ID: 1077033794

View in Genome Browser
Species Human (GRCh38)
Location 11:483970-483992
Sequence CACTGGTGCAGCCTGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077033787_1077033794 14 Left 1077033787 11:483933-483955 CCACTGTCAATCCATAGTGCATT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1077033794 11:483970-483992 CACTGGTGCAGCCTGCATGGAGG 0: 1
1: 0
2: 2
3: 22
4: 261
1077033789_1077033794 3 Left 1077033789 11:483944-483966 CCATAGTGCATTCTCCACAAGGA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1077033794 11:483970-483992 CACTGGTGCAGCCTGCATGGAGG 0: 1
1: 0
2: 2
3: 22
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077033794 Original CRISPR CACTGGTGCAGCCTGCATGG AGG Intronic
900079325 1:843803-843825 CTCAGGTGCAGCCACCATGGAGG + Intergenic
900946609 1:5834501-5834523 CCTGGGTGCAGCCTGCAGGGAGG + Intergenic
900967162 1:5966783-5966805 CTCTGCTGCTGCCTGCCTGGAGG - Intronic
901735726 1:11310982-11311004 AACTTGTGAAGCCTGCATGGCGG + Intergenic
901811449 1:11769010-11769032 CCCTGGCCCAGCCTGCATGTGGG - Intronic
902802905 1:18841519-18841541 CTCTGAAGCAGCCTGTATGGAGG + Intronic
905001137 1:34671128-34671150 CCCTGCTGCAGCCTGCATGATGG - Intergenic
907152818 1:52305525-52305547 CCCTGCTGCAGCCAGCATGATGG - Intronic
911039928 1:93583401-93583423 CACTGGGGTAACCTACATGGAGG + Intronic
911700775 1:100949731-100949753 CAATGCTGCAGCCTGGCTGGGGG - Intronic
912205227 1:107501047-107501069 CACTGCTGCAGGATGCTTGGGGG + Intergenic
912393126 1:109318558-109318580 GACTGATGCAGCCTGCAGAGGGG + Intronic
912522431 1:110254840-110254862 CACTGCTGCAGCCTTCTTGTGGG - Intronic
912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG + Intergenic
913125930 1:115790349-115790371 CACTGGTGCAGCATGGCTGCTGG - Intergenic
915285149 1:154847494-154847516 CACTGGGGTTGCCTGCAGGGAGG + Intronic
916188780 1:162159013-162159035 CACTGGCGCCGCTTGCTTGGAGG + Intronic
919314124 1:195948898-195948920 CCCTGCTGCAGCCAGCATGATGG + Intergenic
920879468 1:209866406-209866428 CACTTTTGCAGCCCACATGGAGG - Intergenic
921902155 1:220462834-220462856 CCCTGCTGCAGCCGGCATGATGG - Intergenic
921923755 1:220695066-220695088 CACTGGGTCAGGCAGCATGGGGG + Intronic
922107570 1:222525709-222525731 CACTGGGGCAGGGTGCATGGTGG + Intronic
923899082 1:238305607-238305629 CACTGGTGTACCCTGGATGTGGG + Intergenic
1062895571 10:1100858-1100880 CCCTGCTGCAGCCTGTCTGGGGG + Intronic
1064537136 10:16368922-16368944 CCCTGCTGAAGGCTGCATGGCGG - Intergenic
1067508570 10:46876810-46876832 CACTTCTCCAGGCTGCATGGAGG + Intergenic
1067653678 10:48175039-48175061 CACTTCTCCAGGCTGCATGGAGG - Intronic
