ID: 1077031237

View in Genome Browser
Species Human (GRCh38)
Location 11:468896-468918
Sequence CTGGGTAATCGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077031237 Original CRISPR CTGGGTAATCGGAGGGAGGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901771164 1:11531053-11531075 CTGGTTCCTCCGAGGGAGGATGG + Intronic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
910197633 1:84660290-84660312 CTGAGTAATGGGGGTGAGGAGGG + Intronic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
916982181 1:170150165-170150187 CTAGGCAGTTGGAGGGAGGAAGG - Intronic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921819097 1:219596208-219596230 GTGGGTACTCGGAGGCAGGCAGG - Intergenic
921819777 1:219604163-219604185 GTGGGTACTCGGAGGCAGGCAGG + Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1071494336 10:86157430-86157452 CTGGGTACTCGGAGGGCTCAAGG + Intronic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073347549 10:102795434-102795456 CTGGGAAAGCGGAGGCAGAACGG + Intronic
1075341264 10:121648436-121648458 CTAGGTAGTAGGAGGCAGGAAGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077031244 11:468925-468947 CTGGGTAATCGGAGAAAGAGGGG + Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090406484 11:126478833-126478855 GTGAGTAGTGGGAGGGAGGAGGG + Intronic
1090786865 11:130056996-130057018 CTTGGTAGTCGGAGGCAGGAGGG + Intergenic
1091290207 11:134435264-134435286 CTGGGTGATGGGAGAGAGCAGGG + Intergenic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1096668048 12:53180411-53180433 CTGGGTGCTCGATGGGAGGAGGG - Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1102312547 12:111858004-111858026 CTGGGTAGGCTGAGGTAGGAGGG - Intronic
1102649020 12:114423737-114423759 CTGGGTAATGAGAGCTAGGAAGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1108094377 13:46885291-46885313 CTGGGTAATACGAGGCAGGATGG + Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110512910 13:76374098-76374120 TTGGGTGATCGGACGGATGAGGG + Intergenic
1111417582 13:87969039-87969061 CTGGGTAATTTCAGGCAGGAGGG + Intergenic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112462582 13:99615776-99615798 CTGGTTTATGGTAGGGAGGATGG - Intronic
1114444828 14:22780411-22780433 ATGGGGAATGGGAGGTAGGAGGG - Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114602653 14:23969158-23969180 CTGGGGAATCTGAGGGGTGATGG + Exonic
1114607021 14:24006287-24006309 CTGGGGAATCTGAGGGGTGATGG + Exonic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1120509586 14:85397264-85397286 CTTGGCAATGTGAGGGAGGAGGG - Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129220333 15:74128591-74128613 CTGGGTAATGGAAGGGAGAATGG - Exonic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130655358 15:85788786-85788808 CTTGGAAATCTGAGGGAGAAAGG - Intronic
1132853957 16:2036563-2036585 CTGGGTCCTTGCAGGGAGGAGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134095034 16:11413406-11413428 CTGGGTAATCTGAAACAGGAGGG + Intronic
1134534081 16:15011285-15011307 CTGAGTAATTCGAGGGAGAAAGG + Intronic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137539243 16:49350621-49350643 CTGGGGAGTCGGAGGAGGGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1139861955 16:70029442-70029464 CTGAGTAATTCGAGGGAGAAAGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1143714251 17:8755786-8755808 CCGGGAAGTCGGAGGGAGGGAGG + Intronic
1145063042 17:19744448-19744470 GAGGGTAGTCGGTGGGAGGATGG + Intronic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145886488 17:28385467-28385489 GTGGGTAGGCGGTGGGAGGAAGG + Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146787394 17:35731875-35731897 CCGGGTAAGCGGCGGGAGGAGGG + Exonic
1147308308 17:39578657-39578679 GTGGGAAGTCGGAGAGAGGAAGG + Intergenic
1148612444 17:48973370-48973392 CTGCCTAATCCGTGGGAGGAGGG + Intergenic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151393527 17:73803941-73803963 ATGGGGAATGGGAGGGAGAAAGG - Intergenic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1152334000 17:79690095-79690117 CGGGGTCGTGGGAGGGAGGAAGG - Intergenic
1152520959 17:80856625-80856647 CTGAGTCATCGGAGGAAGGCTGG + Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1203159869 17_GL000205v2_random:39285-39307 GTGGGGAAGCGGAGGGACGAGGG - Intergenic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1155474580 18:26225448-26225470 CTCGGGAATCTGAGGTAGGAGGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1160104836 18:75964164-75964186 CTAGGCCATCGGTGGGAGGAAGG - Intergenic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162788684 19:13051985-13052007 GTGGGTAATCGGCAGGAGGGAGG - Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166588225 19:43969851-43969873 CTGGGCAATCTGGGTGAGGAAGG + Intronic
