ID: 1077028437

View in Genome Browser
Species Human (GRCh38)
Location 11:452023-452045
Sequence GTCCTCCCGCAGCACAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077028426_1077028437 14 Left 1077028426 11:451986-452008 CCTCTCCATCAGGTGCCCTGCCA 0: 1
1: 0
2: 1
3: 13
4: 270
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028429_1077028437 -1 Left 1077028429 11:452001-452023 CCCTGCCACACCCCTTCAGGCTG 0: 1
1: 0
2: 0
3: 45
4: 490
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028423_1077028437 30 Left 1077028423 11:451970-451992 CCCTGTGGACATCAGGCCTCTCC 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028430_1077028437 -2 Left 1077028430 11:452002-452024 CCTGCCACACCCCTTCAGGCTGT 0: 1
1: 0
2: 1
3: 21
4: 273
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028424_1077028437 29 Left 1077028424 11:451971-451993 CCTGTGGACATCAGGCCTCTCCA 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028427_1077028437 9 Left 1077028427 11:451991-452013 CCATCAGGTGCCCTGCCACACCC 0: 1
1: 1
2: 3
3: 18
4: 302
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194
1077028431_1077028437 -6 Left 1077028431 11:452006-452028 CCACACCCCTTCAGGCTGTCCTC 0: 1
1: 0
2: 2
3: 42
4: 413
Right 1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077028437 Original CRISPR GTCCTCCCGCAGCACAGCTG GGG Intronic
900327198 1:2114146-2114168 GTCCTCCTGGAGAAAAGCTGGGG - Intronic
900465960 1:2825575-2825597 GTCCTACCGCAGCCCAGCTGGGG - Intergenic
900602922 1:3510751-3510773 GCCCTGCCACTGCACAGCTGGGG - Intronic
900707723 1:4090802-4090824 AGCCCCCGGCAGCACAGCTGGGG - Intergenic
900808282 1:4782086-4782108 TTCTTCCCGCAGCACAGGAGTGG + Intronic
901167382 1:7230110-7230132 GTCCCCCCCCACCACATCTGGGG + Intronic
902703671 1:18190141-18190163 CTCATCCAGCAGCACAGATGGGG - Intronic
903046935 1:20571581-20571603 ATCATCCAGCAGCACAACTGGGG - Intergenic
904032120 1:27539839-27539861 GTCCTACTGCCTCACAGCTGGGG - Intronic
904287610 1:29462252-29462274 GTTCTCCCCCAGCTCATCTGAGG + Intergenic
904534313 1:31189099-31189121 ATCCTCCAGCAGGTCAGCTGGGG - Intronic
905240074 1:36575731-36575753 GTCCTCCCCCAGCACAGGACTGG + Intergenic
907274789 1:53311148-53311170 GTCCACCCCCATCACAGCTCAGG + Intronic
909759579 1:79271213-79271235 ACCCTCCCCCAGCACAGCAGAGG + Intergenic
912159311 1:106961841-106961863 GGACTCTCCCAGCACAGCTGAGG + Intergenic
912735321 1:112145095-112145117 ATCCTCCCCCTGCCCAGCTGGGG - Intergenic
913198219 1:116475467-116475489 AGCCTCCCGCAGAACAGCTGGGG + Intergenic
915115813 1:153598807-153598829 GGCCTCCCTCAGGACTGCTGGGG - Intergenic
917738819 1:177944197-177944219 TCCCTCCCACAGGACAGCTGCGG + Intronic
919466217 1:197923325-197923347 CTCCTGCCCCAGCACAGCAGGGG - Intronic
920535465 1:206734001-206734023 GGCCTCCCCCAGCACAGATGAGG + Exonic
