCGGGGGAGG - Intergenic
1160171230 18:76557174-76557196 GATCACCGGAACCCGGGAGGCGG - Intergenic
1160179341 18:76620338-76620360 GCTCCCCAGCACGTGGGGGGCGG - Intergenic
1160500678 18:79400051-79400073 GCTCCTCCGGACCCGGGGGTAGG - Intronic
1160577337 18:79864110-79864132 GCGCCCTGGGACCTCGGGGGCGG + Exonic
1160706393 19:532122-532144 GGGCTCCGGGACCCGGGCGGGGG - Intronic
1160747135 19:717315-717337 GCTCCCCGAGGGCTGGGGGGAGG - Intronic
1160753690 19:747232-747254 GGGCCCCGGGAGCCGGGGGTGGG + Exonic
1160788291 19:912038-912060 GCACCTCGGGGCCCGGGGAGTGG + Intronic
1160993988 19:1873435-1873457 GGTACCCGGAGCCCGGGGGGAGG - Intergenic
1161206097 19:3042119-3042141 CCTCCCCGGGACCCGAGAAGGGG + Intronic
1161957722 19:7505900-7505922 GGTCCCCGGGCCCGGGGGGGAGG - Intronic
1162373303 19:10291396-10291418 GGACCCTGGGACCCAGGGGGCGG - Intronic
1162572015 19:11479635-11479657 GGCCCCCGGGGCCCTGGGGGCGG + Intronic
1163612262 19:18307773-18307795 GCCCCCAGGGATGCGGGGGGGGG + Intronic
1164229242 19:23273594-23273616 GCTTCTCGGGGGCCGGGGGGGGG + Intergenic
1165533177 19:36421301-36421323 GCTCCCCGGGGCCCAAGGAGAGG + Intergenic
1166131994 19:40751147-40751169 GCTCTACGCGACCCGGTGGGCGG - Exonic
1166917311 19:46204259-46204281 GATCCCAGGCACCCGGGGGCTGG - Intergenic
1168297339 19:55383841-55383863 GCTCTCCGGGAGCCGGGCGCGGG + Exonic
925917815 2:8619305-8619327 GCTCCCTGGGCCCCGGGGCGGGG - Intergenic
927714422 2:25342516-25342538 GCTCCGCGGGCTGCGGGGGGAGG - Exonic
927909586 2:26887429-26887451 GCTCCCCTGGGCCTGCGGGGAGG - Intronic
928413167 2:31070033-31070055 GCTCCATGGGACTCGGAGGGTGG - Intronic
929788563 2:45008498-45008520 GCTCCCCGGGGCCCAAGGGAGGG - Intronic
930358079 2:50346232-50346254 TCTTCCCTGGCCCCGGGGGGCGG - Intronic
933354677 2:81196742-81196764 TCTCCACGGGAACCGGGGGCAGG + Intergenic
934553719 2:95276861-95276883 GCTCTGCAGGAGCCGGGGGGTGG - Intronic
936537587 2:113324119-113324141 GCTCCTGGGGCCCCGGGTGGGGG - Intergenic
937388590 2:121461765-121461787 GCTCCCTTGAACCCGGGAGGTGG - Intronic
940265122 2:151828307-151828329 GCTTCCAGGGAACCGGAGGGAGG + Exonic
941476148 2:165953805-165953827 GCGCCCCGGGCCCCAGCGGGAGG + Exonic
941917733 2:170823306-170823328 CCTCCCTGGGTCCCGGGGCGAGG + Intronic
942360760 2:175168730-175168752 GCTCCCGGGGAGCCAAGGGGTGG - Intergenic
942360766 2:175168740-175168762 GCTCCCCGGGAGCCTGAGGCGGG + Intergenic
946249103 2:218402235-218402257 GCCCCCCGAGACCCGGGCTGAGG - Intronic
947172480 2:227325371-227325393 GCGCCCCGGGAGCCAGAGGGCGG + Exonic
947447849 2:230178193-230178215 GCTCCCCGTGACCTGTGGTGAGG - Exonic
947565301 2:231189710-231189732 GGGCCCCGGGATCCTGGGGGAGG - Intergenic
947874683 2:233460378-233460400 AGTCCCAGGGACCCTGGGGGAGG - Intronic
948131168 2:235601629-235601651 GCTCCCAGGGACCCAGTGGGAGG - Intronic
1168795899 20:610070-610092 GCGGCCCGGGCCCCGGGGGCGGG - Exonic
