ID: 1077032647

View in Genome Browser
Species Human (GRCh38)
Location 11:476510-476532
Sequence CCCCAGTGATGCCGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077032647_1077032652 0 Left 1077032647 11:476510-476532 CCTGGGTGGCGGCATCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1077032652 11:476533-476555 ACTGGGACGCAGCCGTGAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 210
1077032647_1077032655 17 Left 1077032647 11:476510-476532 CCTGGGTGGCGGCATCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1077032655 11:476550-476572 AGTGGGACAGACTGGTCAGCAGG 0: 1
1: 1
2: 2
3: 17
4: 186
1077032647_1077032651 -1 Left 1077032647 11:476510-476532 CCTGGGTGGCGGCATCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1077032651 11:476532-476554 GACTGGGACGCAGCCGTGAGTGG 0: 1
1: 0
2: 1
3: 10
4: 129
1077032647_1077032653 9 Left 1077032647 11:476510-476532 CCTGGGTGGCGGCATCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1077032653 11:476542-476564 CAGCCGTGAGTGGGACAGACTGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077032647 Original CRISPR CCCCAGTGATGCCGCCACCC AGG (reversed) Intronic
900089585 1:914084-914106 CCACAGTGGAGCCGCCACCTTGG + Intergenic
900120733 1:1047683-1047705 CCCCAGTGAGACCTGCACCCTGG + Exonic
900161633 1:1226873-1226895 CCCCTGTGATGCCGCGAGCCAGG + Intronic
900236355 1:1593357-1593379 CTCCAGTGATCCGGCCACCTTGG - Intergenic
901040382 1:6359732-6359754 CCCCAATGCTGCCCCCACCAGGG + Intronic
901833813 1:11910683-11910705 GCCCAGTGTTGCCGTCTCCCAGG + Intergenic
904131100 1:28275910-28275932 CTCCAGTGATGCCACCACACAGG - Intronic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
905179276 1:36156399-36156421 CCCCAGTGACGCCGCAGCCATGG + Exonic
905214215 1:36395543-36395565 CCCCAGTGATCCACCCACCTTGG - Intronic
905866047 1:41377390-41377412 CCCCAGGGATTCCCCCACCAGGG - Intronic
907951325 1:59186757-59186779 CCCCAGTGACCTCCCCACCCTGG + Intergenic
908246387 1:62230616-62230638 CCCCAGTGATCCACCCACCTAGG + Intergenic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
913109346 1:115642908-115642930 CCCCACTGCTGCCGCCACCACGG - Intronic
915053504 1:153103106-153103128 CTCCAGTGGGGCAGCCACCCAGG + Intronic
919811890 1:201414049-201414071 ACCTAGTGATGCCACCACCCAGG + Intronic
920889365 1:209968825-209968847 TACCATTGATGCCACCACCCAGG + Intronic
922335597 1:224616392-224616414 ACCCACTGCTGCAGCCACCCGGG + Exonic
922874180 1:228927117-228927139 CCCCAGTGGTGACGTCTCCCTGG + Intergenic
923261028 1:232268245-232268267 CTCCAGTGATCCTCCCACCCTGG + Intergenic
924339961 1:243020186-243020208 CTCAAGTGATGCTGCCACCTTGG - Intergenic
1064031719 10:11887110-11887132 CACCACTGAGGCCGACACCCGGG + Intergenic
1064413185 10:15126043-15126065 CCCCAGTGATCCCACCTCCTGGG + Intronic
1064713879 10:18155129-18155151 CCCCTGTGGAGCCACCACCCAGG + Intronic
1065622718 10:27599826-27599848 CCACAGTGATCCTGCCACCTGGG + Intergenic
