ID: 1077033165

View in Genome Browser
Species Human (GRCh38)
Location 11:479384-479406
Sequence CCTCCAGGAGCATCTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077033155_1077033165 7 Left 1077033155 11:479354-479376 CCTTCAAAACGTAGGCCGAGCTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG 0: 1
1: 1
2: 1
3: 40
4: 377
1077033161_1077033165 -8 Left 1077033161 11:479369-479391 CCGAGCTGCGGGGGGCCTCCAGG 0: 1
1: 1
2: 1
3: 17
4: 259
Right 1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG 0: 1
1: 1
2: 1
3: 40
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077033165 Original CRISPR CCTCCAGGAGCATCTGCTGG TGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900371253 1:2333174-2333196 GCACCAGGAGCATCTCCAGGCGG - Intronic
900520778 1:3104598-3104620 CATCCAGGAGCATGTGCCAGCGG + Intronic
900559232 1:3295466-3295488 CCTCCAGGAGCACCAGCGTGTGG + Intronic
900606813 1:3527412-3527434 CCTCCAGGGCCATCTACTGGAGG + Intronic
901396653 1:8986844-8986866 CCTCCAGGTGTGCCTGCTGGGGG + Intergenic
901438149 1:9262102-9262124 CCTCCAGAACCATCTGACGGAGG + Exonic
901778472 1:11576722-11576744 TCTCCAGAAGCAGCAGCTGGAGG + Intergenic
902509540 1:16958696-16958718 CCTTCAGCAGCCTCTGCCGGAGG - Exonic
903000185 1:20259901-20259923 GCTCCTGGAGCTTCTGCTGCTGG + Intergenic
903602369 1:24552033-24552055 CCTCTAGGAGCATCTGGCGATGG - Intergenic
903786388 1:25863905-25863927 CCCCCACGAGCAGCAGCTGGGGG + Intronic
904192598 1:28758548-28758570 CCTCCATGACCATTTGCTGAAGG + Intronic
904810661 1:33161520-33161542 CCTGCAGGAAGAACTGCTGGCGG + Intronic
904857989 1:33514517-33514539 GCTCGAGGAGCACCTGCTGGTGG - Exonic
904900213 1:33851319-33851341 CCTCCCAGAGCATCTCCTGTGGG + Intronic
909204832 1:72742485-72742507 CCTCCAGAAGCGTCTGCTATGGG + Intergenic
909498098 1:76302337-76302359 CCTGCATGAGTATCTGCTTGTGG + Intronic
910838805 1:91541872-91541894 CCTCCATGAACACCTCCTGGGGG - Intergenic
912386513 1:109273587-109273609 CCTCCAGGAGCAGCTGAACGGGG + Exonic
915109511 1:153554111-153554133 CCTCCTAGAGCTGCTGCTGGAGG - Intergenic
915312336 1:155010950-155010972 TCTCCAGGAGCAGCAGCTTGGGG - Exonic
915535636 1:156533809-156533831 CCTCCAGGAGCTCATGCAGGGGG + Exonic
915604853 1:156944079-156944101 CCTCCACGTGCTGCTGCTGGAGG - Exonic
916175038 1:162031041-162031063 CTTCCAGGAGTATCTGCATGTGG - Intergenic
916259298 1:162824816-162824838 CCTTCTGCAGCAGCTGCTGGTGG + Intronic
917004035 1:170391991-170392013 GCACCAGGAGCAGATGCTGGAGG + Intergenic
917178581 1:172266777-172266799 CCTCTATGAGTATCTGGTGGAGG + Intronic
917835998 1:178942022-178942044 CCACCATGAGCAACAGCTGGAGG + Intergenic
919785207 1:201254290-201254312 ACTCCACCAGCCTCTGCTGGGGG + Intergenic
920346461 1:205308840-205308862 CCTCCAGGAATATCTGCTAATGG + Intronic
920673157 1:208020217-208020239 ACTCAAGGGGCATCTGCTGTGGG + Intergenic
922663717 1:227451596-227451618 CCTCCATGAGCAGCTGGTTGGGG + Intergenic
922769920 1:228176163-228176185 CCTCCAGGAGCGTGGGGTGGGGG + Exonic
1062925496 10:1313082-1313104 CCTCAACAAGCATCTGCTGAAGG + Intronic
1066627183 10:37418662-37418684 GGTCCAGGTGCTTCTGCTGGGGG - Intergenic
1067722881 10:48743069-48743091 CCTCCAGGAGCCCCCGCTGCAGG + Exonic
1067832745 10:49619871-49619893 GCTCCAGGAGTTTCTGCTGCAGG - Exonic
1067926142 10:50510062-50510084 CTGCCAGGAGCATGTGATGGGGG - Intronic
1068725324 10:60294432-60294454 GCTCCAGCTGCATCAGCTGGTGG - Intronic
1068904388 10:62307024-62307046 CCTGCAGCAGCATCTAGTGGGGG + Intergenic
1069137832 10:64786024-64786046 CCTGCAGTAGCATCTGGGGGTGG - Intergenic
1069496091 10:68904492-68904514 ACTCAAGGAGCATCCACTGGAGG + Intronic
1069846707 10:71377214-71377236 CTTCCGGGAGCATCCGCCGGCGG - Intergenic
1069868990 10:71521719-71521741 CCTTCAGAAGCAGCTGCTGAGGG + Intronic