1169801442 20:9515947-9515969 GCTCGCCCGGCCCCGGGGCGGGG - Intronic
1171291833 20:23986746-23986768 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1172083282 20:32358855-32358877 GCTCCGTGGGGCCCGGGGTGGGG + Intronic
1172100687 20:32482987-32483009 GCGCCGCGGGTCCTGGGGGGCGG - Intronic
1172407984 20:34703761-34703783 GCTCCCCGGGAACCGGGGGTTGG + Intronic
1172618663 20:36306292-36306314 GCTCCCCGAGAGCGGCGGGGAGG - Intergenic
1172944098 20:38674563-38674585 GCGCCCCGGGGCTCTGGGGGCGG - Intergenic
1173251622 20:41366731-41366753 GGACCCCGGGACCCTCGGGGCGG - Exonic
1173460054 20:43235981-43236003 GGTCCCCAGGACACGGGGTGTGG + Intergenic
1174173831 20:48632729-48632751 GCCCCCCTGGACCTGGGGGCAGG - Intronic
1174484235 20:50851358-50851380 GGTCCCTGGGAGCCGTGGGGAGG - Intronic
1175310866 20:58010907-58010929 GCTCCCAGGGAGGCGAGGGGAGG - Intergenic
1175429354 20:58891188-58891210 GCCCCCCGGGAGCCCGGGGAGGG - Intronic
1175735922 20:61386877-61386899 GTTCCCCGGAGCCCGGGGGGAGG + Intronic
1175997297 20:62817484-62817506 GCCGCTCGGGACCCGGGAGGAGG + Intronic
1176117721 20:63440286-63440308 GCTCACCGGGACCCTTGGGGAGG - Intronic
1176546740 21:8205544-8205566 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176554635 21:8249734-8249756 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176565691 21:8388591-8388613 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176573556 21:8432759-8432781 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1179213732 21:39349115-39349137 GCGGCCGGGGACGCGGGGGGAGG - Exonic
1179810024 21:43864781-43864803 GCTCCCCCGGACCGGGTCGGGGG - Intergenic
1180082473 21:45493209-45493231 GCTCCCCGGGACCCAAGGTAAGG + Exonic
1180765568 22:18344360-18344382 GCTCCCCAGGACCCAAGGGCAGG - Intergenic
1180780748 22:18518032-18518054 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1180813461 22:18775339-18775361 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1181022801 22:20112506-20112528 GCTCCCAGGGCCCCAGGGGCGGG - Exonic
1181199643 22:21209669-21209691 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1181400116 22:22646189-22646211 GCTCCCCAGGACCCAAGGGCAGG - Intronic
1181649248 22:24249601-24249623 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1181702089 22:24627287-24627309 GCTCCCCAGGACCCAAGGGCAGG - Intronic
1181710709 22:24685997-24686019 GCTTCCAGGGAACCGGCGGGAGG - Intergenic
1183361403 22:37385010-37385032 GCCCCTTGGGACCCTGGGGGAGG - Intronic
1183362484 22:37389932-37389954 TCTCCCCAAGACCAGGGGGGTGG + Intronic
1183744680 22:39685750-39685772 GCTCCCGGTGGCCTGGGGGGAGG - Exonic
1184207435 22:43014374-43014396 CCCCCCCGGGACACGGAGGGTGG + Intronic
1184600009 22:45537853-45537875 GCTCTCCGGGACCAGCGGGGAGG + Intronic
1185011932 22:48319332-48319354 GCTCCCAGGGTTCTGGGGGGCGG - Intergenic