922079357 1:222279859-222279881 CTCCTCCAGCAGCACTGCTAAGG + Intergenic
923475525 1:234327826-234327848 ATCCTCCCACAGCACAGGAGAGG + Intergenic
1063592400 10:7407486-7407508 GGGCTCCCGCAGCACAGCCGCGG - Intronic
1063759416 10:9056665-9056687 GTGCCCCCACAGCACAGCAGTGG - Intergenic
1064327795 10:14366838-14366860 GTCCTCCAGCAGCCTGGCTGGGG - Intronic
1067064467 10:43096014-43096036 GTACTTCTGCAGCACAGCGGTGG - Intronic
1069723756 10:70564902-70564924 GCCCTCGCGGAGCACAGGTGAGG - Intronic
1070588892 10:77787600-77787622 GGCTTCCCGCAGCTCAGCTGAGG + Intergenic
1072712193 10:97723086-97723108 TTCCTTCCGCAGCACAGATGGGG + Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077074024 11:691913-691935 CTCCTTCTGCGGCACAGCTGTGG + Intronic
1077195514 11:1278004-1278026 GTCCTCCCGCATCAGACATGGGG - Intronic
1079130618 11:17744909-17744931 TTCACCCCTCAGCACAGCTGAGG + Intronic
1083952781 11:65966070-65966092 CTCCTCCTGCAGCACGCCTGGGG - Exonic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1091178060 11:133579449-133579471 GTCCTCCCCGAGCACAGCAGGGG - Intergenic
1092169404 12:6363783-6363805 GGCCTCCCGGGGCACAGATGAGG - Intronic
1094056551 12:26274522-26274544 TGCCTCCCGCAGCTCAGCTCTGG + Intronic
1102782538 12:115577830-115577852 GTCCTCCCCCAACAAAGCTTAGG + Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103440583 12:120959893-120959915 GTCATCACGCATCATAGCTGGGG + Intergenic
1103928416 12:124436324-124436346 GCCCTGCCTCAACACAGCTGAGG + Intronic
1104464863 12:128982148-128982170 TTCCTCCCGCGGCTCAGCTTCGG - Intronic
1104747285 12:131218672-131218694 GCCCTGCTTCAGCACAGCTGAGG - Intergenic
1104958548 12:132477432-132477454 CCCCTCCCCCACCACAGCTGAGG + Intergenic
1105946345 13:25193049-25193071 AGCCTCCAGCAGCACATCTGCGG - Intergenic
1105965302 13:25378156-25378178 ACCCTCCCCCACCACAGCTGGGG - Intronic
1106780603 13:33055722-33055744 GTCCTCCAGAGGCACAACTGTGG + Intronic
1107540783 13:41387057-41387079 TTCCTCCATCATCACAGCTGGGG + Intergenic
1107851492 13:44576811-44576833 GTCCTCGCGGAGCACGGCCGGGG + Intronic
1110887257 13:80655163-80655185 CTCCTCCCGCAGCCCGGCGGGGG + Intergenic
1112033206 13:95475495-95475517 GTGCTCAGTCAGCACAGCTGAGG - Intronic
1112483363 13:99797604-99797626 GTCCTCCAAGAGCTCAGCTGTGG - Intronic
1112603225 13:100877760-100877782 GTTCTGCTGCAGCACAGCTTTGG - Intergenic
1123986724 15:25652864-25652886 GTGCTCCTGCTGCACAGATGAGG - Intergenic
1125041811 15:35196454-35196476 CTCCTCCCACAAAACAGCTGAGG - Intergenic
1127489188 15:59446175-59446197 GCCCTACGGCAGCTCAGCTGGGG + Intronic
1129069690 15:72940316-72940338 GTCCTGCCCCAGCACTGCTCTGG + Intergenic
1130578609 15:85115346-85115368 GTCCTCCCACAGGACAACTCAGG - Intronic
1130724815 15:86428220-86428242 ATCCTCATGCAGCACAGCTTTGG + Intronic