1166944566 19:46388955-46388977 CTGGGCAATCAGTGGGAGAAAGG - Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167583510 19:50359976-50359998 CGGGGTAATGGGATGCAGGAAGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168606592 19:57765149-57765171 CTGAGTAATCGTAAGGAGCATGG - Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
937098513 2:119250990-119251012 GTGGGTGGTCGGAGGGAGGCAGG + Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
939093468 2:137805288-137805310 TGGGGTAGTGGGAGGGAGGAGGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
942371729 2:175293090-175293112 ATGGATCATCCGAGGGAGGAAGG + Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
945045074 2:205774708-205774730 CTGGGGAATAGGTGGGAGGTGGG - Intronic
945874404 2:215263372-215263394 AAGGGTAATCGGAGGTGGGAAGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1170488985 20:16851917-16851939 CTGGGGACTCGGGGGAAGGATGG - Intergenic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172100257 20:32480983-32481005 CTGGGAAATATGAGGCAGGAAGG + Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1178396895 21:32250729-32250751 CTGGGAAATAGGTGAGAGGAGGG - Intergenic
1178981356 21:37267619-37267641 CCGGGTTAGCGGAGGGAGGGAGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181877122 22:25948333-25948355 ATGGGTAAGCGGTGGTAGGATGG - Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
1184509737 22:44926432-44926454 CTGGGGCATCTGAGTGAGGACGG - Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
963136767 3:141912799-141912821 CTTGGTAATGGGAGGGAAGAGGG - Intronic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
969783775 4:9435248-9435270 TGGGGTAATGGGAGGGGGGAGGG - Intergenic
972703310 4:41515281-41515303 CTGGGGACGCGGAGGAAGGAAGG - Intronic
976126454 4:81838276-81838298 CTGGATGATAGCAGGGAGGAGGG + Intronic
976294552 4:83456421-83456443 CTGGATAATCTTAGTGAGGAAGG + Intronic
977082040 4:92542616-92542638 CTGGGGACTCGGTGGGAGGGTGG + Intronic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
979548030 4:121959149-121959171 CTGGCTAATGGGAGGTAGGAAGG - Intergenic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
995127253 5:108590581-108590603 CAGGGTAATGGCAGGGAGAATGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
998023921 5:138796648-138796670 CTGGGAAATCAGTGGGAGAAGGG + Intronic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006670170 6:35725490-35725512 CTGGGTGATGGGAGAGAGAAAGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008378997 6:50821802-50821824 GTAGGCAAGCGGAGGGAGGAAGG + Intronic
1009566569 6:65318457-65318479 GTGGGTACTCGGAGGCAGGCAGG + Intronic
1011153650 6:84303940-84303962 GTGGGAAGTTGGAGGGAGGAGGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1013450101 6:110272113-110272135 CGGGGGAATGGGTGGGAGGAGGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1028350213 7:89837684-89837706 ATGAGTCATTGGAGGGAGGAAGG - Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032078024 7:128845304-128845326 CTGGGTAGTCCGTGGGAGGGAGG + Intronic
1033193289 7:139303550-139303572 ATGGGTAATCTGAGGCACGAAGG - Exonic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1040033945 8:42850763-42850785 TTGGGTAGTCTGAGTGAGGAGGG + Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041040440 8:53841274-53841296 TTGGGCTAACGGAGGGAGGAAGG - Intronic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057474269 9:95385385-95385407 CTGGGTATTGGGAGTGATGACGG - Intergenic
1057861330 9:98643159-98643181 CTGGGCACTCGGAGGGGAGAGGG + Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1185518074 X:715657-715679 CTGGGTCCTCCCAGGGAGGAGGG - Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1187490740 X:19748822-19748844 CTGGGTAATTGGGTGGATGATGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188937422 X:36193757-36193779 CTGGTTAATAGGAGAAAGGAGGG - Intergenic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1197404235 X:126029916-126029938 ATTGGTAATCAGTGGGAGGATGG + Intergenic
1197885163 X:131210692-131210714 CTGGGTCATCCGTGAGAGGAAGG - Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198670495 X:139075200-139075222 CTGGGTAATGGGAGAGAATAGGG - Intronic
1199608753 X:149596357-149596379 CGGGGTAGTGGGAGGAAGGAGGG - Intergenic
1199630369 X:149773003-149773025 CGGGGTAGTGGGAGGAAGGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic