ID: 1077032598

View in Genome Browser
Species Human (GRCh38)
Location 11:476233-476255
Sequence GGTCTTGCCTCCAAGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077032591_1077032598 -2 Left 1077032591 11:476212-476234 CCCAGCCGGCTGAGCACAGACGG 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032593_1077032598 -3 Left 1077032593 11:476213-476235 CCAGCCGGCTGAGCACAGACGGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032594_1077032598 -7 Left 1077032594 11:476217-476239 CCGGCTGAGCACAGACGGTCTTG 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032590_1077032598 6 Left 1077032590 11:476204-476226 CCTGTCTGCCCAGCCGGCTGAGC 0: 1
1: 0
2: 0
3: 19
4: 266
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032589_1077032598 7 Left 1077032589 11:476203-476225 CCCTGTCTGCCCAGCCGGCTGAG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032587_1077032598 13 Left 1077032587 11:476197-476219 CCAGGGCCCTGTCTGCCCAGCCG 0: 1
1: 0
2: 1
3: 47
4: 473
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138
1077032586_1077032598 14 Left 1077032586 11:476196-476218 CCCAGGGCCCTGTCTGCCCAGCC 0: 1
1: 2
2: 6
3: 73
4: 569
Right 1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077032598 Original CRISPR GGTCTTGCCTCCAAGGGGTT TGG Intronic
900714379 1:4134533-4134555 GGTCTTGCCTGGAAGTGTTTGGG - Intergenic
900781118 1:4617684-4617706 GGGCTGGCCTCCCAGGGGCTCGG - Intergenic
904267072 1:29324339-29324361 GGTCTGGCCCCCAGGGGTTTTGG + Intronic
904967189 1:34384278-34384300 CGTCTTTCATCTAAGGGGTTGGG + Intergenic
907947829 1:59151769-59151791 CGGCTAGCCTCCAAGGGATTTGG + Intergenic
914812111 1:151036596-151036618 GCTCTTGCCTCCAAGGAGGGAGG - Exonic
922858229 1:228793336-228793358 GCTCTTGACTCCAAGGCCTTCGG + Intergenic
1062769219 10:86234-86256 GGTCCAGCCTGCAAGGGGCTGGG + Intergenic
1063607378 10:7534572-7534594 GGCCCTCCCTCCAAGGCGTTTGG - Intergenic
1064575584 10:16742837-16742859 GTTATTGCCTTAAAGGGGTTGGG - Intronic
1066390596 10:34974807-34974829 GGTCTTGCCTCCCAGGTTTCAGG - Intergenic
1075101783 10:119511202-119511224 GGCTTTGCCTCCAAAGGGCTGGG + Intronic
1075633485 10:124015423-124015445 GGTCCTGGCTCCAAGGGTATTGG - Intronic
1076254838 10:129013850-129013872 GCTTTTTCCTCCAAGGGGCTGGG - Intergenic
1076802016 10:132835236-132835258 GGTCCTGGCTCCCAGGGGTGGGG + Intronic
1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG + Intronic
1077390387 11:2298288-2298310 GGTCTGGCCTGAAAGGGGATGGG + Intronic
1077445921 11:2590796-2590818 GGTCCAGCCTCCAAGGGACTGGG - Intronic
1077995688 11:7450273-7450295 GGTCTTGACTCCAATGACTTAGG + Intronic
1078058046 11:8023305-8023327 GCTCCTGCCTCCAAGAGGTAAGG - Intronic
1080399681 11:31922324-31922346 GGTGCTGACTCCCAGGGGTTGGG + Intronic
1084244547 11:67847818-67847840 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1084828135 11:71746738-71746760 GGTCTTGCCTCCCAGGTTTCAGG - Intergenic