1070787391 10:79169886-79169908 CAAACAGGAGCATCTGCTTGAGG + Intronic
1071288746 10:84172949-84172971 CCTCAAGGAGCTCCTGTTGGTGG - Intergenic
1072249195 10:93568339-93568361 CCTCCAGGAGCTTCTGCCCGTGG + Intronic
1072291038 10:93964938-93964960 CCTCCATCAGAATCAGCTGGAGG + Intergenic
1072582371 10:96750511-96750533 CCCCCAGCCGCATCTTCTGGCGG + Intergenic
1072585037 10:96774099-96774121 CCTCCAGGTGCTTCTGATGCAGG - Intergenic
1072628355 10:97128779-97128801 CCTCCGGCAGGATCTGGTGGAGG - Intronic
1072821359 10:98561030-98561052 CCTCCTGGAGGATCTGCCTGAGG - Intronic
1072881999 10:99236882-99236904 CCTCCAGGAGGGTCTGGAGGGGG - Intergenic
1073134969 10:101215419-101215441 TCCCCAGGAGCAGCTGCTGTGGG - Intergenic
1074298350 10:112211247-112211269 TCCCCAGGTGCTTCTGCTGGTGG - Intronic
1074536082 10:114329460-114329482 CCACCAGGGGCAGCTGCTGGTGG - Intronic
1074823898 10:117201181-117201203 TCTCCAGGGGCATCTGCAGAAGG + Exonic
1075739765 10:124687668-124687690 CCTACAGGAGCATCCTTTGGGGG + Intronic
1075855608 10:125626888-125626910 CCTCCAGGAGGTCGTGCTGGAGG - Intronic
1075953647 10:126504224-126504246 CCTCCAGGAGCTCCTGCTTCAGG + Exonic
1076470796 10:130716692-130716714 CCTCCTGTAGCAGCTGCTGCTGG + Intergenic
1076474118 10:130740520-130740542 TAGCCAGGAGCATCTGCTGTTGG - Intergenic
1076527920 10:131124020-131124042 TCTACAGGAGCCTCTGCTGCGGG - Intronic
1076809413 10:132878898-132878920 CCACCAGGAGCAGCTGTCGGGGG - Intronic
1076852266 10:133099041-133099063 CCTCCCGGAGAAAGTGCTGGGGG + Intronic
1076852292 10:133099113-133099135 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1076852304 10:133099149-133099171 CCTCCCGGAGAAAGTGCTGGGGG + Intronic
1076852317 10:133099185-133099207 CCTCCCGGAGAAAGTGCTGGGGG + Intronic
1076852329 10:133099221-133099243 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG + Intronic
1077311121 11:1889534-1889556 GCTCAAGAAGCAGCTGCTGGAGG - Exonic
1077488729 11:2850815-2850837 GTGCCAGGAGCATCTGCTGGGGG + Intergenic
1077556113 11:3226941-3226963 CATCCAGGAGCATGTGCCAGGGG - Intergenic
1079032750 11:16997693-16997715 TCTACAGGTGCATGTGCTGGGGG + Intronic
1079367192 11:19819614-19819636 CCTTCAAGTGCATCAGCTGGTGG - Intronic
1080821553 11:35811727-35811749 CCTCCAGATACACCTGCTGGTGG - Exonic
1080980874 11:37404005-37404027 CCTCCACGAACATGTGTTGGGGG + Intergenic
1082238810 11:49851697-49851719 GCTCCAGGAGCCTCTGCTTGAGG - Intergenic
1082243337 11:49892630-49892652 GCTCCAGGAGCCTCTGCATGAGG + Intergenic
1082657831 11:55873456-55873478 GCTCCAGGAGCCTCTGCATGAGG + Intergenic
1082996432 11:59259395-59259417 CCTCTATGAGCATCTTCTTGAGG - Intergenic
1083091829 11:60207835-60207857 CTGCCAGGAGCATCTGCTGCAGG + Intronic
1083578930 11:63813061-63813083 CTGCCCGGGGCATCTGCTGGCGG + Intergenic
1083637739 11:64129509-64129531 CCCCCAGGAGGCTGTGCTGGGGG - Intronic
1083652136 11:64209861-64209883 CCTCCAGGAGCATGAACAGGTGG - Intronic
1083741416 11:64713450-64713472 CTTCCTGGAGCTGCTGCTGGTGG - Exonic
1083879877 11:65543123-65543145 CCCCCAGGGGCATCGGCTGGTGG - Exonic
1083894490 11:65613396-65613418 CTTCCAGGAGCTGCGGCTGGAGG - Exonic
1083940108 11:65891158-65891180 CCGCCAGGAGGAGCTGCTGCGGG + Exonic
1084107120 11:66987464-66987486 CCTCTGGGAGCAGCTACTGGGGG - Intergenic
1084876166 11:72135429-72135451 CCTCCCGCAGCATCTGCTCCGGG + Intronic
1084881030 11:72171908-72171930 CCTCCCGCAGCATCTGCTCCAGG + Intergenic
1085300819 11:75457231-75457253 CTTCCAGGAGCCTCTGCTTCAGG - Intronic
1085455100 11:76661154-76661176 CCTGCTGGAGCGGCTGCTGGGGG - Exonic
1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG + Intronic
1086690760 11:89787051-89787073 GCTCCAGGAGCCTCTGCATGAGG - Intergenic
1086715040 11:90052608-90052630 GCTCCAGGAGCCTCTGCATGAGG + Intergenic