1185048331 22:48540281-48540303 GCTCCCCAGGACCAGGGCGGTGG + Intronic
1185222592 22:49636466-49636488 GCTGCTCCGGACCCTGGGGGAGG - Intronic
1185285896 22:49999756-49999778 GCTGACCGGGGCCCGGGGCGCGG + Intronic
1185285914 22:49999797-49999819 GCTGACCGGGGCCCGGGGCGCGG + Intronic
1203227190 22_KI270731v1_random:85250-85272 GCTCCCCAGGACCCAAGGGCAGG - Intergenic
1203251605 22_KI270733v1_random:121810-121832 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203259655 22_KI270733v1_random:166892-166914 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203263562 22_KI270734v1_random:1021-1043 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
950586281 3:13894915-13894937 GCTCTCCCGGGCCCGGCGGGAGG - Intergenic
951611277 3:24494901-24494923 GCTCCCCGGGACCCCGCCGCCGG - Intronic
954110206 3:48429330-48429352 GCTCCGCCAGACCCGGGGAGAGG - Exonic
954419364 3:50410469-50410491 GCTCCCTGGGATGGGGGGGGGGG + Intronic
954717516 3:52533893-52533915 GCGCCCCTCGGCCCGGGGGGCGG + Intronic
954912803 3:54122732-54122754 GCCCCCCGGGACGCGCGGCGCGG - Exonic
957646619 3:82939172-82939194 GCACCCCGAGACCAGGGTGGGGG - Intergenic
960682955 3:120267857-120267879 GATCGCCTGGACCCGGGAGGTGG + Intronic
966905842 3:184525547-184525569 GCTCCCCGGGGCCGGGGGCCGGG + Intronic
967858306 3:194134414-194134436 GCCGCCCGGGACCCGGGGAAGGG + Intergenic
968574324 4:1357950-1357972 GGTCCCCGGGACCTGGTGGGTGG - Intronic
968593728 4:1472199-1472221 GCCCCGCGGGACACGGGGCGCGG - Intergenic
968701473 4:2059965-2059987 GGTCCCCGGGAGCCGGGCGCGGG - Intronic
968727771 4:2256245-2256267 GGTCCCCAGGACCCTGGGGTTGG + Intronic
968898321 4:3418176-3418198 GCTCCCAGGGCGCCAGGGGGTGG + Intronic
968965257 4:3766279-3766301 GCTCCCCGTGAGCCGGGCCGAGG + Intergenic
969588319 4:8107275-8107297 GCTCCCGGGGACCGGGCAGGGGG + Intronic
969669273 4:8580791-8580813 GGTCCGGGGCACCCGGGGGGAGG - Exonic
970280662 4:14451448-14451470 AATCACCAGGACCCGGGGGGCGG - Intergenic
978189598 4:105896122-105896144 GCTTCCAGGCCCCCGGGGGGAGG + Intronic
982863423 4:160482045-160482067 GAGCCCCCGGAGCCGGGGGGAGG - Intergenic
983229102 4:165112364-165112386 GCTCCCGGAGACTCGCGGGGAGG + Intronic
986710795 5:10486717-10486739 TCTCCCCAGCACCCGGCGGGGGG - Intergenic
988577938 5:32444564-32444586 GCTGCCCGGGGCCAGGGAGGGGG + Intronic
992105844 5:73448425-73448447 GCCGCCCGGGACCCGGGCTGGGG - Intergenic
995219395 5:109630920-109630942 ACACCCCGGGGCCCGTGGGGAGG - Intergenic
997470562 5:134114876-134114898 GCGCCCCGCGCCCCGGCGGGCGG + Exonic
997963336 5:138338590-138338612 GGTCCCCGGGGCGGGGGGGGGGG - Intronic
998352274 5:141509275-141509297 GCTCCCAGGGTCCAGGGTGGAGG + Intronic
999215654 5:149932854-149932876 GCGCCCTGGGAGCCGGAGGGCGG - Intronic
1001426740 5:171627896-171627918 ACTCCCCTGGACCCTGGGGCAGG + Intergenic