1067739844 10:48887174-48887196 CCCTGGTGCAGGCACCATGGAGG + Intronic
1069731900 10:70622520-70622542 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1070514303 10:77189432-77189454 CACTGGTGAAGCTTGCACAGTGG - Intronic
1070865750 10:79707206-79707228 CGGTGGTGGAGCCTGCATAGGGG + Intronic
1071328902 10:84541556-84541578 CAGATGTGCAGCCTGCCTGGGGG - Intergenic
1072335718 10:94396041-94396063 CCCTGCTGCAGCCGGCATGATGG + Intergenic
1073082830 10:100870873-100870895 CACTGTTGCAGCCAGCTTTGCGG + Intergenic
1074785595 10:116836383-116836405 CAGTGCTGCAGGCTCCATGGCGG - Intergenic
1076342438 10:129758992-129759014 CAAGGGGCCAGCCTGCATGGTGG + Intronic
1076768481 10:132650638-132650660 CACTCCCGCAGCCTGCTTGGTGG + Intronic
1077033794 11:483970-483992 CACTGGTGCAGCCTGCATGGAGG + Intronic
1077461337 11:2712283-2712305 CACTGGTGACCCCTGCCTGGGGG + Intronic
1082800307 11:57409521-57409543 TCCTGGTGCAGCCTGCATGAGGG - Intronic
1083273249 11:61582595-61582617 CACTGGAACAGTCTTCATGGAGG - Intergenic
1084398755 11:68931655-68931677 CCCTGCTGCAGCCGGCATGATGG + Intronic
1084429528 11:69103410-69103432 CTCTGCTCCATCCTGCATGGGGG + Intergenic
1084451942 11:69244292-69244314 CCCTGGTGCAGTCCCCATGGGGG + Intergenic
1084614319 11:70225776-70225798 CAGGGGTCCAGCCTGTATGGGGG + Intergenic
1085391672 11:76185344-76185366 TACTGGTGCTGCCTCCATGAGGG + Intergenic
1087701163 11:101438352-101438374 CTCTGGAGCAGCCTGCCAGGAGG - Intergenic
1088902720 11:114130326-114130348 CCCTTGTGCACCCTGCAGGGTGG + Intronic
1091146210 11:133282585-133282607 CCCTGGTGGAAACTGCATGGGGG - Intronic
1091322567 11:134662646-134662668 CAAGCCTGCAGCCTGCATGGAGG - Intergenic
1091487169 12:900606-900628 CACTGGTGAAGGCTGAATAGAGG - Exonic
1093566824 12:20616312-20616334 TACTGGTGCAGGCTCCAAGGTGG - Exonic
1093777967 12:23099407-23099429 CCCTACTGCAGCCTGCACGGAGG + Intergenic
1094720989 12:33063606-33063628 GACTCTTGCAGCCTGGATGGGGG + Intergenic
1097544534 12:60982522-60982544 TAGAGTTGCAGCCTGCATGGTGG + Intergenic
1097889121 12:64759497-64759519 GACTGGCGCAGCCTGGAGGGAGG + Intergenic
1100057065 12:90524765-90524787 CTCTGGTGGAGTTTGCATGGGGG - Intergenic
1100138477 12:91585877-91585899 AACTGCTGCAGCCTGAATGAAGG - Intergenic
1100535884 12:95508540-95508562 CACTGTAGCAGTCTGCTTGGGGG + Intronic
1100847723 12:98678325-98678347 CCCTGCTGCAGCCAGCATGATGG - Intronic
1101462785 12:104913708-104913730 CAGGGTTGCAGCCTGCAAGGTGG - Intronic
1102504024 12:113372564-113372586 CTCTGGGGCAGCCTGGGTGGGGG + Intronic
1102588507 12:113940149-113940171 CTCTGCTGCAGCCTGCAAAGAGG + Exonic
1104184668 12:126418982-126419004 CACTGGAGCTTCATGCATGGTGG + Intergenic