1131761452 15:95627197-95627219 GTCCTTTCCCAGCCCAGCTGGGG - Intergenic
1132581719 16:687789-687811 GTGCGCCCTCAGAACAGCTGTGG + Intronic
1132897478 16:2235959-2235981 GGCCTCAGGCAGCGCAGCTGGGG - Exonic
1133235874 16:4387197-4387219 GACCACCCACAACACAGCTGGGG - Intronic
1135423617 16:22321578-22321600 GTCCTCCCGTCACACACCTGAGG + Intronic
1135435713 16:22425497-22425519 GCACTCCCGCAGGACAGCCGAGG - Intronic
1137831230 16:51545263-51545285 ACCCTCCCCCACCACAGCTGCGG - Intergenic
1138505790 16:57477700-57477722 TTTCTCCCGCGGCAGAGCTGTGG - Intronic
1141597866 16:85108196-85108218 CACCTCCCGCCGCACAGCTCTGG - Intronic
1141969667 16:87472487-87472509 GACCACCAGCAGCACCGCTGTGG + Intronic
1142044920 16:87919301-87919323 GCACTCCCGCAGGACAGCCGAGG - Intronic
1142140342 16:88469973-88469995 GTCCTCTCCCAGGACAGCTTGGG + Intronic
1145272597 17:21412734-21412756 GTCCTCCCCCAACACCGCTGTGG - Intronic
1145284818 17:21497534-21497556 GTTCTCCTGCAGCAGATCTGAGG - Intergenic
1145310806 17:21700197-21700219 GTCCTTCCCCAACACCGCTGTGG - Intronic
1145395054 17:22488038-22488060 TTCCTCCCACACCACAGCTTAGG + Intergenic
1147668423 17:42163294-42163316 GGACTCTGGCAGCACAGCTGAGG - Exonic
1150710293 17:67525492-67525514 GTAATCCCACAGCACAGCTAAGG - Intronic
1150782258 17:68133621-68133643 GGCCCTCAGCAGCACAGCTGGGG + Intergenic
1151697419 17:75724612-75724634 TTCCTCTCGCTGCACAGCTGTGG - Intronic
1152653226 17:81506285-81506307 ATCCTGGCTCAGCACAGCTGGGG - Intergenic
1153056323 18:949832-949854 CTCCCCCAGCAGCAAAGCTGTGG - Intergenic
1153723854 18:7936167-7936189 ATGCTCCCTGAGCACAGCTGCGG + Intronic
1154148505 18:11886702-11886724 GTCCTCCTGCAGGTGAGCTGGGG - Exonic
1157095584 18:44682889-44682911 CTCCTCCCCCAGCTCAGCTCAGG - Intronic
1157442987 18:47724466-47724488 GTCCTCTGCCAGCAGAGCTGTGG - Intergenic
1157557439 18:48621980-48622002 TGGCTCCTGCAGCACAGCTGTGG + Intronic
1161329532 19:3679643-3679665 GTGCTCCCCCTCCACAGCTGAGG - Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1163531310 19:17850620-17850642 TTCCTGCCGCAGGTCAGCTGTGG - Intergenic
1164459783 19:28437050-28437072 GTCCTCCCTCAGATCTGCTGAGG - Intergenic
1164600776 19:29561928-29561950 GCCCTCCTGCAGCACAGCTCAGG - Intronic
1164799917 19:31067885-31067907 GTGCTCCCGGAACACAGATGGGG + Intergenic
1165312608 19:35038029-35038051 CTCCTCCCGCAGGGAAGCTGGGG + Intronic
1166711548 19:44940890-44940912 GTCCTCATGCAGGACGGCTGAGG - Intergenic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
1168584908 19:57584240-57584262 GTCCTCCCGCTGAACAGTGGGGG + Exonic
925929089 2:8693454-8693476 ATCCTCCCGCCGCCCCGCTGCGG - Intergenic
927268284 2:21177889-21177911 GTCATCCCTCAGTACATCTGGGG - Intergenic
929609402 2:43258834-43258856 GTTCTCCTCCAGTACAGCTGAGG + Intronic
929789077 2:45010579-45010601 GTCCTCCCGCTTCGCCGCTGGGG + Intergenic