1002322755 5:178385283-178385305 GCTCACTGAGACCTGGGGGGAGG - Intronic
1002322967 5:178386657-178386679 GCTCACTGAGACCCGGTGGGAGG + Intronic
1002712650 5:181204549-181204571 GGTCCCGGGGACCCACGGGGTGG + Intronic
1003098977 6:3162921-3162943 GCTGCCAGGGACTCGGGGTGGGG + Intergenic
1003425755 6:5997236-5997258 GCTGCGGGGGCCCCGGGGGGGGG - Intergenic
1003502598 6:6714705-6714727 GCTGCCTGGGACCCGGGGCTGGG + Intergenic
1003661203 6:8064165-8064187 CCAGCCCGGGACCCGGGGGTCGG + Intronic
1004426386 6:15510098-15510120 GCCCGCCTGGACCTGGGGGGCGG + Intronic
1006642918 6:35497674-35497696 GCTCCCCGGGCCCCCACGGGGGG + Intergenic
1008598397 6:53065533-53065555 GCTGCCGGGGACTCGGGGAGTGG - Intronic
1015366318 6:132401369-132401391 GCTCCCCGGGACGGCGGCGGGGG - Exonic
1015440412 6:133241203-133241225 GCCGCCAGGGACGCGGGGGGCGG - Intronic
1017011957 6:150069185-150069207 GCTCCCCTGGATCCCGGGGCGGG - Intergenic
1018628884 6:165805346-165805368 TCTCCCAGGGCCCCGGAGGGAGG + Intronic
1018733809 6:166672748-166672770 GCTCCCTGGGACACAGGGGATGG - Intronic
1018745346 6:166757583-166757605 ACTCCCCAGGTCCCGGGGGCCGG + Intronic
1020023596 7:4883506-4883528 GCTGCCGGGGACCTGGGGCGCGG - Intronic
1021311810 7:19106533-19106555 GCTGCCGGGGACTCAGGGGGAGG - Intronic
1023972358 7:45000441-45000463 GTTCCTTGGGGCCCGGGGGGGGG + Intronic
1026829601 7:73602855-73602877 CCTGCCCGGGACCCAGGGAGTGG - Intronic
1026909584 7:74084215-74084237 GCTCGCCGGGGGCCGGGGAGGGG - Intronic
1026968585 7:74454700-74454722 CCTCCCCGGGGCCGGGGCGGGGG - Intronic
1029456352 7:100674264-100674286 GCTCCCCGGGGGCAGGCGGGAGG - Intronic
1030304259 7:108003044-108003066 GCTCCCACGGAAGCGGGGGGTGG + Intronic
1031688927 7:124765079-124765101 GTTCCCCGCTACCCGGGCGGGGG - Exonic
1034448644 7:151126035-151126057 GCTTCCCGGGAGCGGGCGGGTGG + Intronic
1034976096 7:155450009-155450031 GCTCTCCGGGTCCCGGGACGTGG - Intergenic
1036772252 8:11587313-11587335 GCTCCCCGGATCCCGCTGGGGGG - Intergenic
1037526718 8:19731419-19731441 ACTCCCTGGAACCCGGGAGGTGG + Intronic
1037529205 8:19757302-19757324 GCCTCCAGGGACCCCGGGGGCGG + Intronic
1039453852 8:37695676-37695698 TCTCGCCGGGACCCCGGGGCGGG - Intergenic
1039884315 8:41646611-41646633 GCCGCCCGGGGCCCGGGGCGTGG + Exonic
1039907759 8:41798690-41798712 GCCTCCCTGGACCCTGGGGGTGG + Intronic
1040302811 8:46196720-46196742 TGTCCCCGGGACTCAGGGGGAGG + Intergenic
1040355842 8:46617520-46617542 GCTGCGCGGGACGCGGGGGTCGG + Intergenic
1041108012 8:54459725-54459747 GCTGTCCGGGGCCCGGGGGGTGG - Exonic
1042246459 8:66712968-66712990 ACTCTCCGGGAGCCGGGGGCTGG - Intronic
1045188586 8:99861882-99861904 GCTCCCCGAGAGCCTGGGCGAGG + Exonic
1048444774 8:134485190-134485212 ACTCCCCAGGACCCAGTGGGTGG - Intronic
1049000414 8:139822442-139822464 GCTCCCCAGGAGCCTGGGGCGGG - Intronic