1104209948 12:126679036-126679058 CACTGATGTAGCCTTCATGGTGG - Intergenic
1104566994 12:129894190-129894212 CAAAGGCACAGCCTGCATGGTGG + Intronic
1104587056 12:130055992-130056014 CACTGCTGCACCCTCCATGCCGG - Intergenic
1104844830 12:131841498-131841520 CTCTGGCGCAGCCGGCATCGAGG + Intronic
1105041697 12:132966437-132966459 CGCTGCTGCAGCCTGCATGATGG - Intergenic
1106105147 13:26726411-26726433 CACAGGTGTAGCCTCTATGGTGG - Intergenic
1106571850 13:30934642-30934664 CCCTGCTGCAGCCAGCATGATGG - Intronic
1107234856 13:38155684-38155706 CCCTGGTGTAGCCAGCATGATGG + Intergenic
1107412705 13:40172487-40172509 CACGGGGGCAGCCTGGATGGAGG + Intergenic
1107922072 13:45219081-45219103 GAATGGTTCAGCCTGCATAGTGG + Intronic
1108088145 13:46817912-46817934 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1109426042 13:62167647-62167669 CCCTGCTGCAGCCAGCGTGGTGG - Intergenic
1109633815 13:65086304-65086326 CCCTGCTGCAGCCAGCATGATGG + Intergenic
1110008037 13:70297036-70297058 CCCTGCTGCAGCCAGCATGTTGG - Intergenic
1113587942 13:111478349-111478371 TGCTGGTACAGGCTGCATGGAGG + Intergenic
1113949448 13:114063789-114063811 CACTGGTCCAGACTCCCTGGAGG - Intronic
1114778701 14:25514913-25514935 GGCTGGTGCAGCTGGCATGGAGG + Intergenic
1115725811 14:36215097-36215119 CTTTGGTGCAGGGTGCATGGTGG + Intergenic
1116674019 14:47881484-47881506 CAGGGTTGCAGCCTGCAAGGTGG - Intergenic
1117505595 14:56399448-56399470 CACTGGTCCAGCCTCCATTCTGG - Intergenic
1117690760 14:58302707-58302729 CACTTGGGAAGCCTGAATGGGGG + Intronic
1119853268 14:77881289-77881311 CACTCGTGCAGCCTGCAGAGGGG - Intronic
1120755971 14:88244689-88244711 CACTTCTGCAGCCTGAATGCAGG - Intronic
1121541348 14:94729194-94729216 CACTGTTACAGCCTGCAAGCAGG + Intergenic
1122097343 14:99381483-99381505 CAGTGGTGCAGCCTCCAGGTGGG - Intergenic
1123090308 14:105739360-105739382 GACAGGTGGAGACTGCATGGGGG + Intergenic
1124375666 15:29127330-29127352 CAGTGGAGTTGCCTGCATGGGGG + Intronic
1125450897 15:39806003-39806025 GCCTGGTGCTGTCTGCATGGAGG - Intronic
1125841442 15:42804846-42804868 TACTGGTGCAGCCTGATTTGGGG + Intronic
1126318392 15:47395663-47395685 CACTGGTATAGCTTGCCTGGTGG - Intronic
1129038661 15:72665929-72665951 CGCTGGTGCAGGCTCCAGGGTGG + Intronic
1129211230 15:74071301-74071323 CGCTGGTGCAGGCTCCAGGGTGG - Intronic
1129399173 15:75269786-75269808 CACTGGTGCAGGCTCCAGGGTGG + Intronic
1129402780 15:75294062-75294084 CACTGGTGCAGGCTCCAGGGTGG + Intronic
1129796620 15:78382311-78382333 CCCTGCTGCAGCCCGCATGATGG - Intergenic
1131478706 15:92763694-92763716 CACTGGTCCAGTCGGCCTGGGGG - Intronic