1065995514 10:31055995-31056017 CCCCAGCAGTGCCGCCACACAGG + Intergenic
1066745854 10:38603958-38603980 CCCCAGGGAGGCTGCCAGCCTGG - Intergenic
1067437357 10:46287428-46287450 CGCCAGTGCTGCCTCCATCCTGG - Exonic
1067718785 10:48710659-48710681 CCCCAGGGATGCCAACACCAAGG + Intronic
1069130728 10:64698694-64698716 TCCCAGTGATCCCATCACCCAGG - Intergenic
1070923167 10:80201788-80201810 CCCCAGTGGTGCCACTCCCCAGG + Intronic
1071531410 10:86392520-86392542 CCTCAGTGATGACGCTTCCCAGG - Intergenic
1073475537 10:103750284-103750306 CTCAAGTGATCCTGCCACCCTGG + Intronic
1076725287 10:132410259-132410281 CCCCTGAGATGCCTCCAGCCAGG - Intronic
1077010969 11:379213-379235 CCCCAGTCCTGCCCCGACCCTGG + Intronic
1077032647 11:476510-476532 CCCCAGTGATGCCGCCACCCAGG - Intronic
1077356661 11:2121932-2121954 CCCCACTGACACCGCCACTCTGG + Intergenic
1079357663 11:19743413-19743435 CCCCAGTGCTTCACCCACCCTGG - Intronic
1081426013 11:42927198-42927220 CTCCAGTGATCAAGCCACCCAGG + Intergenic
1083174256 11:60939386-60939408 CCCCAGGGATGCAGCCCCCAGGG - Intronic
1084659043 11:70536428-70536450 CCCCAGGGCTGTCCCCACCCAGG + Intronic
1084720016 11:70899501-70899523 CCCAAGGGAAGCCGCCACTCAGG - Intronic
1085294884 11:75425720-75425742 GCCCAGTGCTGCCACCACCTGGG + Intronic
1087290863 11:96318927-96318949 TCCCAGTGATGCCTACTCCCTGG + Intronic
1088374117 11:109121314-109121336 CCCCTGTGATGCTGCCTCACTGG + Intergenic
1089033710 11:115361971-115361993 CTCAAGTGATGCCCCCACCTCGG + Intronic
1089845202 11:121452702-121452724 CCCCAGTGGTGCCTGCACCTAGG - Intronic
1202815548 11_KI270721v1_random:45078-45100 CCCAGGCCATGCCGCCACCCCGG + Intergenic
1092160440 12:6312657-6312679 CCCCAGAGCTGGCGCCTCCCAGG + Intronic
1092243317 12:6849009-6849031 CCCCAGCAATGCAGTCACCCAGG - Exonic
1095755655 12:45763722-45763744 CTCAAGCGATGCCGCCACCTTGG + Intronic
1101822852 12:108197299-108197321 CCCCAGTCCTGCCCCCAACCTGG + Intronic
1102963156 12:117106811-117106833 CAGCAGTGATTCTGCCACCCAGG - Intergenic
1102971953 12:117175601-117175623 TCCCAGTGTTGCCACCAGCCAGG + Intronic
1103912831 12:124361653-124361675 CCCCAGAGCTGCTGCCAGCCGGG + Intronic
1104559871 12:129833988-129834010 CCTCAGTGATTCCCCCAACCAGG - Intronic
1105207491 13:18235813-18235835 CGCCAATGAGGACGCCACCCAGG + Exonic
1105971410 13:25432251-25432273 CCCCAGTGCTGCCTCTGCCCTGG - Intronic
1112297738 13:98203128-98203150 CTCCAGTGAGGCGGCCAGCCTGG - Intronic
1117054429 14:51897412-51897434 CTCCCATGATGCCCCCACCCCGG - Intronic
1118221311 14:63856868-63856890 CCCAAGTGATTCTCCCACCCCGG + Intronic
1119396116 14:74327458-74327480 CCGCAGGGATGGCCCCACCCAGG + Intronic
1119743856 14:77030534-77030556 CCCAAGTGATGCACCCACCTTGG + Intergenic
1122487234 14:102089301-102089323 TCCCAGTGATGCCCAGACCCAGG - Intronic
1122789601 14:104178734-104178756 CCCGAGGGAGGCCCCCACCCAGG + Exonic
1123466438 15:20519836-20519858 CTCCAGTGATCCCCCCACCTTGG + Intergenic