1090011599 11:123050325-123050347 GGTCTTGCCAAGAAGGGCTTCGG - Intergenic
1090353522 11:126123367-126123389 AGTCTTGCCTCCTAGAAGTTTGG - Intergenic
1091389367 12:116668-116690 GGAAGTGCCTCCAAGGGGATTGG - Intronic
1091882382 12:3990400-3990422 GGCCTTGCATCAAAGGGGGTTGG - Intergenic
1092415110 12:8284967-8284989 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1100149414 12:91717554-91717576 AGCCTAGTCTCCAAGGGGTTAGG - Intergenic
1102502020 12:113359254-113359276 GGGCTGGCCTCCATGGGGTGAGG - Intronic
1104457624 12:128928517-128928539 CGTCTTTACTCCAAGCGGTTTGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119365001 14:74084230-74084252 GGTCTGGCCAAAAAGGGGTTGGG + Intronic
1120142687 14:80945977-80945999 GGACTTGAATCCAAGTGGTTTGG - Intronic
1121482988 14:94292717-94292739 GGCCTAGACTCCAAAGGGTTGGG - Intronic
1121528531 14:94637124-94637146 GTTCTTGCCTCCAAGGAGCTTGG - Intergenic
1122824056 14:104361097-104361119 GATCTGGCCTCCAAGCGGTGGGG + Intergenic
1123106887 14:105845944-105845966 GGTCTTCCCTCCAGAGGCTTTGG + Intergenic
1125607880 15:40952600-40952622 AGTCTTGCCCCCAAGGCGATGGG - Intergenic
1126973212 15:54142661-54142683 GCTCTTGACTCCAAAGAGTTTGG + Intronic
1128578430 15:68791802-68791824 GGTCTTTCCCCCATGTGGTTTGG - Intronic
1128867564 15:71126055-71126077 GGTCTTGCAGCCAAGGGCATGGG + Intronic
1129035108 15:72644386-72644408 CATCTTGGCGCCAAGGGGTTGGG + Intergenic
1129214774 15:74092830-74092852 CATCTTGGCGCCAAGGGGTTGGG - Intergenic
1132394806 15:101464749-101464771 GGTCTCCTCACCAAGGGGTTAGG + Intronic
1132458326 16:36480-36502 GGTCCAGCCTGCAAGGGGCTGGG + Intergenic
1132463327 16:66305-66327 GGGCTTTCCTCCAAGCAGTTGGG - Intronic
1136394293 16:29984574-29984596 GGTCTTGACTGCCAGGGGCTTGG + Intronic
1138681296 16:58685128-58685150 GGTCTTTCCTGCAAGGGAGTGGG + Intergenic
1141759745 16:86020285-86020307 GGTTTCTCCTCCAAGGGCTTTGG + Intergenic
1145268509 17:21392001-21392023 CGTCTTGCCTCCTAGGGCTGTGG + Intronic
1145864654 17:28233172-28233194 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1146279201 17:31534099-31534121 GGACCTGCCACCAAGGGGTCTGG - Exonic
1149655364 17:58306960-58306982 GGTTTTGCCTCCAGGTGTTTGGG - Exonic
1151560249 17:74866067-74866089 GGTCTGGCATCCAAGGGCTGAGG + Intronic
1151955549 17:77378457-77378479 GGTCCTGCCTCCTACGGGTGTGG + Intronic
1152523173 17:80872418-80872440 GGTCTGGCTTCCATGGGGGTGGG - Intronic
1152962292 18:87036-87058 GGTCCAGCCTGCAAGGGGCTGGG + Intergenic
1156466168 18:37348932-37348954 TCTCATGCCTCCAGGGGGTTTGG + Intronic
1160475461 18:79181432-79181454 GGTCATGTCTCAGAGGGGTTTGG - Intronic
1161908614 19:7176052-7176074 GGTCCTGCCTCCATGGGATATGG - Intronic
1162962737 19:14137396-14137418 GCTCTCGCCCCCGAGGGGTTCGG + Intergenic
