ID: 1077036407

View in Genome Browser
Species Human (GRCh38)
Location 11:497004-497026
Sequence TACTGGGAAAGGCGGGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077036407_1077036417 24 Left 1077036407 11:497004-497026 CCGCCAGCCCGCCTTTCCCAGTA 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1077036417 11:497051-497073 CCCATGTGCTCACACTCACATGG 0: 3
1: 1
2: 4
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077036407 Original CRISPR TACTGGGAAAGGCGGGCTGG CGG (reversed) Intronic
900326613 1:2111337-2111359 GACAGGGACAGGCGGGGTGGGGG + Intronic
900672988 1:3867441-3867463 TTTTGGGAAAGGAGGGCTTGAGG + Intronic
900706346 1:4082505-4082527 TACTGGGGGAGGGAGGCTGGGGG + Intergenic
901035092 1:6331693-6331715 TAATGGGAAGGGCAGGCTGGTGG - Intronic
901388529 1:8927215-8927237 TAAGGGGAAAGGCCGGATGGTGG - Intergenic
902191140 1:14764150-14764172 TCCTGGGAAAGACCGGCAGGAGG + Intronic
906248253 1:44292180-44292202 TACTGGAGAAGGCTTGCTGGGGG + Intronic
906753978 1:48291586-48291608 TACTGGGTGAGGGGGGCAGGTGG - Intergenic
907971919 1:59391324-59391346 TGCTGGGTCAGTCGGGCTGGAGG + Intronic
910712081 1:90192560-90192582 TACTGAGAAAGGCTGGCTTGAGG + Intergenic
912948428 1:114104071-114104093 GACTGAGAAGGGTGGGCTGGAGG - Intronic
915893144 1:159789896-159789918 TACTGGGAAAGGACAACTGGAGG - Intergenic
916991587 1:170250807-170250829 CAATGGGAAGGGGGGGCTGGAGG + Intergenic
919978739 1:202629342-202629364 TATTGGGGAAGGTGGGCTGGAGG - Intronic
920869503 1:209782436-209782458 TGCTAGGAAAGTAGGGCTGGGGG - Exonic
921964698 1:221075965-221075987 TAGTGAGAAAGGAGGGCTGGAGG - Intergenic
923420975 1:233814625-233814647 TACTGGGAGAGGGAAGCTGGAGG + Intergenic
924787090 1:247209149-247209171 TCCTGGGCAAGGCGGGAAGGTGG - Intergenic
1063123132 10:3118685-3118707 GACTGGGGAAGGCGGCCGGGTGG + Intronic
1063165186 10:3455328-3455350 TACTGGGAAATGCGGTCCGGTGG + Intergenic
1064478843 10:15719825-15719847 TGCGGGGCAAGGGGGGCTGGTGG + Exonic
1065808472 10:29418532-29418554 AACTGGCAATGGGGGGCTGGTGG - Intergenic
1069571963 10:69499750-69499772 TACTGAGAAAGGCGGGATCTGGG + Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070759243 10:79013236-79013258 TACTGGGAGATTCGGGCTGGCGG - Intergenic
1077036407 11:497004-497026 TACTGGGAAAGGCGGGCTGGCGG - Intronic
1077498073 11:2896370-2896392 AACTGGGAACTGCGGGGTGGTGG - Intronic
1077519765 11:3025612-3025634 CACTAGGACAGGCGGGGTGGGGG + Intronic
1078241436 11:9534300-9534322 AAGTGGGAAAAGCAGGCTGGAGG - Intergenic
1078579320 11:12526348-12526370 CACTGGGAAAGAAGGGGTGGGGG - Intronic
1078635219 11:13043226-13043248 AAATGGGAAAGGAGGGGTGGAGG + Intergenic
1079279837 11:19077125-19077147 TAAAGGGCAAGGCTGGCTGGGGG + Intergenic
1081904245 11:46657021-46657043 TTCAGGGAAAGACGGTCTGGGGG + Intronic
1082215248 11:49560799-49560821 TACTGAGAAAGGGGGGATGGGGG - Intergenic
1083263631 11:61536201-61536223 TCCTGGGAAAGGCGGGTGTGGGG - Intronic
1084574700 11:69981660-69981682 TAGCGGGAGAGGAGGGCTGGAGG - Intergenic
1084648310 11:70473670-70473692 AACTGGGACAGAGGGGCTGGGGG + Intronic
1084648330 11:70473739-70473761 AACTGGGACAGAGGGGCTGGGGG + Intronic
1084953831 11:72680958-72680980 TCCTGGGAATGGTGAGCTGGAGG + Intergenic
1086049904 11:82577556-82577578 TACTGGGGAAGCGGGGCTGGAGG + Intergenic
1086634322 11:89063678-89063700 TACTGAGAAAGGGGGGATGGGGG + Intronic
1089486706 11:118852176-118852198 AACTGGGACAGACGGGCTGAGGG + Intergenic
1089564483 11:119363718-119363740 CCCTGGGAAAGGAGGGGTGGGGG + Intronic
1089887488 11:121842040-121842062 TAGTGGGCAGGGCGAGCTGGAGG - Intergenic
1091166174 11:133478235-133478257 TGCTGGGAGAGGCAGGCAGGAGG - Intronic
1094385896 12:29893400-29893422 TACTGGGGAAGGTGAGTTGGGGG - Intergenic