1123651676 15:22481201-22481223 CTCCAGTGATCCCCCCACCTTGG - Intergenic
1123742097 15:23290063-23290085 CTCCAGTGATCCCCCCACCTTGG - Intergenic
1123744899 15:23312493-23312515 CTCCAGTGATCCCCCCACCTTGG + Intergenic
1124200726 15:27676839-27676861 CCTCAGGGATGCCCCAACCCTGG + Intergenic
1124277167 15:28335814-28335836 CTCCAGTGATCCCCCCACCTTGG + Intergenic
1124305534 15:28575792-28575814 CTCCAGTGATCCCCCCACCTTGG - Intergenic
1125263227 15:37850928-37850950 TCCCAATGATTCTGCCACCCAGG - Intergenic
1132409487 15:101565760-101565782 CCTGAGTGTTGCCACCACCCTGG - Intergenic
1132414364 15:101610098-101610120 GCACAGTGATGCCACCTCCCAGG + Intergenic
1134669417 16:16043833-16043855 CCCAAGTGATCCAGCCACCTTGG + Intronic
1134669868 16:16046959-16046981 CTCCAGTGATTCCCCCACCTTGG - Intronic
1135525818 16:23212917-23212939 CCCCACTGAAGCCCCCAGCCTGG + Intronic
1136109988 16:28058760-28058782 CCCCTGTGATGTCCCCAACCGGG - Intronic
1136110042 16:28059061-28059083 CCTCGGTGTTGCCGCCACCCTGG - Intronic
1136316495 16:29457644-29457666 CCCTTGTGTTGCCCCCACCCTGG + Exonic
1136431072 16:30196986-30197008 CCCTTGTGTTGCCCCCACCCTGG + Exonic
1137788392 16:51154797-51154819 CGCCAGTGAGGTCGCGACCCCGG - Intergenic
1137879948 16:52035490-52035512 CCCCAGTGAACCAGCTACCCTGG + Intronic
1138418606 16:56885401-56885423 GGCCAGTGATGGCTCCACCCTGG + Intronic
1139192603 16:64881917-64881939 CCCAAGTGATTCACCCACCCTGG + Intergenic
1141478195 16:84287986-84288008 TCCCAATGATCCCGTCACCCAGG - Intergenic
1141487205 16:84348330-84348352 CTCCAGTGATCCTTCCACCCTGG + Intergenic
1141632162 16:85294030-85294052 CAGCAGTGATGCCTCCTCCCCGG + Intergenic
1141982785 16:87560608-87560630 CCCCAGTCATGGCCCCACCCCGG - Intergenic
1142028809 16:87828363-87828385 ACTCAGAGATGCCCCCACCCCGG - Intergenic
1142627943 17:1203957-1203979 CCCCCGTGAAGCCGGCACCGAGG - Intronic
1142849140 17:2695906-2695928 CCCCAGCCATGCCACCATCCAGG + Intronic
1143729769 17:8874443-8874465 TCCCAGTCATGCCTCCCCCCGGG - Intergenic
1145265145 17:21376474-21376496 CGCCACTGCTGCCGCCTCCCTGG + Exonic
1146433670 17:32822652-32822674 CCCCGGTGGGGCGGCCACCCGGG + Intronic
1146900356 17:36581645-36581667 CTCAAGTGATACCTCCACCCTGG - Intronic
1147171888 17:38625397-38625419 CTCAAGTGATGCCCCCACCTCGG + Intergenic
1147490350 17:40860228-40860250 CCCCAGTGGGGACCCCACCCTGG + Intergenic
1147666940 17:42154900-42154922 CCCAAGTAACGCCGCCGCCCCGG - Exonic
1148002556 17:44398317-44398339 CCCCAGTGATGGGGACACCCTGG - Exonic
1148097940 17:45066951-45066973 CTCAAGTGATGCTGCCACCTTGG + Intronic
1148174456 17:45551331-45551353 CCTCAGTGATCCCCCCACCTCGG - Intergenic
1148274807 17:46294116-46294138 CCTCAGTGATCCCCCCACCTCGG + Intronic
1148296913 17:46511695-46511717 CCTCAGTGATCCCCCCACCTCGG + Intronic
1148361465 17:47016175-47016197 CCTCAGTGATCCCCCCACCTCGG + Intronic
1150405675 17:64898253-64898275 CCTCAGTGATCCCCCCACCTCGG - Intronic
1150718833 17:67597125-67597147 CTCAAGTGATGCCCCCACCTTGG + Intronic