1086779930 11:90891175-90891197 TCTCCATGAGCATGTGTTGGTGG - Intergenic
1087182603 11:95154647-95154669 CCTGCAGGAGCATTTGGAGGAGG - Intergenic
1087479546 11:98681357-98681379 CCAGCAGGAGCATCTGCCCGGGG - Intergenic
1088125570 11:106419419-106419441 ACTCCAGTAGCATATGTTGGAGG + Intergenic
1090805401 11:130199122-130199144 CCTCCAGGTGCACCCTCTGGTGG - Intronic
1090940632 11:131385053-131385075 CCTCCAGGAGCATCTGCAGGGGG - Intronic
1090996165 11:131867851-131867873 CCTTCAGCTCCATCTGCTGGTGG - Intronic
1094528788 12:31252355-31252377 CCCCCAGCCGCATCTTCTGGCGG - Intergenic
1096521823 12:52188829-52188851 CAGCCAGCAGCCTCTGCTGGAGG + Intronic
1096529379 12:52233545-52233567 CCTCCTGGCGCACCCGCTGGAGG - Exonic
1096812761 12:54182290-54182312 CCGGCAGGTGCAGCTGCTGGGGG - Exonic
1099125200 12:78746158-78746180 CCTGCTGGAGCATTAGCTGGAGG - Intergenic
1099184841 12:79505166-79505188 CCTCCGGGAGCCTCTCCTGGGGG - Intergenic
1099927973 12:89041100-89041122 CTTCCTAGAGCCTCTGCTGGTGG + Intergenic
1101989413 12:109472469-109472491 CCTCCAGAAGCACCTGCCTGAGG + Intronic
1102530406 12:113542266-113542288 CCTCCAGGGGCTTCTGATGCAGG + Intergenic
1102840826 12:116119221-116119243 CGACCAGGAGCATCTGGTAGGGG - Intronic
1104410786 12:128556048-128556070 CTTCCAAGAGAATTTGCTGGAGG + Intronic
1104466336 12:128993870-128993892 CTCCCAGGAGGATCTGCTGGGGG - Intergenic
1104880611 12:132068106-132068128 CCTCCAGGGACTTCTGCTCGTGG + Intronic
1107409684 13:40147035-40147057 TCTCCAGGATCATCTGCAGGAGG - Intergenic
1112356420 13:98677802-98677824 CCTCTCGCAGCAGCTGCTGGAGG + Intergenic
1112959441 13:105105637-105105659 GCTCCAGGGGCTTCTGCTGTAGG - Intergenic
1113817521 13:113184695-113184717 CCTGCAGGAGCCCATGCTGGTGG + Intronic
1113817545 13:113184783-113184805 CCTGCAGGAGCCTGTGCTAGTGG + Intronic
1113817557 13:113184838-113184860 CCTGCAGGAGCCTGTGCTAGTGG + Intronic
1115879756 14:37902096-37902118 CCACCAGGAGCCTGTCCTGGCGG + Intronic
1117221056 14:53606815-53606837 CCTCCAGGACTAGCTTCTGGTGG - Intergenic
1117258084 14:54000687-54000709 CCTCCAGGAGCTGCTGCAGAGGG + Intergenic
1118755737 14:68842552-68842574 CACCCAGGAGCAGCTGCTGCTGG + Intergenic
1120751619 14:88203399-88203421 CCTCCAGGAGTAGCTGTTGCAGG - Intronic
1120942735 14:89964294-89964316 CCTCAGGGAGCACCTGCAGGAGG + Intronic
1121336021 14:93077925-93077947 CATCTTTGAGCATCTGCTGGAGG - Intronic
1121417716 14:93790260-93790282 CCTCCATGGGCACCTGCTGGGGG + Intergenic
1121633535 14:95438737-95438759 CCTGCAGGAGCTGCTGCTAGTGG + Intronic
1122293152 14:100690280-100690302 CCTCCAGGAGGTGCTGCAGGTGG + Intergenic
1122615340 14:103013863-103013885 CCTCTAGGAGCTTCTTGTGGGGG - Intronic
1122790852 14:104183618-104183640 CCTCAAGGAACACCTGCTGGAGG - Intergenic
1122987704 14:105220115-105220137 TCTCCTGAAGCATCTTCTGGAGG + Exonic
1125721621 15:41847791-41847813 CAACCAGGAGCAGCTGCTGGAGG + Exonic
1126218144 15:46181346-46181368 CCACCAGCAGCATCTGCTCCTGG + Intergenic
1126583996 15:50265529-50265551 CCTGCAGGAACGGCTGCTGGTGG - Intronic
1129166396 15:73780671-73780693 CAGCCAGGAGCATCTGCTACAGG + Intergenic
1130123806 15:81075293-81075315 CCACCAGAAACATCTGCAGGGGG - Intronic
1130895877 15:88170100-88170122 CCTCCAGGAACATCTGTTGAGGG - Intronic
1131057961 15:89387293-89387315 CCACCAGCAGCAGCTGCTGAGGG - Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1132157351 15:99504922-99504944 CCTCCTGGAGCTCCTCCTGGAGG + Intergenic
1132367780 15:101270043-101270065 CCCACAGCAGCCTCTGCTGGTGG + Intergenic
1132510449 16:338332-338354 CCTCCAGAAACAGCTGCTGCAGG + Intronic
1132511759 16:346203-346225 TCTCCAGGAGCAGCTTCTGAGGG + Exonic
1132734142 16:1377368-1377390 CCAACAGGGGCATCTGCAGGTGG - Intronic
1133533204 16:6674751-6674773 CCTCTTGTAGCTTCTGCTGGTGG - Intronic