1162962747 19:14137424-14137446 GCTCTCGCCCCCGAGGGGTTCGG + Intergenic
1162962757 19:14137452-14137474 GCTCTCGCCCCCGAGGGGTTTGG + Intergenic
1163273262 19:16266895-16266917 GGTCTTGCAGCCCAGGGGTCAGG + Intergenic
1163966181 19:20749490-20749512 GGTCTTGCCTCCCAGGTTTCAGG + Intronic
1164674592 19:30092951-30092973 TGTCTTGGCTCCCAGGGGTTAGG - Intergenic
928786070 2:34887750-34887772 AGTCCTGCCTTCAAGGCGTTGGG + Intergenic
930019687 2:46994063-46994085 GGGCTGGGCTCCAAGGGGTCAGG + Intronic
935807360 2:106762232-106762254 GGACTTGTGTCCAAGGTGTTCGG - Intergenic
943900761 2:193432716-193432738 GCTATTTCCTCCAAGGGGTGGGG - Intergenic
944446663 2:199798710-199798732 TGTCTTGTCACCAAGTGGTTTGG - Intronic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
946023745 2:216659467-216659489 TGCCGTGTCTCCAAGGGGTTGGG + Intronic
947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG + Intronic
948780839 2:240320667-240320689 AGTCCGGCCTCCAAGGGGGTTGG + Intergenic
949028775 2:241778496-241778518 GGTGTTGCCTCCCTGGGGTGTGG + Intronic
1171408709 20:24931496-24931518 GGTCTTGCCTCCCAGGATTCAGG - Intergenic
1172049147 20:32103082-32103104 GGTTTTGCCTCCAAGGAGATGGG + Intergenic
1172215702 20:33234168-33234190 GGTGGTGCCCCCAAGGGTTTGGG - Intergenic
1175220619 20:57414522-57414544 GGTCCTGCCTCCCAGGGCTGTGG + Intergenic
1175237345 20:57524321-57524343 GGTCTGGCCTCAAAAGGTTTTGG + Intronic
1179676302 21:42984935-42984957 GTCCTTGCCTCCAAGGGTTAGGG + Intronic
1180608932 22:17083490-17083512 GGTCGTGACTCCCAGGGGGTGGG + Intergenic
1182549731 22:31094230-31094252 GGCCTTGTCTTCAAGGGGCTAGG + Intronic
1182794596 22:32981885-32981907 GGTTTTGCCTTCAAAGGGTAGGG - Intronic
954901113 3:54020925-54020947 GGTCTTGCCTCCACTGGGCCTGG - Intergenic
955240007 3:57169882-57169904 AGTCTTGGCTCCAATGGGGTAGG + Intronic
955346289 3:58164489-58164511 AGACTTGCCTCCCAGGGGTGAGG + Intronic
961892662 3:130143578-130143600 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
962748775 3:138417665-138417687 GGTCCTGCTTCCCAGGTGTTGGG - Intergenic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
969750104 4:9103564-9103586 GGTCTTGCCTCCCAGGTTTCAGG - Intergenic
974907650 4:68077653-68077675 GTTCTTGCCTACAAAGGATTGGG + Intronic
976963304 4:91004916-91004938 GGTCTTGCCTCTAAGACCTTGGG + Intronic
979732871 4:124045640-124045662 GGTCATGCCACCAAGGCCTTGGG - Intergenic
990873982 5:60463745-60463767 GGCCTTGTCTCCATGGTGTTGGG - Intronic
995458361 5:112375923-112375945 GTCTGTGCCTCCAAGGGGTTAGG + Intronic
995479778 5:112582455-112582477 GGTCTGGTCCCCGAGGGGTTTGG + Intergenic
1000952853 5:167505716-167505738 GGCTTTGCCTCCATGGAGTTAGG + Intronic
1001776935 5:174336188-174336210 GTTTTTGGCTCCAAGGGGCTAGG - Intergenic
1004295674 6:14407814-14407836 GGTCTTGCTTTCAAATGGTTTGG + Intergenic
1004929434 6:20447571-20447593 GATCTAGCCTCTAAGGGGTAAGG + Intronic