1151390662 17:73784776-73784798 CCCAAATGATGCTGCCTCCCAGG + Intergenic
1151807681 17:76416669-76416691 TCCCAGTGATGCCAGCATCCCGG - Intronic
1152809029 17:82372360-82372382 CCCCCTTGCTGCCCCCACCCAGG - Intergenic
1157663807 18:49468599-49468621 CTCAAGTGATCCCCCCACCCTGG - Intergenic
1160067236 18:75587023-75587045 CCCCACTGATGTGGGCACCCAGG - Intergenic
1161016724 19:1987053-1987075 TCCCTGTGCTGCCCCCACCCTGG - Intronic
1161147691 19:2688830-2688852 CACAAGTGATCCTGCCACCCCGG - Intronic
1162484495 19:10950820-10950842 CTCAAGTGATCCCCCCACCCGGG + Intergenic
1163039741 19:14593411-14593433 CTCCAGTGATGCTCCCACCTTGG - Intronic
1163565126 19:18046563-18046585 CCCCACAGATACCCCCACCCTGG - Intergenic
1163655516 19:18543141-18543163 CCTCAGTCAAGCCGCGACCCAGG + Intronic
1164648784 19:29877229-29877251 CTCAAGTGATGCAGCCACCTTGG + Intergenic
1165020180 19:32917780-32917802 CTGCAGTGATGTCGCCTCCCAGG + Intronic
1165176008 19:33930344-33930366 CCCCAAGGCTGCAGCCACCCTGG - Intergenic
1165864648 19:38929319-38929341 CCCAAGTGATCCTCCCACCCTGG - Intronic
1166086094 19:40476109-40476131 CTCCAGTGATCCCCCCACCTTGG - Intronic
1166256932 19:41613276-41613298 CACCAGTGAGGCAGCCACACCGG + Intronic
1166749286 19:45157085-45157107 CACCTCTGCTGCCGCCACCCCGG + Intronic
1166856372 19:45784377-45784399 CCCCAAAGCTGCTGCCACCCTGG + Intronic
925614890 2:5735425-5735447 GCACAGTGATGGAGCCACCCAGG - Intergenic
925999781 2:9321430-9321452 GCCCAGGGAGGCCCCCACCCAGG + Intronic
926077517 2:9952400-9952422 TCCCACTCATGCCGCCAGCCAGG - Intronic
926698750 2:15788623-15788645 CCCCAAGGAGGCCGCCTCCCAGG + Intergenic
927153592 2:20209490-20209512 CCCCAGTGGTGACGCTACCCAGG + Intronic
927508976 2:23632540-23632562 GCCCAGTGATGCCCCCCTCCTGG + Intronic
928340075 2:30435274-30435296 CTCAAGTGATGCCCCCACCTTGG - Intergenic
929143191 2:38684437-38684459 CTCCAGTGATGCTCCCACCTTGG - Intronic
929975498 2:46630448-46630470 CACCATTGATCCCGACACCCAGG + Intergenic
930124322 2:47783835-47783857 CCCCAGTGCTCCCACCTCCCAGG - Intronic
933972331 2:87480300-87480322 CCCCAGTGATCCAGCAGCCCTGG + Intergenic
934281003 2:91613174-91613196 CACAAATGATCCCGCCACCCAGG + Intergenic
935062456 2:99620393-99620415 CCCAAGTGATCCTCCCACCCTGG - Intronic
935756290 2:106278540-106278562 CCTCAGTGATGCCATCACACAGG + Intergenic
936113190 2:109681937-109681959 CCTCAGTGATGCCATCACACAGG - Intergenic
936321400 2:111469888-111469910 CCCCAGTGATCCAGCAGCCCCGG - Intergenic
938169972 2:129066845-129066867 CCCCAGTGGTGCCTCCTGCCAGG - Intergenic
945223646 2:207509605-207509627 CTCCAGTGATCCACCCACCCTGG - Intergenic
946126742 2:217569183-217569205 CCACAGTGAGGCAGCCACACTGG - Intronic
946179215 2:217939907-217939929 CCCCAGTGCAGCCTCTACCCAGG - Intronic
946603223 2:221374019-221374041 CTACAGTGATGCCTCCATCCTGG - Intergenic
947374559 2:229482513-229482535 CCACCGTGCTGCAGCCACCCAGG + Intronic
948399045 2:237669713-237669735 CCACAGTGATGCCTCCACCCCGG + Intronic