1133907017 16:10031669-10031691 CTTCCAGAAGCATCCTCTGGTGG - Intronic
1135839091 16:25857216-25857238 CCTCCAGGAGCTTCTTCTCCAGG + Intronic
1137981289 16:53072216-53072238 CCTGCAGGAGCAGCAGCTGGAGG - Intronic
1138433402 16:56983621-56983643 CTTCCCTGAGCACCTGCTGGTGG + Exonic
1139090450 16:63640066-63640088 CCTCCAGAGGCATCTGGTGAGGG + Intergenic
1140913027 16:79470483-79470505 CCTCCAGGAACTTGTGGTGGGGG - Intergenic
1141041908 16:80679837-80679859 CATCTAGGAACTTCTGCTGGAGG + Intronic
1141181069 16:81753829-81753851 TCTCCAGGAGAAGCAGCTGGAGG + Intronic
1141369009 16:83470177-83470199 CCTCCAGAACCCTCTGCTGCTGG + Intronic
1142060252 16:88024592-88024614 TGTCCAGTAGCATCTGCGGGCGG + Intronic
1142189832 16:88712714-88712736 CCAGCAGCAGCATGTGCTGGGGG + Exonic
1142231447 16:88902002-88902024 CCTCCATGAGCATCCCCCGGGGG + Intronic
1142267566 16:89071501-89071523 CCTCCAGGAGCATTTCCCGGAGG - Intergenic
1142286344 16:89173063-89173085 CCCTCAGGGGCAGCTGCTGGAGG - Intronic
1142685159 17:1573340-1573362 CACCCGGGAGCCTCTGCTGGGGG + Intronic
1143473411 17:7190326-7190348 CCTCGAGGAGCACCCGCTGCAGG - Exonic
1144812105 17:18007054-18007076 TCTCCAGGAGCTTCTCGTGGTGG - Exonic
1145220779 17:21086542-21086564 CCTCCATGAGTCTCTGCTAGTGG + Intergenic
1145766364 17:27460743-27460765 CTCCCAGGAGCATCTGATGATGG + Intronic
1147427971 17:40355300-40355322 GCTGCAGGAGCCGCTGCTGGAGG + Exonic
1147531298 17:41280656-41280678 GCTACAGGAGCATCTGCTGTGGG + Intergenic
1148214871 17:45829077-45829099 CCTTCCTGAGCATCTGCTGAGGG - Intronic
1148392564 17:47283383-47283405 CCTGAAGGAGAATCTGCTGAAGG + Exonic
1148606163 17:48930597-48930619 CCTCCAGGAACACCTGCTGAAGG - Exonic
1148734635 17:49858571-49858593 CCTCCGGGAGCACTGGCTGGTGG - Intergenic
1148790538 17:50170274-50170296 CCTCCTGGTGCCCCTGCTGGTGG + Exonic
1148911895 17:50947278-50947300 CCTCCTGGAGGGTCTGCAGGGGG + Intergenic
1151258545 17:72898859-72898881 CCTCCCTGAGCAACTGCTGCAGG - Intronic
1151357723 17:73570384-73570406 CCTCCAGGTGCATGTGAGGGTGG + Intronic
1151747343 17:76018585-76018607 CCCCCAGGTGCAGCTGCTGCAGG - Exonic
1152586233 17:81190652-81190674 CCTCCAGCTCCAGCTGCTGGCGG + Exonic
1152597935 17:81246954-81246976 CCAGCAGGAGAAGCTGCTGGCGG - Exonic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1152946305 17:83199315-83199337 CCGCCGGGAGCAGGTGCTGGGGG + Intergenic
1153043069 18:832257-832279 CCTCCAGGAGAAGCTGCAGCGGG + Intergenic
1153679970 18:7491307-7491329 CCAGGAGCAGCATCTGCTGGTGG + Intergenic
1155174396 18:23290058-23290080 TCTCCAGGGGCCTCTGATGGAGG - Intronic
1157226523 18:45870578-45870600 CCTCCATGAGCATCTGGTCAGGG + Exonic
1157294585 18:46433452-46433474 CTTCCAGGAGCTGCTGCTGCAGG - Exonic
1157586873 18:48806638-48806660 CCTCCAGCAGCATCTCCCTGTGG + Intronic
1158198885 18:54918314-54918336 CCTGCAGATGCAGCTGCTGGTGG + Intronic
1158503764 18:58027664-58027686 CCTCCATGATCATGTGCTCGTGG - Intergenic
1159766141 18:72490512-72490534 CCTCAAGCATCATCTTCTGGTGG - Intergenic
1160328246 18:77969439-77969461 CTCCCAGGAGCAGCTCCTGGAGG + Intergenic
1160597041 18:79982881-79982903 CATCCAGCAGCATCTGCTGGTGG + Intronic
1161931833 19:7345762-7345784 CCTGCAGGAGCTCCAGCTGGGGG - Intergenic
1162123203 19:8485117-8485139 CCTCTAGGATGCTCTGCTGGGGG - Intronic
1162943730 19:14030063-14030085 CTTCCAGGGGCACATGCTGGAGG - Intronic
1163504571 19:17697875-17697897 CCTCCAGGTGCATCTGCATTTGG + Intergenic
1164565169 19:29320808-29320830 ACTCCAGGTGCAAGTGCTGGGGG + Intergenic
1166231715 19:41428486-41428508 CCTCCAGGGGCCCCTGCTGTTGG + Intronic
1166560165 19:43727529-43727551 GGTCCAGCAGCACCTGCTGGAGG - Intergenic
1167145543 19:47679479-47679501 CCTCTTGGAGGCTCTGCTGGAGG - Exonic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1167437910 19:49490544-49490566 CCCCCAGCCGCATCTTCTGGCGG + Exonic