930155710 2:48105986-48106008 GTTCTTCAGCAGCAGAGCTGGGG + Intergenic
931227653 2:60347740-60347762 GTGCTCCAGCAGCCCTGCTGTGG + Intergenic
931441772 2:62295049-62295071 TTCCTCCCTGGGCACAGCTGTGG + Intergenic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
935423237 2:102892767-102892789 GCCCTCCCTCAGGACAGCCGGGG - Intergenic
935715204 2:105933320-105933342 ATCCTCCAGCAACACAGCTTTGG + Intergenic
935741235 2:106150503-106150525 TTCCTCAGCCAGCACAGCTGTGG + Intronic
937092966 2:119218671-119218693 GTGCTCACTCAGCACAGCAGGGG - Intergenic
937871799 2:126791590-126791612 CTCCACCTGCACCACAGCTGAGG + Intergenic
938117036 2:128609101-128609123 TTCCTCCATCAGCAAAGCTGGGG - Intergenic
945985371 2:216349531-216349553 GTGCTGCAGAAGCACAGCTGGGG + Intronic
947760379 2:232599731-232599753 TACCACCCACAGCACAGCTGAGG + Intergenic
948915743 2:241034370-241034392 GTCCTCCGGCAGCTCACCTCTGG - Intronic
1169135159 20:3192785-3192807 GTCCTCCCCCAGCTCATTTGCGG - Intronic
1169695811 20:8385525-8385547 GGCCACCAGCACCACAGCTGTGG - Intronic
1170620357 20:17990532-17990554 GTCCTCCCTGCACACAGCTGGGG - Exonic
1170955631 20:20977184-20977206 GTCCTTCCACAGCTCAGCTCAGG + Intergenic
1171200951 20:23241797-23241819 GTTCTCCCCCAGCTCTGCTGAGG - Intergenic
1172095409 20:32457755-32457777 ATCCTCCCGCAGGGCAGCTCCGG + Intronic
1172664149 20:36587499-36587521 GTACTCCTGCAGCACAGGTATGG + Intronic
1172971534 20:38876388-38876410 AGGCTCCAGCAGCACAGCTGAGG - Intronic
1174453754 20:50635830-50635852 TTGCTCCCGCAGCTCTGCTGAGG + Intronic
1175869973 20:62204515-62204537 CTCCTGCCGCAGCCCAGGTGGGG + Intergenic
1176187809 20:63790923-63790945 GGCCTCCCGCTGCACACCTGTGG - Exonic
1176521824 21:7830047-7830069 CTCGTCCCGCACCCCAGCTGTGG + Intergenic
1177369447 21:20182344-20182366 CCCCTCCTGCACCACAGCTGAGG - Intergenic
1178655844 21:34460059-34460081 CTCGTCCCGCACCCCAGCTGTGG + Intergenic
1178734455 21:35136500-35136522 GTCCTCCCACAGCCCAAGTGGGG - Intronic
1179999995 21:44991231-44991253 GACTTGCCCCAGCACAGCTGTGG - Intergenic
1181464537 22:23103796-23103818 TTCCTCCCTCAGGTCAGCTGGGG + Intronic
1181467662 22:23118800-23118822 GTCCTGCTGCAGCCCACCTGTGG - Intronic
1185142121 22:49108352-49108374 CTCCTCCCTCAGCAGAGCTGGGG + Intergenic
1185173317 22:49305672-49305694 GTCCTCCCCCACCTCACCTGGGG - Intergenic
950007119 3:9698522-9698544 GCCCTCAGGCACCACAGCTGAGG - Intronic
950364305 3:12472114-12472136 GTCCTCCCGGGGGCCAGCTGTGG + Intergenic
950565674 3:13768298-13768320 CCCCTCCCCCAGCCCAGCTGGGG - Intergenic
952511134 3:34057319-34057341 CTCCACCTGCACCACAGCTGAGG - Intergenic
952964086 3:38610427-38610449 GTCCTCCTGCCCCACTGCTGGGG + Intronic
953136725 3:40188336-40188358 GTCCTACTGCAGCAGGGCTGTGG + Intronic
953735601 3:45491683-45491705 GTCCTCCAGGGGCACAGGTGTGG - Exonic