948574069 2:238938536-238938558 CCCCAGCTCAGCCGCCACCCGGG - Intergenic
948844256 2:240675709-240675731 CCCCAGTGAGACCTCCACCCCGG - Intergenic
948849604 2:240699170-240699192 CCCCAGTGAGACCTCCACCCCGG + Intergenic
948920453 2:241063814-241063836 CCCCAGGGCTGCGGCCACCTTGG + Intronic
949075213 2:242052850-242052872 CCCCAGTTTTGGAGCCACCCAGG - Intergenic
1170191258 20:13647594-13647616 CTCCAGTGATACTGCCACCTTGG + Intergenic
1172990871 20:39035638-39035660 CCCCTGTGATGCCACCACGTAGG - Intronic
1173465552 20:43278414-43278436 CCCAAGTGATGCTGCAAGCCTGG - Intergenic
1175693264 20:61081777-61081799 GCCCAGTGATGCCACCAGTCAGG + Intergenic
1175693604 20:61084560-61084582 CCCCAGTGATCCCCACCCCCTGG + Intergenic
1175915505 20:62424018-62424040 CCCCACTGCAGCCCCCACCCAGG - Intronic
1176414609 21:6467515-6467537 TCCCCGCGAGGCCGCCACCCCGG - Intergenic
1176550612 21:8219265-8219287 CCCCGGTGGGGCGGCCACCCGGG + Intergenic
1176569542 21:8402306-8402328 CCCCGGTGGGGCGGCCACCCGGG + Intergenic
1176577454 21:8446535-8446557 CCCCGGTGGGGCGGCCACCCGGG + Intergenic
1176699297 21:10023659-10023681 TCCCAGTGATCCTACCACCCAGG - Intergenic
1177555911 21:22688378-22688400 CCTCAGTGATGCTCCCACCTTGG - Intergenic
1178306374 21:31494145-31494167 CTCAAGTGATCCAGCCACCCTGG + Intronic
1179587585 21:42383482-42383504 CCCCAGTGATGACAACACCCTGG + Intronic
1179690107 21:43075837-43075859 TCCCCGCGAGGCCGCCACCCCGG - Exonic
1180240265 21:46498760-46498782 TCCCAGTGCTGCAGCCACGCCGG + Exonic
1180594821 22:16966229-16966251 CCACAGGGATGCAGACACCCTGG + Exonic
1180636022 22:17263747-17263769 CACCAGGGATGCTGCCGCCCTGG - Intergenic
1180799721 22:18626083-18626105 CTCCAGAGATGCCACCACCCAGG + Intergenic
1181221994 22:21369183-21369205 CTCCAGAGATGCCACCACCCAGG - Intergenic
1181347116 22:22227691-22227713 CTCCAGTGATACCCCCACCTCGG + Intergenic
1181591984 22:23890979-23891001 CCCCAGAGTTCCTGCCACCCAGG - Intronic
1181637384 22:24180822-24180844 CTCCAGAGATGCCACCACCCTGG - Intergenic
1181972389 22:26701199-26701221 CTCAAGTGATGCCCCCACCTCGG + Intergenic
1182004601 22:26949387-26949409 CCCCAGGGAGCCTGCCACCCAGG + Intergenic
1182642588 22:31780419-31780441 CTCCAGTGATTCCTCCACTCAGG - Intronic
1183338370 22:37264139-37264161 CCCCACTGTGGCTGCCACCCAGG + Intergenic
1183377868 22:37475607-37475629 CCCCATTAATGCCGCTGCCCTGG + Intronic
1183391387 22:37547207-37547229 CCCCTGGAATGCCCCCACCCTGG + Intergenic
1183549219 22:38471447-38471469 CCCCACTGTTGCCCTCACCCCGG + Intronic
1184508068 22:44916354-44916376 CCCCAGCAATGCCGCCGCCATGG - Exonic
1184789359 22:46689896-46689918 CCCCAGGGAACCCCCCACCCTGG + Intronic
1185246561 22:49776112-49776134 CTCCACTGATGCCGCCGCCTCGG - Exonic
1203255511 22_KI270733v1_random:135608-135630 CCCCGGTGGGGCGGCCACCCGGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950839625 3:15954992-15955014 CCCAAGTGATTCCCCCACCTCGG + Intergenic