925258481 2:2509658-2509680 CCTCCAGGAGCTTCTACTCATGG + Intergenic
925414739 2:3661482-3661504 GGCCCAGGACCATCTGCTGGAGG + Intronic
925784547 2:7418380-7418402 CCTACAGAAGCTTCTGCTTGTGG + Intergenic
925858912 2:8156416-8156438 CCTCCAGGTGCTGCTGATGGTGG - Intergenic
925871790 2:8278162-8278184 GGACCAGGAGCATGTGCTGGGGG - Intergenic
926112742 2:10193303-10193325 CCTCCCGGAGCTGCTGCTGTGGG + Intronic
926140871 2:10367091-10367113 CCGGGAGGAGCATCTGGTGGAGG + Intronic
927240977 2:20919314-20919336 GCTCAAGCAGCAGCTGCTGGGGG - Intergenic
927496130 2:23553162-23553184 TTTCCAGCAGCATCTGCTGCAGG - Intronic
927704246 2:25287238-25287260 CCTGCAGCTGCACCTGCTGGTGG - Intronic
927808564 2:26169427-26169449 GCTCCAGGAGAGTCAGCTGGGGG - Intergenic
928914783 2:36459184-36459206 TCTCCAGGAGAGTCTGCTGATGG - Intronic
929773789 2:44915118-44915140 CCTCCAGGTGGTTCTGATGGAGG + Intergenic
930089363 2:47520663-47520685 CCTGAAGGAGAATCTGCTGGGGG + Exonic
930739765 2:54819273-54819295 ACTCCAGGAGATTCTGATGGAGG - Intronic
930864997 2:56113764-56113786 CCTCCTGAAACATCTCCTGGTGG + Intergenic
930979689 2:57508537-57508559 CCTCCAGGAGATTCTGATGCAGG + Intergenic
931209832 2:60182083-60182105 CCTCCAGCAGCCTCTGCCTGTGG + Intergenic
934470772 2:94531612-94531634 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
934588460 2:95526439-95526461 GCTCCAGGAGCCTCTGCATGAGG - Intergenic
934936927 2:98472372-98472394 CAGCCAAGAGAATCTGCTGGGGG - Intronic
935271983 2:101442840-101442862 CCGCCAGGAGCATCAGTAGGAGG - Intronic
935676058 2:105595797-105595819 CCTGCAGGAGTCTCTGCTGTGGG + Intergenic
937570744 2:123356275-123356297 ACTCCAGCAGCTTTTGCTGGAGG + Intergenic
937603036 2:123762216-123762238 ACTGCAGGAGCATCTGTAGGTGG - Intergenic
939466506 2:142562944-142562966 CCTCAAGCAGCTTCTGCTGCAGG - Intergenic
940227871 2:151419151-151419173 CCTTCTGGAGTATCTGCTGAAGG + Intronic
941107153 2:161367481-161367503 ACTGCAGGAGCATCTGTAGGTGG - Exonic
942347588 2:175019053-175019075 TCACCAGGAGCAGATGCTGGAGG + Intergenic
946202111 2:218076468-218076490 GCGCCAGGAGCAGCTGCTGAGGG + Exonic
946821879 2:223638361-223638383 CCTCCAGGAGATTCTGATGCAGG - Intergenic
948051082 2:234979824-234979846 CCTCCAGGGTCATCTGGGGGAGG - Intronic
948260521 2:236601056-236601078 CCTGCAGGAGCAGGTGGTGGTGG + Intergenic
948446025 2:238033524-238033546 CCTGCAGGTGCCTCTGCTGTAGG - Intronic
948463805 2:238142810-238142832 CCTCCTCCAGCTTCTGCTGGAGG - Exonic
948665474 2:239532085-239532107 CCTCCAGGGACCTCTGATGGAGG - Intergenic
949060400 2:241953416-241953438 CCTCCAGGAGCAGCCGCGTGCGG - Intergenic
1170142096 20:13134622-13134644 CCTCCAGGAGATTCTGGTGCAGG + Intronic
1171414078 20:24965685-24965707 CCTCCCTGACCATGTGCTGGAGG - Intronic
1172275490 20:33676878-33676900 GCTCCTGGAGCATGTGCGGGAGG - Exonic
1172882744 20:38212521-38212543 GATCCAGGAACCTCTGCTGGGGG - Exonic
1174447777 20:50602161-50602183 CCTCGAGGGGCCTCTGCAGGAGG - Exonic
1175338825 20:58214575-58214597 CCTCCAGCAGCCTCTGCAGCCGG - Intergenic
1175487580 20:59356484-59356506 CCTTCTGAAGGATCTGCTGGAGG - Intergenic
1175514679 20:59561390-59561412 CCTTCAGGAGCAGCTGATGCAGG + Intergenic
1175771373 20:61626672-61626694 GCTCCAGGACCACCTGCTGCTGG - Intronic
1175823321 20:61923606-61923628 CCTCCAGGCGGATCAGCTTGTGG - Exonic
1175893873 20:62327516-62327538 CCTGCAGGCGCACCTCCTGGCGG + Exonic
1176423210 21:6532711-6532733 CCTCCAGGTGCAGCTGCTCCAGG + Intergenic
1176762610 21:12971059-12971081 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
1177757201 21:25362045-25362067 CCCCCAGCCGCATCTTCTGGCGG + Intergenic
1178127359 21:29529543-29529565 GCTGCAGGAGCATCTGATGGGGG + Intronic