1005356792 6:24992024-24992046 TGTCTTGCCCCCTAGGGCTTTGG - Intronic
1006475402 6:34249417-34249439 GGTCTTGCCGCGAAGGGCCTGGG - Exonic
1008860592 6:56144766-56144788 TGTGTTGCCTCCCAGGGTTTGGG - Intronic
1010413743 6:75590015-75590037 GGTCATGACACCAAGTGGTTTGG + Intergenic
1015419768 6:132993634-132993656 GTACTTACCTTCAAGGGGTTCGG - Intergenic
1016299220 6:142611342-142611364 GGTATGGCCTCTAAGAGGTTTGG - Intergenic
1016724462 6:147346377-147346399 GGTCTTGCCATCAAGGAGGTTGG + Intronic
1018329754 6:162714490-162714512 GGTTTTCCCTCCAAGGCTTTTGG + Intronic
1018674534 6:166207442-166207464 GGTCTTTCCTGTTAGGGGTTAGG + Intergenic
1019807746 7:3140952-3140974 GGTCTGGCCTCCAAAGGCCTGGG - Exonic
1020322876 7:6953078-6953100 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1021849179 7:24791082-24791104 GGTCTTGCCTCCCAGGTCTCAGG + Intergenic
1022092986 7:27119815-27119837 GGACTTGCTTCCAGGGGATTAGG - Intronic
1022262714 7:28721753-28721775 GGCATTGCCTTCAAGGAGTTCGG + Intronic
1032281629 7:130507677-130507699 GGTCTCACCTTCAAGGGTTTTGG + Exonic
1035359367 7:158300270-158300292 GGCCTTGACTCCAAGGGCTAGGG - Intronic
1035890007 8:3332991-3333013 GGTCTGGCCTCCATGAGGTGAGG + Intronic
1036373183 8:8177904-8177926 GGTCTTGCCTCCCAGGTTTCCGG - Intergenic
1036877721 8:12487737-12487759 GGTCTTGCCTCCCAGGTTTCCGG + Intergenic
1040667665 8:49652986-49653008 GGTCTTGCCCCAAGGGGTTTAGG - Intergenic
1040796625 8:51295247-51295269 GGTCTTGCCTCAAAGGTTTAAGG - Intergenic
1040878503 8:52177520-52177542 GCTCTTTCCTCCTAGGGGGTGGG + Intronic
1048957176 8:139546817-139546839 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1049765346 8:144352792-144352814 CCGCTTGCCTCCAAGGGGGTGGG - Intronic
1050929294 9:11303490-11303512 AGCCTTGCCTAAAAGGGGTTGGG - Intergenic
1055736831 9:79339591-79339613 GGTCATGAGTCCAAGAGGTTGGG - Intergenic
1057730598 9:97605058-97605080 GATCTTGCCTCCTAGGGGGATGG + Intronic
1059763086 9:117357853-117357875 GTTCATCCCTCCAAAGGGTTAGG - Intronic
1062215343 9:135386111-135386133 GGTCTTGCCACCACGGAGTGGGG - Intergenic
1062223886 9:135437897-135437919 GGTCTTGCCTCCCAGGTTTCAGG + Intergenic
1062268628 9:135698966-135698988 GGTGGTGCCTCCCAGGGGTGAGG - Intronic
1062268748 9:135699370-135699392 GGGCTGGCGGCCAAGGGGTTGGG - Intronic
1062735850 9:138137081-138137103 GGTCCAGCCTGCAAGGGGCTGGG - Intergenic
1186917007 X:14233782-14233804 GGTCTTGTCTGGATGGGGTTTGG + Intergenic
1191606498 X:63068156-63068178 AGTCTTGCATCCCAGGGATTAGG - Intergenic
1191719444 X:64217141-64217163 GGTCTTTCCTCAAGGGGATTCGG + Intergenic
1194400752 X:93435799-93435821 GGTCTTGCCTCCCAGGTTTCAGG - Intergenic
1194426977 X:93750860-93750882 GGGCTTGCTTCCAAGTGGATTGG - Intergenic
1200948470 Y:8868750-8868772 GGTCTTGCCTCCTAGGTTTCAGG - Intergenic
1201311861 Y:12604694-12604716 GGTCTTGCCTCCAGGGTTTAGGG - Intergenic