1132382109 15:101373199-101373221 CGCTGCTGCTGCCTGCAGGGAGG + Intronic
1132945319 16:2528983-2529005 CCATGCTGCAGCCTGCTTGGGGG - Exonic
1133366367 16:5213531-5213553 CACTGGTGGAGCAGGCATGGTGG - Intergenic
1134045369 16:11097217-11097239 CACTGGGACAGCCTTCCTGGAGG - Intronic
1134659538 16:15973599-15973621 CAATGGTGTAGCCTGCTTGTTGG + Intronic
1135046446 16:19159712-19159734 CGCGGGTGCAGCCTGGCTGGTGG + Intronic
1135132110 16:19861735-19861757 CACATGGGCAGCCTCCATGGAGG + Intronic
1135629739 16:24026849-24026871 CAGTGGTGGAGCTCGCATGGAGG - Intronic
1136778212 16:32882598-32882620 CACTGGCACAGTCTTCATGGCGG + Intergenic
1136892409 16:33978916-33978938 CACTGGCACAGTCTTCATGGTGG - Intergenic
1138717673 16:59042878-59042900 AAGTGTTGCAGCCTGCAGGGTGG - Intergenic
1142025092 16:87808307-87808329 CACTGGTGCAGACAGGGTGGTGG + Intergenic
1203080633 16_KI270728v1_random:1144707-1144729 CACTGGCACAGTCTTCATGGCGG + Intergenic
1143840103 17:9725157-9725179 CACTGGTGCCATCTGCATGGAGG + Intronic
1144136909 17:12304013-12304035 CATTGGTACAGCCTCCATGGAGG - Intergenic
1144701363 17:17343053-17343075 CGCTGGTGCAGGCTGGATGGGGG - Intronic
1146053890 17:29571858-29571880 CCCTGGTGCTGACTGCATGGGGG + Exonic
1147189338 17:38729939-38729961 GACTGATGCACCCTGCGTGGTGG - Intergenic
1147214861 17:38893249-38893271 GACTGGTGCATCCTGCAGGGTGG - Intronic
1147716562 17:42512652-42512674 CAGGGGTGCAGCCAGCGTGGAGG - Intronic
1148856894 17:50583845-50583867 CATTGGTGCAGGCTGGGTGGAGG + Intronic
1149028801 17:52061381-52061403 CACTAGGGCAGCCTGCATTATGG - Intronic
1150952635 17:69821029-69821051 CCCTGCTGCAGCTGGCATGGTGG - Intergenic
1152829244 17:82486969-82486991 CTCTGGTGCAGCCTCCAGGCAGG + Intronic
1154163117 18:11994730-11994752 CCATGGTGCACCCTGCATGGGGG - Intronic
1160450743 18:78964889-78964911 CGCTGGTGCAGCCTGCAGGTCGG - Intergenic
1160450815 18:78965134-78965156 CGCTGGTGCAGGCTGGGTGGAGG - Intergenic
1160730640 19:640283-640305 GATGGGTGCAGCCTGCCTGGTGG + Intronic
1160871349 19:1279266-1279288 TACTGGTGCAGCCAGTGTGGGGG + Intergenic
1161041207 19:2111593-2111615 CACTCCTGCAGCCTCCATGCGGG - Intronic
1162762383 19:12896400-12896422 CCCTGGTGCATCCAGCCTGGGGG + Exonic
1162948028 19:14055180-14055202 CACTAGTCCAGCCGGCAGGGAGG + Exonic
1164755022 19:30682759-30682781 CAGAGGTGCTGCCTGGATGGAGG - Intronic
1164989234 19:32672776-32672798 TACTGGTGGAGGGTGCATGGTGG - Intronic
1165078690 19:33295325-33295347 CAATGGTGCGGCTTGCTTGGCGG + Intergenic
1165319370 19:35076018-35076040 CGCTGTTGAAGCCTGCCTGGGGG - Intergenic
1166492120 19:43268972-43268994 CTCTGTTGCAGCCTGGATAGGGG - Intronic