1179592109 21:42415670-42415692 GCTTCAGCAGCATCTGCTGGAGG - Intronic
1179698703 21:43141027-43141049 CCTCCAGGTGCAGCTGCTCCAGG + Intergenic
1179958308 21:44753437-44753459 CCCCCAGGAGCCTCTGAGGGTGG - Intergenic
1180900877 22:19371226-19371248 CCCCCAGGAGGATGTGCTGCGGG - Intronic
1181175028 22:21030394-21030416 CCACCAGGGGCCTCTGCTGGGGG + Intronic
1181634291 22:24167163-24167185 CCTCCAGGAGCTTCCTCTTGCGG - Exonic
1182044666 22:27264866-27264888 CCTCCAGGAGTTTTTGGTGGGGG + Intergenic
1182619516 22:31611234-31611256 CCTCCAGCAGCAGCTGCCGGTGG - Exonic
1182714731 22:32348423-32348445 CCTGGAGGAGCAGCTGCTGCTGG - Intergenic
1183489978 22:38110980-38111002 CCTCCAGGGGCTGCTGCTGCTGG - Intergenic
1184149592 22:42630516-42630538 CTTCCTGGAGCCTCTGCTGCAGG + Intronic
1184189310 22:42884420-42884442 CTTCCGGGAGGTTCTGCTGGAGG - Exonic
1184743449 22:46442496-46442518 CCTTCAGGAGCCACAGCTGGGGG - Intronic
949343205 3:3051545-3051567 CCTCCAGGAGAATGGGCTGATGG - Intronic
949815684 3:8055363-8055385 TCTCCAGTAGCAGATGCTGGAGG - Intergenic
950228902 3:11259109-11259131 CCACCAGGGGCATCAGCTGGGGG - Exonic
950636678 3:14320367-14320389 CCTCCAGAAGCATGTTATGGTGG + Intergenic
950836126 3:15920674-15920696 CCTCCAGGAGATTCTGATGCAGG + Intergenic
951778608 3:26338118-26338140 CCACCAGGAACAAGTGCTGGTGG + Intergenic
952581480 3:34838482-34838504 CCTCCTGGAGGATCTGAGGGAGG + Intergenic
952885865 3:38010598-38010620 CAGCCAGGAGCGCCTGCTGGAGG - Intronic
953454189 3:43029120-43029142 CCTCCAGCAGCAGCTTCAGGTGG + Intronic
953531041 3:43740185-43740207 CCTCCAGCAGCTTCTGCTCCAGG - Intergenic
953878312 3:46678894-46678916 CCTCCAGGGACAGCTGCTCGAGG + Intronic
954292411 3:49656562-49656584 CCAGGAGCAGCATCTGCTGGTGG - Exonic
954368012 3:50156283-50156305 CCTCCTGTCCCATCTGCTGGGGG - Intronic
956054289 3:65282000-65282022 AGTCCAGGAGCATCTGGTGAGGG - Intergenic
958450162 3:94263040-94263062 CCTGCAGGTGCCTCTGCTGAGGG + Intergenic
959065174 3:101648747-101648769 CCCACAGTAGCATCTGGTGGGGG + Intergenic
959066843 3:101666105-101666127 CCTCAAGAAACAGCTGCTGGAGG + Intronic
960664127 3:120094074-120094096 GCGCCAGGAGCAGCTGCAGGCGG + Intronic
961485398 3:127212388-127212410 CTTCCAGAAGCTTCTGCTTGAGG - Intergenic
961685268 3:128625602-128625624 GCTGCAGGAGCCCCTGCTGGTGG - Exonic
961713213 3:128842733-128842755 CCTCCAGCAGCCTCTGTTGGGGG - Intergenic
963466277 3:145686439-145686461 GCTCCAAAAGCAGCTGCTGGTGG - Intergenic
964930012 3:162007202-162007224 CCTCCAGCAGCATTTGCTGAAGG - Intergenic
965834738 3:172838791-172838813 CCTACTGGAGCCACTGCTGGAGG - Intergenic
966854635 3:184185766-184185788 CCTCGAGGCGCGTCTGCTGCTGG - Intronic
969362195 4:6672079-6672101 GTTCCAGGAGCATCTGCCCGAGG + Intergenic
969452812 4:7284556-7284578 CCTCCTGGAGCACCTGCTGAGGG - Intronic
969716616 4:8871151-8871173 CCTCCCTGCGCATTTGCTGGGGG - Intronic
969806289 4:9611489-9611511 CCTCTTTGAGCATCTGCTTGGGG + Intergenic
969987305 4:11225520-11225542 CCTCCAGGAGCCCCAGCTGCAGG - Intergenic
970378317 4:15480757-15480779 CCCCCAGGAGCCTGTGCAGGAGG + Exonic
973729337 4:53808645-53808667 CCTCTAGAAGCTTCTGCTGGAGG + Intronic
974237207 4:59197515-59197537 CCCCCAGGATCAACTGGTGGTGG + Intergenic
974877585 4:67717256-67717278 GCTCCAGGACCATCTTCTTGGGG + Intergenic
980097285 4:128504454-128504476 CCTGTAGCAGCATCTGCAGGGGG + Intergenic
984113591 4:175650029-175650051 CCTCCAGTAGCATTTGCTGTGGG + Intronic
985836711 5:2277176-2277198 CCTCCAGGGGCATCTGAGGGTGG + Intergenic
987091102 5:14508260-14508282 CCTCCAGGAGCAGTGGCTGCAGG + Exonic
992058002 5:73011959-73011981 CCTCCTGAAGGACCTGCTGGAGG + Intronic
992106361 5:73451691-73451713 CCTCCAGGAGCCCCTGCGCGGGG + Intergenic
992195666 5:74336553-74336575 CCTCCAGAAGCAGCTGCCTGCGG - Intergenic