954320551 3:49829616-49829638 GTCCTCTTGCAGCAAAGATGTGG - Exonic
954471058 3:50695678-50695700 TTCCTCTCTCAGAACAGCTGAGG - Intronic
960011857 3:112842224-112842246 GACTTCCCGCAACACTGCTGTGG - Intronic
962588216 3:136862814-136862836 GTCCACCCGCAGCACCGCGCAGG - Intronic
964077225 3:152706340-152706362 GTTCTCCAGAAACACAGCTGAGG - Intergenic
965133569 3:164732711-164732733 GTCCTCCCTTAGCACACATGGGG - Intergenic
966659494 3:182398583-182398605 CTCCTCCTGCAGCAAAGCTCAGG + Intergenic
968575596 4:1364677-1364699 CTGTTCCCACAGCACAGCTGAGG - Intronic
968782353 4:2592784-2592806 GTTCTCCCCAAGCCCAGCTGAGG + Intronic
968867672 4:3224201-3224223 GTCTTCCCGCATCACTGGTGTGG - Intronic
969254216 4:5991567-5991589 GGCCTCCTTCAGCCCAGCTGGGG - Intergenic
969619738 4:8273060-8273082 GGCCTCCAGCAGCACATCTGTGG - Intronic
982728260 4:158928114-158928136 CTCCACCTGCAGCACAGGTGTGG + Intronic
986683982 5:10259777-10259799 GTGGCCCCCCAGCACAGCTGAGG - Intronic
986708106 5:10468068-10468090 TCCCTCCCCCAGCACAGTTGGGG + Intronic
987399879 5:17464003-17464025 GTCAACCAGCAACACAGCTGAGG - Intergenic
999252875 5:150192908-150192930 TTCCTCCCGGAGCTCACCTGGGG + Intronic
999263536 5:150252016-150252038 GTCCTTCCGCAGCACTTCTGGGG + Exonic
1002473484 5:179451322-179451344 GTCCTCTGGAAGCTCAGCTGTGG - Intergenic
1005292317 6:24391971-24391993 ATCCTCCCACATCAAAGCTGAGG + Intergenic
1006862698 6:37183512-37183534 TTCCTCCCACAGCACTGCTGAGG - Intergenic
1007091990 6:39190377-39190399 GCCCGCCCGCATCCCAGCTGTGG - Exonic
1008920904 6:56843583-56843605 GTCCTCCCGCACCGCTGCCGCGG - Intronic
1011502501 6:88006698-88006720 GTCTTCCCTCAGCAGGGCTGCGG + Intergenic
1012944698 6:105452890-105452912 CTCCTCCCGCACCCCACCTGTGG + Intergenic
1015391166 6:132683741-132683763 GTCCTCCCACACCCCAGCAGTGG + Intronic
1018062880 6:160104336-160104358 GTGATCCCCCAGCGCAGCTGGGG - Intronic
1018721287 6:166574450-166574472 GACCTCCAGCTGCACAGATGTGG + Intronic
1019151747 6:170011022-170011044 AACCTCCGGCAGCACATCTGTGG + Intergenic
1019807648 7:3140023-3140045 GCCCTCCCGGAGCAGAGCAGGGG + Intergenic
1021946853 7:25736196-25736218 GTTTTCCCACAGCACAGCAGTGG - Intergenic
1023948581 7:44823134-44823156 GTCCTGCACCAACACAGCTGAGG - Intronic
1025610566 7:63072727-63072749 TTCCTCACACAGCACAGATGAGG - Intergenic
1027578834 7:79966799-79966821 TTCCTACCTCAGCACACCTGAGG - Intergenic
1028245619 7:88473353-88473375 CTCCACTTGCAGCACAGCTGAGG + Intergenic
1030759313 7:113331589-113331611 GGCAACCAGCAGCACAGCTGTGG + Intergenic
1034401917 7:150867712-150867734 CTCCTCCCACACCACAGCAGAGG - Intergenic
1034450949 7:151137079-151137101 GTCTCCCAGCAGCAGAGCTGTGG + Intronic
1034538933 7:151743867-151743889 GGCCTCCCGCAGCCCAGCCCTGG - Intronic
1034897715 7:154888058-154888080 CTCCCCCAGCAGCACAGCTCTGG - Intronic
