ID: 1077031149

View in Genome Browser
Species Human (GRCh38)
Location 11:468412-468434
Sequence CTCGTGTTGTCCAGTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077031149_1077031155 20 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031155 11:468455-468477 AACATTCATTGAGGAGATGGGGG 0: 1
1: 0
2: 1
3: 19
4: 274
1077031149_1077031156 26 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031156 11:468461-468483 CATTGAGGAGATGGGGGTCCCGG 0: 1
1: 0
2: 0
3: 31
4: 243
1077031149_1077031158 30 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031158 11:468465-468487 GAGGAGATGGGGGTCCCGGCGGG 0: 1
1: 0
2: 5
3: 35
4: 362
1077031149_1077031154 19 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031154 11:468454-468476 AAACATTCATTGAGGAGATGGGG 0: 1
1: 0
2: 3
3: 22
4: 370
1077031149_1077031151 11 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031151 11:468446-468468 CAGATTTTAAACATTCATTGAGG 0: 1
1: 0
2: 0
3: 58
4: 432
1077031149_1077031152 17 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031152 11:468452-468474 TTAAACATTCATTGAGGAGATGG 0: 1
1: 0
2: 3
3: 33
4: 367
1077031149_1077031157 29 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031157 11:468464-468486 TGAGGAGATGGGGGTCCCGGCGG 0: 1
1: 0
2: 1
3: 30
4: 334
1077031149_1077031153 18 Left 1077031149 11:468412-468434 CCTGTAGAACTGGACAACACGAG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1077031153 11:468453-468475 TAAACATTCATTGAGGAGATGGG 0: 1
1: 0
2: 0
3: 22
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077031149 Original CRISPR CTCGTGTTGTCCAGTTCTAC AGG (reversed) Intronic