994172087 5:96668957-96668979 CCTCCAGTAGCACCTCCTGCAGG - Intronic
994680290 5:102878530-102878552 CCTCCTGAAGGACCTGCTGGAGG - Intronic
994789722 5:104207716-104207738 CCTCAAGGGGCATCTGGAGGAGG + Intergenic
994835089 5:104841260-104841282 CCCTCAAGAGCATCTGCTTGTGG + Intergenic
995637136 5:114206398-114206420 GATTCAGGAGCTTCTGCTGGAGG - Intergenic
996179994 5:120407312-120407334 CCTACAGGAGCATCACCTAGCGG + Intergenic
996403840 5:123088542-123088564 CCTCCAGGACCAGCTGCTCTCGG + Intergenic
996690419 5:126334196-126334218 ACTCCAGGAAGATCAGCTGGGGG + Intergenic
996747189 5:126855150-126855172 CTGCCAGGAGCAGCTGCTCGTGG - Intergenic
999799058 5:155016367-155016389 CATCCAGCAGCTTCTGCTGTAGG - Exonic
1000410749 5:160933526-160933548 CTTCCAGGAGCAGCTGCAGATGG - Intergenic
1001549039 5:172588657-172588679 CTGCCAGGAGCACCAGCTGGAGG + Intergenic
1001616236 5:173045644-173045666 GCTCCAGGGGCATGTCCTGGAGG + Intergenic
1001747162 5:174100631-174100653 TTTCCAGAAGCATTTGCTGGAGG + Intronic
1002065626 5:176650329-176650351 CCTCCAGGAACTCCTGCTGGAGG + Intronic
1002394294 5:178941262-178941284 CTTCGAGGAGCCTCTGCCGGCGG - Exonic
1004102442 6:12627713-12627735 CTTCCTGGAGGATCTGCAGGAGG + Intergenic
1004464656 6:15873301-15873323 GCTCCAGGTGCATCAGCTGGCGG - Intergenic
1004588011 6:17021387-17021409 GCTACAGGAGCATCCGCTGCAGG - Intergenic
1006164886 6:32058304-32058326 CCCCGAGGAGCCTCTCCTGGGGG - Intronic
1006582853 6:35086761-35086783 CCTCCTGGAGCATCTTGGGGAGG - Intronic
1007150320 6:39684141-39684163 CCTTCATGAGTATCTGCTGCAGG - Intronic
1007172706 6:39875379-39875401 CCTGGAGGACAATCTGCTGGAGG - Exonic
1007227132 6:40322844-40322866 CTTCCAGGTGCAGCTGCTGCTGG + Intergenic
1007721490 6:43887867-43887889 CCTCCAGAGGCTTCTCCTGGCGG - Intergenic
1008921122 6:56844335-56844357 CCCACAGGCGCATCTGCTGCTGG + Intronic
1015430789 6:133128500-133128522 CCTCCAGAAGCTTCTGCTAGGGG + Intergenic
1015468787 6:133578550-133578572 CTTCCTTGAGCATTTGCTGGGGG - Intergenic
1017845571 6:158255180-158255202 CCTCCAGCAACACCTGCAGGGGG - Intronic
1018807294 6:167271151-167271173 TCTCCAGGTGCTTCTGCTGAGGG + Intronic
1018807318 6:167271306-167271328 TCTCCAGGTGCTTCTGCTGAGGG + Intronic
1019261753 7:85907-85929 CTTCCAGGAGCATATGATGAAGG - Intergenic
1019283151 7:210640-210662 CATTCAGGAGCATCCCCTGGAGG + Intronic
1019335258 7:479795-479817 CCTCCACCACCATCAGCTGGAGG + Intergenic
1020012696 7:4815379-4815401 ACTCCAGGAGCTGCTGCAGGCGG + Exonic
1020427580 7:8086466-8086488 CCTGCAGGAGCTGCTGCTGCTGG - Exonic
1020945239 7:14597015-14597037 CCTTCAAGAGCATCTGCTTCTGG + Intronic
1021474706 7:21047887-21047909 CCTCCAGGTGCTTCTGATTGGGG - Intergenic
1022976994 7:35567774-35567796 CCCACAGTAGCTTCTGCTGGAGG - Intergenic
1024076986 7:45826211-45826233 CATACAGGAGGGTCTGCTGGTGG - Intergenic
1024167554 7:46749957-46749979 CCTCCAGGAGCTTATACTGATGG + Intronic
1024254287 7:47528272-47528294 CATCAGGGACCATCTGCTGGGGG + Intronic
1024675979 7:51638291-51638313 TCTGCAGGAGCATCAACTGGGGG - Intergenic
1024923470 7:54586800-54586822 CCTCCTGGAGGACCTGCCGGAGG + Intergenic
1025127435 7:56355206-56355228 CATACAGGAGGGTCTGCTGGTGG + Intergenic
1025309589 7:57914506-57914528 CTTCCTGGAGCATCTGCCAGAGG - Intergenic
1026971747 7:74472821-74472843 GCTCCAGAGGCATCTGCAGGAGG - Intronic
1029557713 7:101281928-101281950 CATGCAGGAGGGTCTGCTGGTGG + Intergenic
1030523280 7:110624361-110624383 CATTCAGGAGCATTTTCTGGTGG - Intergenic
1031240762 7:119236452-119236474 ACTCCAGAAGCATCAGCTTGTGG - Intergenic
1031992919 7:128209562-128209584 CCTCCAGCAGCTTCTGCTTAGGG - Intergenic
1033221153 7:139526797-139526819 CCTCCTGCAGCCCCTGCTGGGGG + Intronic
1033647483 7:143316335-143316357 CCTTCCGGAGCCTGTGCTGGAGG - Exonic