1166938724 19:46350360-46350382 GATGGGAGCAGCCTGCATGGGGG + Intronic
1167842108 19:52130790-52130812 CACTGCTGCAGCCTGTGTGTGGG - Intronic
1167863020 19:52300160-52300182 CACTGCTGCAGCGTGCGTGTGGG + Intronic
1167969969 19:53183190-53183212 CACTGCTGCAGCCTGTGTGGGGG - Intronic
926094846 2:10074436-10074458 TACTGGGGGAGACTGCATGGGGG - Intronic
926120108 2:10237228-10237250 CACAGGAGCAGCCTGCAGGGAGG - Intergenic
927072759 2:19547912-19547934 CATTGCTGCAGCCAGCATGATGG - Intergenic
927173716 2:20391017-20391039 CCTTGGTGCAGCCCCCATGGGGG + Intergenic
927637573 2:24827379-24827401 CACTGCTGCAGCCCTCCTGGAGG + Intronic
932501749 2:72188209-72188231 CCCTGCTGCAGCCAGCATGATGG + Intronic
937278455 2:120701539-120701561 ACCTGTTGCAGCCTGTATGGAGG - Intergenic
937436703 2:121887400-121887422 CAGTGCTGCACCCTTCATGGTGG - Intergenic
938415549 2:131100955-131100977 CAAAGGTGCAGCCAGCATGCTGG + Intergenic
941902779 2:170694058-170694080 CACTGGGGGAGCCTGAATGCAGG + Intergenic
942643181 2:178082455-178082477 AAGTGTTGCAGCCTGCAGGGTGG + Intronic
943233615 2:185290243-185290265 CAATGCTGCAGCCTGGCTGGGGG + Intergenic
943526148 2:189020340-189020362 CCTTGCTGCAGCCTGCATGATGG - Intergenic
944586449 2:201177948-201177970 CCCTGCTGCAGCCAGCATGATGG - Intergenic
945984349 2:216341838-216341860 GACTGGAGCAGCCAGGATGGTGG + Intronic
946560937 2:220912837-220912859 AACTGTTGAAGCATGCATGGAGG + Intergenic
946610174 2:221449314-221449336 CACTGGGGCAGCCAGCCTGCAGG + Intronic
947507618 2:230721141-230721163 AACTTTTGCAGCCAGCATGGTGG + Intronic
948836912 2:240630338-240630360 CACGGCCGCAGCCTGCCTGGGGG - Exonic
1169203529 20:3727744-3727766 CAGAGGGGCAGCCTGCAAGGAGG - Intergenic
1170933224 20:20787618-20787640 CACTGGAGAAGCCTGGATGAGGG - Intergenic
1170954342 20:20964646-20964668 CACTGGTGCAGCCTTCACCACGG - Intergenic
1171148983 20:22810350-22810372 CACTGGAGCAGCCTTCAGTGTGG + Intergenic
1171273410 20:23834387-23834409 CCCTGGTGCATCCTGCAGGCAGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172015194 20:31869308-31869330 CACTGGGGAAGGCTGAATGGCGG + Intronic
1172148211 20:32772393-32772415 CACAGGTGCAGCCTGCTGTGAGG + Intronic
1175175223 20:57107575-57107597 CACTGGTCCAGTCTGGGTGGAGG - Intergenic
1178295764 21:31408996-31409018 CACTGATGAAGCCTGGAGGGGGG - Intronic
1178407874 21:32339367-32339389 CAGTGGTAGAGCCTGGATGGTGG - Intronic
1178826920 21:36024915-36024937 GACTGGTGCACCCTGAGTGGAGG - Intergenic
1179470368 21:41606115-41606137 CACTGTCGCAGGCTGAATGGTGG + Intergenic
1179914508 21:44467588-44467610 CCCTGGTGCAGCCTGGGTAGGGG - Intergenic
1180052079 21:45335848-45335870 GCCTGGTGCACCCTGGATGGAGG - Intergenic