955010054 3:55005040-55005062 CCCAAGTGATCCAGCCACCTCGG - Intronic
964383984 3:156127702-156127724 CCCCAGTGGTGCAGCTACACAGG - Intronic
968022655 3:195407597-195407619 CTCCAGTGATCCAGCCTCCCAGG - Intronic
968497312 4:925989-926011 CCCCAGTGGTGAGCCCACCCGGG + Intronic
968567251 4:1319635-1319657 CTCAAGTGATGCTCCCACCCTGG - Intronic
968690601 4:1987900-1987922 CACCAGTAAGGCCCCCACCCTGG - Exonic
969517297 4:7654785-7654807 CCCCAGACAAGCCCCCACCCTGG + Intronic
969605403 4:8199872-8199894 CCACTCTGATGCCGCCACCTGGG + Intronic
969716820 4:8871858-8871880 CCCCAGTGAGGCCGCCCCGGCGG - Intergenic
970233500 4:13934462-13934484 CCCCAGTGAGGGCTCCACACAGG - Intergenic
971563575 4:28112953-28112975 CCCCAGTGGTGCCGGCCCACAGG + Intergenic
973547875 4:52000431-52000453 CCCCAGTGATCCTGCCTCCTTGG + Intronic
975590793 4:75997831-75997853 CCCAAGTGATCCAGCCACCTTGG + Intergenic
976177961 4:82373571-82373593 CCCCTGTGTCGCCGCCACCATGG + Exonic
981457675 4:144973418-144973440 TCCTAGTGATTCCGTCACCCAGG - Intronic
982046069 4:151447449-151447471 CCCCTGTGCTGCAGCCACACAGG + Intronic
982276304 4:153639980-153640002 CCCCATTGATGTCTCCAGCCCGG - Intergenic
984102273 4:175499956-175499978 CCCCATTGAGGCAGCCCCCCAGG + Intergenic
985521175 5:374487-374509 CCCAAGGGATGCCCCCACCTCGG + Intronic
987070586 5:14333795-14333817 CACCAGTTAGGCCCCCACCCTGG + Intronic
989151052 5:38300226-38300248 ACCCGGTGGTGCAGCCACCCAGG - Intronic
991659408 5:68935062-68935084 CCTCAGTGCTGCCGGGACCCAGG - Intergenic
995159853 5:108967044-108967066 AGCCAGTGATGCCCCCACCTAGG + Intronic
996573591 5:124959479-124959501 ACCCAGTGATCCTCCCACCCTGG + Intergenic
997206522 5:132053546-132053568 CCCCAGGGAAGCTGCCACCTGGG - Intergenic
997829831 5:137140259-137140281 CCAGAGTGATGCCACGACCCAGG - Intronic
998453839 5:142255254-142255276 CTCAAGTGATGCCTCCACCTCGG - Intergenic
1001091838 5:168747562-168747584 CCCCAGTGAGGGGGCCTCCCTGG - Intronic
1005158519 6:22835246-22835268 CCCCACTGCTGCCACCACCAGGG + Intergenic
1005899808 6:30207477-30207499 CCCCAGTGCTGCAGCCACTCTGG + Intronic
1006642295 6:35495715-35495737 CCCCAGTGCTGGGGCCACCTGGG - Intronic
1012398835 6:98828094-98828116 CCCCACTGATCCCCCCACGCGGG + Intergenic
1016351906 6:143177748-143177770 CTCCAGTGATGAAGCCACCCAGG - Intronic
1016794618 6:148104906-148104928 CCCCACTGATGTCGCCAATCTGG + Intergenic
1016968038 6:149736920-149736942 CTCCAGTGATCTAGCCACCCTGG + Intronic
1018092319 6:160355869-160355891 CCCCACTGCTGCCTCTACCCAGG + Intronic
1018097767 6:160407074-160407096 CCCCAGTGACGCCAACACCAAGG - Exonic
1019324817 7:432888-432910 CCCCAGTGGGCCCTCCACCCAGG + Intergenic
1019535791 7:1529478-1529500 CCACAGTGATGCCTGCAACCTGG - Intergenic
1019605389 7:1907546-1907568 CCCCACTGATGACGCCGCCACGG + Intronic
1019907004 7:4072481-4072503 CCCCAGTGATGCCCGCATCAGGG + Intronic
1021481140 7:21118575-21118597 CCACGGTGATGCCTCAACCCAGG + Intergenic
1023867509 7:44245233-44245255 ACCCAGTGATGCCCCCACCCTGG + Intronic