1035443430 7:158922698-158922720 CTGCACCCACAGCACAGCTGAGG - Intronic
1035637486 8:1157262-1157284 GTCCTCTCGTGGCACAGATGCGG + Intergenic
1036313109 8:7699207-7699229 GGCCTCCCCCTCCACAGCTGTGG + Intergenic
1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG + Intronic
1037813452 8:22099766-22099788 GGCCTCCCGCAGCAGCGCAGGGG - Exonic
1038012051 8:23483122-23483144 CACTTCCCGCAGCACAGCAGCGG + Intergenic
1041208291 8:55521083-55521105 GGCCTCCTTCAGCACAGCTGGGG - Intronic
1045501956 8:102750156-102750178 GTCCTGCAGGAGCTCAGCTGAGG - Intergenic
1047765840 8:127989349-127989371 GACCTCCTGCAGCACAGCTTGGG + Intergenic
1048329177 8:133460708-133460730 GGGCTCCCGCAGCACAGAGGAGG + Intronic
1049406876 8:142455536-142455558 GTCCCGGCCCAGCACAGCTGAGG + Intronic
1049659271 8:143812495-143812517 GTCCTCCCGAAGTACGGCGGCGG - Intronic
1054259294 9:62845502-62845524 TTTCTCCCTCAGCACAGCTCAGG + Intergenic
1054332483 9:63774535-63774557 TTTCTCCCTCAGCACAGCTCAGG - Intergenic
1055462125 9:76528958-76528980 GGGCCCCCACAGCACAGCTGCGG + Intergenic
1056519084 9:87383529-87383551 GTCCTCCGGAAGAACAGATGGGG - Intergenic
1057904018 9:98970558-98970580 GCCCTTCCACATCACAGCTGTGG - Intronic
1058627444 9:106949883-106949905 GTCCTCCAGCTGCCCACCTGTGG + Intronic
1060348969 9:122840761-122840783 GTCATCTCACAGCCCAGCTGGGG - Intergenic
1060518327 9:124279629-124279651 GTCCTCCCACTGCACAGGTGGGG - Intronic
1060896002 9:127218095-127218117 ATCCTCCCACAGCAGTGCTGAGG + Intronic
1060896007 9:127218101-127218123 CTCCTCCCTCAGCACTGCTGTGG - Intronic
1061186913 9:129060217-129060239 GTCCTCCCCCTGCAGAGCTTGGG + Intronic
1061884838 9:133586261-133586283 TTCCCCCCGCAGCTGAGCTGGGG - Intergenic
1062337752 9:136079872-136079894 CTCCTTCCACAGCACGGCTGTGG - Intronic
1062386075 9:136312004-136312026 GTGCTCCCGAAGAACAGCAGGGG + Intergenic
1062432118 9:136530856-136530878 GCCCTCCAGCAGCGCTGCTGTGG - Intronic
1203698455 Un_GL000214v1:117166-117188 GGCTTCCCGCTGCACAGCTGTGG + Intergenic
1203699373 Un_GL000214v1:123317-123339 GGGTTCCCGCTGCACAGCTGTGG + Intergenic
1203700317 Un_GL000214v1:129600-129622 GGGTTCCCGCTGCACAGCTGTGG + Intergenic
1203548565 Un_KI270743v1:150560-150582 GGGGTCCCGCTGCACAGCTGTGG + Intergenic
1203569664 Un_KI270744v1:119554-119576 GGGTTCCCGCTGCACAGCTGTGG + Intergenic
1185449608 X:275387-275409 TTCCTCCCTCACCCCAGCTGTGG - Intergenic
1186448387 X:9651993-9652015 GTCCAGGCACAGCACAGCTGGGG + Intronic
1188736637 X:33725999-33726021 GTTTTCCTTCAGCACAGCTGAGG + Intergenic
1189195309 X:39147580-39147602 GTCCTCCCGAAGCAGAGCATAGG + Intergenic
1199679405 X:150214964-150214986 GCCCTGCCACAGCACAGATGTGG - Intergenic
1199695822 X:150342085-150342107 GCCCTGCCACAGCACAGATGTGG + Intergenic
1200246721 X:154530447-154530469 TTCCACCCGCAGCACAGGTGAGG - Intergenic