1180214993 21:46318176-46318198 CACCGGTGTTGCCTGCAGGGCGG + Exonic
1181046602 22:20217590-20217612 CAGTGCTGCAGGCTGCATGAGGG + Intergenic
1182254058 22:29025445-29025467 CAATGGAGCATCCTGGATGGGGG - Intronic
1182495974 22:30707778-30707800 CAATGGTTCAGGCTGCATGTTGG - Intronic
1182944376 22:34308200-34308222 CAATGGGGCAGCAGGCATGGAGG - Intergenic
1183297261 22:37037657-37037679 CACTGGCGAAGCCTCCATGCAGG - Intergenic
1183723389 22:39575019-39575041 CCCTTGTGGAGCCTGCAAGGTGG + Intronic
1183724399 22:39580499-39580521 CACTGGTGAAGCCTGCCTAGGGG + Intronic
1184144186 22:42598943-42598965 ACCAGGTGCAGCCTGCATGCAGG - Intronic
1184459049 22:44626899-44626921 CTCTGTTGCAGGCTGCAGGGAGG + Intergenic
1184730209 22:46367559-46367581 CCCTTGTGCAGCCGGCACGGGGG - Intronic
1185030752 22:48441694-48441716 CGCAGATGCAGCCGGCATGGAGG + Intergenic
1185092635 22:48784631-48784653 CTCCGGTGCCGCCTTCATGGGGG - Intronic
949951606 3:9233760-9233782 GAGTGGTGCAGTGTGCATGGGGG - Intronic
950522895 3:13506924-13506946 CAGTGGCACAGCCTGGATGGGGG + Intergenic
952311535 3:32194903-32194925 TTCTGGTCCAGCCTGCAGGGAGG - Intergenic
953805187 3:46062273-46062295 CCCTGCTGCAGGATGCATGGTGG + Intergenic
954261680 3:49443572-49443594 CACCTGTACAGCCAGCATGGTGG - Intergenic
954507070 3:51086508-51086530 CACAGGATCAGCCAGCATGGTGG + Intronic
956165536 3:66395763-66395785 CAGGAGTGCACCCTGCATGGGGG + Intronic
959715810 3:109431552-109431574 CCCTGGAGCAGGCTGCCTGGGGG - Intergenic
961932247 3:130547001-130547023 CCCTAGTGGATCCTGCATGGGGG + Intergenic
962655963 3:137543987-137544009 CAGGGGTGCAGCCTGGCTGGGGG + Intergenic
962824698 3:139089295-139089317 ACCTGGTGCAGCCAGCATGATGG + Intronic
964501122 3:157348885-157348907 CAGTGGTGAAGGCTGCAAGGGGG - Intronic
964501565 3:157353797-157353819 CACTAGAACAGCCTCCATGGAGG + Intronic
966194114 3:177296992-177297014 CACTTTTGCAGGCTTCATGGGGG + Intergenic
966491304 3:180531412-180531434 CCCTGCTGCAGCCGGCATGATGG - Intergenic
967650020 3:191974116-191974138 CCCTGCTGCAGCTGGCATGGTGG + Intergenic
968088433 3:195885164-195885186 CAGTGGGGCAGCCTGGCTGGAGG + Intronic
968545696 4:1196629-1196651 CAGGTGTGCAGCCAGCATGGAGG + Intronic
969321422 4:6415224-6415246 CACTGTTACAGCCGGCCTGGGGG + Intronic
969974383 4:11082988-11083010 TGCTAGTGCAGCCTGCAAGGAGG + Intergenic
970166291 4:13241681-13241703 CCCTGGGGCAGCCTCCCTGGTGG - Intergenic
971067618 4:23051508-23051530 CACTGGTGAAGCCTTCATCAGGG - Intergenic
971897335 4:32614664-32614686 AAGTGTTGCAGCCTGCAGGGTGG - Intergenic
972336770 4:38113978-38114000 AACTGTTACATCCTGCATGGGGG + Intronic
972931200 4:44072777-44072799 CCCTGCTGCAGCCAGCATGATGG + Intergenic