1049298012 8:141854002-141854024 GCACCCAGGCACCCGGGGGGAGG + Intergenic
1049427382 8:142543510-142543532 GCTCCCCGGCAGCCAGGGGACGG + Intronic
1049587964 8:143440668-143440690 GCTCACTGGGACCGGGTGGGAGG - Intronic
1049762940 8:144339032-144339054 GCCCCCCGGGACCCCTGGCGGGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1051170600 9:14315452-14315474 GCGCCCCGGGCCCCGGGGGGTGG - Intronic
1051171569 9:14322707-14322729 GGCGCCCGGGACCCGGGAGGCGG + Intronic
1052218653 9:25995515-25995537 GCTCCTCGGGGGGCGGGGGGCGG - Intergenic
1052916384 9:33926934-33926956 GCTCCCCTGGCCTCGGGGGCTGG - Intronic
1053206469 9:36190732-36190754 GCTGCGCGGGCCCCGGGAGGCGG - Intergenic
1057233581 9:93340702-93340724 ACTCCCTTGAACCCGGGGGGTGG - Intronic
1057790145 9:98119207-98119229 GCTCCCCGGGACACAGGGCGGGG + Intronic
1059094601 9:111399382-111399404 GCTGCCTGGGACTCGGGGAGGGG - Intronic
1059340293 9:113594188-113594210 GCTGCCCAGGACGCGGGGTGGGG + Intronic
1059438569 9:114290235-114290257 GCTGCCAGGGCCCCGGGGCGTGG + Exonic
1060208952 9:121699002-121699024 GCCCCCCGGGCGCCGGGGCGAGG - Intronic
1060430102 9:123543673-123543695 GCTCCCCAGGAGCAGGGGGCAGG - Intronic
1060508412 9:124215239-124215261 GCCCCCAGGGACTGGGGGGGAGG - Intergenic
1060831899 9:126722578-126722600 GCTCCCCGGGAGCAGGGGAGAGG + Intergenic
1061118541 9:128629335-128629357 GCCCCCCAGGACCTGGGGGCAGG - Intronic
1061213829 9:129208811-129208833 GCTCCCAGGGACTCAGGGGGAGG - Intergenic
1061285427 9:129620039-129620061 GCCCCGCGGGGCCCGGGGGGCGG - Intronic
1061680947 9:132242151-132242173 GGTCCCGGGGTCCCGGGGCGGGG + Exonic
1061873615 9:133533373-133533395 TCTCCCCGGGACCCTCGGGCAGG - Intronic
1062162638 9:135088393-135088415 GCTCCCCCGGCCCCGCGGCGAGG - Intronic
1062247382 9:135576159-135576181 GGTCCTCAGGCCCCGGGGGGAGG - Intergenic
1062467005 9:136685976-136685998 GCTCCCCGGGACCCCGGCCTGGG + Intronic
1062567283 9:137168878-137168900 GCTCCCCGGGTCCGCGGGCGAGG + Exonic
1062696481 9:137878442-137878464 GATCCCCAGGACCCGGCGTGCGG - Intronic
1203770446 EBV:47484-47506 GCCCCCCGAGACCCGGGAGACGG + Intergenic
1203468007 Un_GL000220v1:104961-104983 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203475828 Un_GL000220v1:148933-148955 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1188310617 X:28612380-28612402 GGTCCCAGGGACCCCGGGCGGGG + Intronic
1189351639 X:40280020-40280042 GCTCCCAGGGACCCAGGGACTGG - Intergenic
1190844910 X:54182841-54182863 GCTGCCCGGGGCCCGGGTGCTGG - Exonic
1192033885 X:67544025-67544047 GCTCCCCGGGATCTCGGAGGGGG - Intronic
1192848085 X:74925833-74925855 GCTCCCGGGCGCCCGAGGGGAGG - Intergenic
1196844519 X:119887874-119887896 GCTCCCCAGGAGCCGATGGGCGG - Intergenic
1199894026 X:152115384-152115406 GGTCCCAGGCACCCTGGGGGAGG - Intergenic
1200235537 X:154466186-154466208 GCTCCACGGGCCCCGGCGGCGGG - Exonic