1034498014 7:151433533-151433555 CAGCCTGGAGCACCTGCTGGGGG + Intronic
1034835912 7:154351530-154351552 CCTCCAGGTGCAGGTGCAGGTGG - Intronic
1034984952 7:155505604-155505626 CCTCCTGGAGCATCTGAGAGAGG + Intronic
1035071056 7:156145312-156145334 CCTCCAGGTTCATCTGGTGCTGG - Intergenic
1036602647 8:10276221-10276243 CCTCCTGGAGCAGCTGTTTGGGG + Intronic
1037817178 8:22118409-22118431 CCTCCGGGAGCATCTCCTCCAGG + Intronic
1037897479 8:22667685-22667707 CCTCCTGGAGCAAATGGTGGAGG + Intronic
1039919106 8:41880795-41880817 CCACCAGGCGCCTCTGCCGGGGG - Intronic
1041170897 8:55141284-55141306 TCTCCAGACGCATCTCCTGGAGG + Intronic
1042819689 8:72916478-72916500 CCTGCAGCAGCATCTGAGGGTGG + Intronic
1044803823 8:95984235-95984257 ACAGCAGGGGCATCTGCTGGTGG + Intergenic
1047550685 8:125869384-125869406 CCTCCAGGAGCCAGTGATGGAGG + Intergenic
1048149732 8:131883031-131883053 TGTCCTGCAGCATCTGCTGGTGG - Intergenic
1048331828 8:133475889-133475911 GCTCCAGGACCATCTGCTTGGGG + Exonic
1048835229 8:138512993-138513015 ACTCCAAGAGCCTCTGCTGAAGG + Intergenic
1048872153 8:138808020-138808042 CCTCCAGGTGCAGCTACCGGTGG + Intronic
1049501636 8:142970680-142970702 CCTCCAGGAAGATTTGCTGGGGG + Intergenic
1049622895 8:143606544-143606566 GCTCCTGCAGCATCTGCTGGAGG - Exonic
1049642308 8:143721221-143721243 ACTCCAGGATCATCTGCGGGAGG - Exonic
1049646412 8:143737847-143737869 CCTCCAGCAGCAGCTGCTCCTGG + Intergenic
1049671516 8:143872179-143872201 GCTCCATGAGCAGCTCCTGGTGG - Exonic
1049753151 8:144295152-144295174 CCTAGAAGAGCCTCTGCTGGTGG - Intronic
1053338591 9:37301730-37301752 CCTCCAGGAGGATCCACAGGAGG - Intronic
1058867778 9:109177372-109177394 CCTCCAGAAGAATCACCTGGAGG - Intronic
1058867779 9:109177372-109177394 CCTCCAGGTGATTCTTCTGGAGG + Intronic
1060262453 9:122088347-122088369 CCTCCAGGAGCTCCTGGTGTAGG - Intronic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1061084305 9:128390291-128390313 GCTGGAGGAGCAGCTGCTGGCGG - Exonic
1061117847 9:128625936-128625958 CCTCCAGAAGCTTCTTCTTGCGG - Exonic
1061269090 9:129526401-129526423 TCTGCAGGGGCATCTGTTGGTGG - Intergenic
1061449424 9:130660434-130660456 CCTCCCGAAACATCTGCCGGGGG - Intergenic
1061720216 9:132546738-132546760 CCACCAGGGGCAGTTGCTGGTGG - Intronic
1061857293 9:133449320-133449342 CCTCCTGGAGCAAATGCAGGGGG + Intronic
1061952850 9:133945856-133945878 CCACCTGGAGCACCTGCTGTGGG - Intronic
1062208122 9:135348397-135348419 ACTCCAGGAGCTGCTGGTGGTGG + Intergenic
1062279680 9:135746412-135746434 CCTCAAAGAGAAGCTGCTGGGGG + Intronic
1062335072 9:136061389-136061411 CCTCCAGGCCCAGATGCTGGAGG + Intronic
1062422602 9:136490561-136490583 CCACCAGGAACCGCTGCTGGTGG + Intergenic
1062497857 9:136840030-136840052 CCTCCAGGAGGCCCTGCTGATGG - Intronic
1186033812 X:5398875-5398897 CCTCCTGGAGCACCTGCCTGAGG - Intergenic
1186916446 X:14227552-14227574 GCTCCTGGACCATCTGCTTGAGG - Intergenic
1188468018 X:30504899-30504921 TCTCCAAGAGCATCTGCTATGGG - Intergenic
1189097173 X:38152560-38152582 CCTCCAGGGGATTCTGATGGAGG + Intronic
1192355830 X:70402584-70402606 CATCCAGCAGCTTCTGCTGTAGG - Exonic
1193372922 X:80720228-80720250 CCTCCAGGAGGACCTTCTTGAGG - Intronic
1198312621 X:135436616-135436638 CCTTCAGCAGCCTCTGCCGGAGG - Intergenic
1199314951 X:146365979-146366001 CCTGAAAGAGAATCTGCTGGTGG + Intergenic
1200055192 X:153456560-153456582 GATTCAGGAGCATCTGCAGGTGG + Exonic
1200150020 X:153946798-153946820 ACTCCAGGAGCTTCTGGTAGCGG + Intergenic
1200182512 X:154159355-154159377 CCTTAAGGTCCATCTGCTGGAGG + Intergenic
1200188166 X:154196469-154196491 CCTTAAGGTCCATCTGCTGGAGG + Intergenic
1200193816 X:154233609-154233631 CCTTAAGGTCCATCTGCTGGAGG + Intergenic
1200199571 X:154271413-154271435 CCTTAAGGTCCATCTGCTGGAGG + Exonic