974176540 4:58332682-58332704 CAAGGCTGCAGCCTGGATGGGGG + Intergenic
976118885 4:81758581-81758603 CATTCTTGCAGCCTGGATGGTGG + Intronic
980449986 4:132958602-132958624 GACAGGTGCAGGTTGCATGGCGG - Intergenic
981756455 4:148145657-148145679 CACTTGTGCCACCTGCAGGGGGG + Intronic
988579785 5:32458833-32458855 CAGGGGTGAAGCCTTCATGGAGG - Intergenic
989541401 5:42622904-42622926 TCCTGGTGCAGGCTGCATGTAGG - Intronic
992752244 5:79872175-79872197 CACAGGAGCAGCCCTCATGGAGG + Intergenic
994725790 5:103434134-103434156 CCCTGCTGCAGCCGGCATGAGGG - Intergenic
997698030 5:135877100-135877122 CAGTGGTGCAGCCTTTGTGGTGG + Intronic
999799600 5:155020237-155020259 CCCTGCTGCAGCCGGCATGATGG + Intergenic
1000001597 5:157143777-157143799 CACTGGTGCAGGATACATTGGGG - Intronic
1000426082 5:161093259-161093281 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1002072539 5:176688640-176688662 CCCTGCTGCAGCCGGCATGATGG + Intergenic
1005043588 6:21620863-21620885 CCCTGCTGCAGCCAGCATGATGG + Intergenic
1007060234 6:38933186-38933208 GGTTAGTGCAGCCTGCATGGGGG - Intronic
1013899818 6:115141577-115141599 CTCTGGTGCTGCCTGCAGAGTGG + Intergenic
1017054320 6:150424184-150424206 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1018270753 6:162074755-162074777 CATAGGTACACCCTGCATGGAGG - Intronic
1019209850 6:170396316-170396338 CTCGGGTGGAGTCTGCATGGAGG + Intronic
1019749070 7:2717484-2717506 CTCTGGAGCAGCCTGCGTGCGGG - Intronic
1020713289 7:11636379-11636401 CTCAGGTACAGCCTGCATGTGGG - Exonic
1021192593 7:17638949-17638971 GACTTGTGCAATCTGCATGGTGG - Intergenic
1022215066 7:28251082-28251104 CACTGCTTCAGCATGCAAGGAGG + Intergenic
1023682585 7:42702816-42702838 CACTGGGGATGCCTGCATGGTGG - Intergenic
1024927005 7:54627772-54627794 CATTGGGGGAGGCTGCATGGGGG - Intergenic
1026631233 7:72039846-72039868 CAATGGAGGAGCCTGCTTGGGGG - Intronic
1029973952 7:104815253-104815275 CCCTGCTGCAGCCGGCATGATGG + Intronic
1034697081 7:153063356-153063378 CACTGCTTCTTCCTGCATGGAGG - Intergenic
1034923338 7:155101458-155101480 CTCTGCTGCAGACTGAATGGTGG - Intergenic
1035327902 7:158076654-158076676 GAATGGTGCAGCCTGGATGTGGG - Intronic
1035391808 7:158509179-158509201 CACTGGTCCCGCCTGCTGGGTGG - Intronic
1035526307 8:315881-315903 CTCAGGTGCAGCCACCATGGAGG - Intergenic
1036143202 8:6227137-6227159 CACTGGAGGAGTCTACATGGGGG + Intergenic
1037554098 8:20004947-20004969 CCCTGCTGCAGCCAGCATGATGG + Intergenic
1037953458 8:23034784-23034806 CACAGATGCATCCTGGATGGTGG - Intronic
1039589277 8:38733388-38733410 CACTGGTGCAGCTCTCTTGGGGG + Intronic