1024579951 7:50793346-50793368 CGCCGGCGCTGCCGCCACCCAGG + Intronic
1026911135 7:74092653-74092675 CCCCAGGGCTGCCGCATCCCTGG + Intronic
1029373307 7:100163047-100163069 TGCCAGTGATGCCCCCTCCCAGG - Intronic
1031255485 7:119442276-119442298 CTCAAGTGATGCCCCCACCTTGG + Intergenic
1033665588 7:143437682-143437704 CCCCTGTGATCCCAGCACCCAGG + Intergenic
1035152764 7:156888682-156888704 CTCAAGTGATGCACCCACCCTGG - Intronic
1035395543 7:158532494-158532516 CCCCACCGATGCCTCCACACTGG + Intronic
1035654396 8:1294564-1294586 ACCCAGTGATGCCACGACACAGG - Intergenic
1035688174 8:1540681-1540703 CCGCAGTGATGCCCCCTCCGTGG - Intronic
1038573377 8:28682675-28682697 CTCAAGTGATGCCCCCACCTTGG + Intronic
1039101974 8:33950974-33950996 CCCCACTGCTGCCACCACCAGGG - Intergenic
1039759832 8:40562558-40562580 CCCCATTGATGACAGCACCCAGG - Intronic
1042909991 8:73816797-73816819 CCCCAGTGATCCGCCCACCTCGG - Intronic
1044240076 8:89878570-89878592 CTCCAGTGATCCACCCACCCTGG + Intergenic
1044354014 8:91199299-91199321 CCTCAGTCATGCAACCACCCAGG + Intronic
1045274157 8:100686997-100687019 CTCCAGTGATCCACCCACCCCGG - Intronic
1046572638 8:115985924-115985946 CTCAAGTGATCCCCCCACCCTGG + Intergenic
1048550428 8:135428259-135428281 CCCCAGTGATTCTGTCTCCCTGG + Intergenic
1049560879 8:143309695-143309717 CCCCACGCATGCCGCCACCCTGG + Intronic
1049731036 8:144178695-144178717 CCCCAATGATGCACCCACCATGG - Intronic
1053636406 9:40009846-40009868 TCCCAGTGATCCTACCACCCAGG - Intergenic
1053769588 9:41454802-41454824 TCCCAGTGATCCTACCACCCAGG + Intergenic
1054256026 9:62814133-62814155 ACCCTGTGATCCCCCCACCCTGG + Intergenic
1054317273 9:63606926-63606948 TCCCAGTGATCCTACCACCCAGG - Intergenic
1054335282 9:63801479-63801501 ACCCTGTGATCCCCCCACCCCGG - Intergenic
1054548255 9:66366281-66366303 TCCCAGTGATCCTACCACCCAGG + Intergenic
1056198443 9:84251226-84251248 CCACAGTGGTGCTGCCATCCTGG - Intergenic
1058064669 9:100535535-100535557 CCCAAGTGATTCCCCCACCTCGG - Intronic
1059153087 9:111966682-111966704 CCCAAGTGATCCACCCACCCCGG - Intergenic
1059401460 9:114072952-114072974 CCTCAGGGATGCCCACACCCTGG + Exonic
1060176141 9:121499036-121499058 CCCCAGTGCTGCAGGCACCCCGG + Intergenic
1061045639 9:128163594-128163616 CCCCAGTGATGCCAGCCCCTAGG + Exonic
1062119327 9:134825664-134825686 CCCCAGGAATGCCGCCAACACGG - Intronic
1203471907 Un_GL000220v1:118743-118765 CCCCGGTGGGGCGGCCACCCGGG + Intergenic
1185859102 X:3561194-3561216 CTCAAGTGATGCACCCACCCTGG + Intergenic
1188461120 X:30428447-30428469 TCCCAGTGATTCCATCACCCAGG - Intergenic
1190626008 X:52339402-52339424 CTTCAGTCATGCCTCCACCCTGG + Intergenic
1190663839 X:52679442-52679464 CTCCAGTCCTGCCTCCACCCGGG - Intronic
1190675583 X:52778980-52779002 CTCCAGTCCTGCCTCCACCCGGG + Intronic
1192448188 X:71225772-71225794 CTCCAGAGATGCCTCCACACAGG + Intergenic
1199847620 X:151702441-151702463 CCCCAGTGAGGCCACCAGCTTGG + Exonic