1041720622 8:60972033-60972055 AACTGGTGCAGCTGGGATGGAGG + Intergenic
1041765985 8:61418879-61418901 CACTGATGCAGCCTCCATCCAGG - Intronic
1042004701 8:64168514-64168536 CCCTGCTGCAGCCTGCATGGTGG - Intergenic
1042600315 8:70493208-70493230 CACAGCTGCAGCCCCCATGGTGG - Intergenic
1047629596 8:126692490-126692512 CACAGGAGCATCCTGCATTGTGG + Intergenic
1047761360 8:127957019-127957041 CACTGGCCTAGCTTGCATGGTGG + Intergenic
1049674957 8:143885246-143885268 CACTGCTGCAGCAGGCCTGGGGG + Intergenic
1051564270 9:18479223-18479245 AACTGGAGCACCCAGCATGGAGG + Intronic
1052740885 9:32392204-32392226 CACTTGTGCAGCCTGTTGGGAGG + Intronic
1053076389 9:35138276-35138298 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1053077902 9:35150695-35150717 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1053875409 9:42540536-42540558 CCCTGCTGTAGCCTGCATGATGG - Intergenic
1054098377 9:60921286-60921308 CAGGGGGGCAGCCTTCATGGAGG + Intergenic
1054119778 9:61196916-61196938 CAGGGGGGCAGCCTTCATGGAGG + Intergenic
1054236291 9:62561188-62561210 CCCTGCTGTAGCCTGCATGATGG + Intergenic
1055027358 9:71736341-71736363 CACTGATGCAGCTTCCAAGGAGG - Intronic
1055435324 9:76286920-76286942 CACTTGTGCAGCCTGCCCTGTGG + Intronic
1056802750 9:89704693-89704715 CACTGGTGCAGCCAACCTCGAGG + Intergenic
1060920500 9:127417407-127417429 CTCTGCTGGAGTCTGCATGGAGG + Intergenic
1060997700 9:127884513-127884535 CACTGGGCCAGCCAGGATGGTGG - Intergenic
1061507492 9:131039639-131039661 CGCCTGGGCAGCCTGCATGGGGG + Intronic
1062264780 9:135681952-135681974 CTCTGCTGCAGCCTGCATGGGGG + Intergenic
1062298698 9:135851051-135851073 TACTGGTGCTTCCTCCATGGAGG - Intronic
1189011792 X:37053340-37053362 AGCTGGTGCAGCCTGGATGCAGG - Intergenic
1191221065 X:57989281-57989303 CCCTGCTGCAGCCAGCATGATGG - Intergenic
1193506552 X:82350459-82350481 CACTTTAGCAGGCTGCATGGAGG + Intergenic
1194244967 X:91499972-91499994 CTCTGCTGCAGCCTGCACAGTGG - Intergenic
1195146052 X:102018410-102018432 CACTGGTTCAGCCTGCAGCTGGG + Intergenic
1195179244 X:102340183-102340205 CCCTGCTGCAGCCAGCATGATGG + Intergenic
1199152076 X:144499005-144499027 AAGTGTTGCAGCCTGCAAGGTGG + Intergenic
1200551051 Y:4578497-4578519 CCCTGCTGCAGCCGGCATGATGG + Intergenic
1200563942 Y:4741282-4741304 CTCTGCTGCAGCCTGCACAGTGG - Intergenic
1200757597 Y:7004881-7004903 ACCTGCTGCAGCCTGCATGCCGG + Intronic
1201555829 Y:15263999-15264021 CACTGGTGCAGCCTTCTCCGTGG + Intergenic
1202242974 Y:22789438-22789460 CACTGGTGCAGCCTTCTCAGTGG + Intergenic
1202395961 Y:24423188-24423210 CACTGGTGCAGCCTTCTCAGTGG + Intergenic
1202474824 Y:25246904-25246926 CACTGGTGCAGCCTTCTCAGTGG - Intergenic