1096123043 12:49101063-49101085 TAATTTGAAAGGAGGGCTGGTGG - Intronic
1096220517 12:49825988-49826010 GGCTGGGAAAGGTGGGGTGGGGG + Intronic
1096518683 12:52172147-52172169 TGCAGGGGAAGGAGGGCTGGAGG - Intronic
1096652251 12:53067611-53067633 GCCTGGGAAAGGTGGGATGGTGG - Intronic
1100045059 12:90369728-90369750 GACTTGGAAAGGCGGGAGGGTGG + Intergenic
1101757794 12:107634948-107634970 TACTGGTAAAGGTGGGTTTGGGG + Intronic
1102446827 12:113009485-113009507 CACTGGGAGAGGAGGGCTAGTGG - Intronic
1102494581 12:113310691-113310713 TACTGGTAATGCCTGGCTGGAGG - Intronic
1103407564 12:120686842-120686864 GAATGGGAAAGGTGGCCTGGGGG - Intergenic
1104695918 12:130863539-130863561 AACAGGGAATGGCGGGCTAGGGG + Intergenic
1106409082 13:29498667-29498689 TCCTGGGAAAGGCCAGCTGTGGG - Intronic
1109423337 13:62142296-62142318 TACTGGGTAAGTCAGGATGGTGG - Intergenic
1109457481 13:62611509-62611531 CACTGGGAAATTCGGACTGGGGG - Intergenic
1109889835 13:68596694-68596716 TACTGGGAAAAGCAGACAGGAGG - Intergenic
1110617921 13:77561850-77561872 AAATGGGCAAGGCTGGCTGGTGG + Intronic
1113908566 13:113831365-113831387 TACAGGGAAGGGTGGGCGGGCGG + Intronic
1115785537 14:36821367-36821389 TACTGGGCAGGGTGGGGTGGGGG + Intronic
1116541111 14:46102929-46102951 TACTGGGAAATGTGTGGTGGTGG - Intergenic
1122548855 14:102539314-102539336 TTCTGGGAAGGCCAGGCTGGGGG + Intergenic
1202903487 14_GL000194v1_random:55972-55994 TACTAGGGAAGGGGGGCTGCGGG - Intergenic
1124494351 15:30177261-30177283 TATTGGGGAAGGTGGGCTGGAGG - Intergenic
1124639258 15:31385691-31385713 GACAGGGAAAGGCAGGTTGGTGG - Intronic
1124749219 15:32361384-32361406 TATTGGGGAAGGTGGGCTGGAGG + Intergenic
1125681222 15:41531409-41531431 TAGAGGGAAAGGTGGGCAGGTGG - Intronic
1128562402 15:68677510-68677532 TTCTGGGAAAGGCCAGATGGTGG + Intronic
1128582569 15:68819654-68819676 CACTGAGAAAGACGGGCCGGGGG + Intronic
1129446303 15:75620960-75620982 TACTGGGATAGGCGGGGGTGTGG + Exonic
1131144065 15:90000511-90000533 TGCTGGGATCGGCGGGCTGGCGG - Intergenic
1132195369 15:99910646-99910668 AAAGGGGAAAAGCGGGCTGGAGG + Intergenic
1132348212 15:101121257-101121279 GACTGGGAAAGGAGGGCTTCGGG + Intergenic
1134104328 16:11475148-11475170 AAAGGGGAAAAGCGGGCTGGAGG - Intronic
1135718263 16:24791537-24791559 TCCTGGTACAGGCTGGCTGGGGG + Exonic
1138389143 16:56657726-56657748 AACTGGGAAGGGCGGGCAGGAGG + Exonic
1141506437 16:84481469-84481491 TTCTGGAAAGGGCGGTCTGGTGG - Intronic
1141528891 16:84632182-84632204 AACTGGGGAAGGCTGGGTGGAGG - Intergenic
1141675687 16:85516037-85516059 GGCTGGGAAAGGAGGCCTGGGGG + Intergenic
1141732255 16:85830389-85830411 TCCTGGGAGAGGCAGGCTGGGGG - Intergenic
1144438134 17:15259491-15259513 GACTGAGAGAGGCGGGCTTGGGG - Intronic
1144710135 17:17396114-17396136 TGCTGGGCCAGGAGGGCTGGGGG - Intergenic
1144886096 17:18463204-18463226 TACTGGGAGGGGCGGGAGGGAGG + Intergenic
1145146111 17:20481165-20481187 TACTGGGAGGGGCGGGGGGGAGG - Intergenic
1147914598 17:43878948-43878970 AACTGGGAGAGGTGGGCTGGAGG - Intronic
1147972591 17:44227637-44227659 TTCTGGGAGAGGAGGGGTGGGGG - Intergenic
1148583764 17:48762186-48762208 TAATGGGAAAGGAGGGTTGTGGG - Intergenic
1148693813 17:49547473-49547495 CACTGGGAATGTCAGGCTGGGGG + Intergenic
1151303798 17:73249639-73249661 CACTGGGAAAGGGGGGGTAGTGG - Intronic
1151704195 17:75758126-75758148 TCCTGTAAGAGGCGGGCTGGGGG + Exonic
1151964591 17:77424880-77424902 TACTCGGAAGGAGGGGCTGGGGG + Intronic
1152840933 17:82567624-82567646 GACAGGGAAAGTCGGGGTGGTGG - Intronic
1153577472 18:6536978-6537000 TCCTGGGAATGGAGGGCTGAAGG + Intronic
1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG + Intergenic
1160727469 19:623728-623750 CGCGGGGAAAGGCGGGCTGCGGG + Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1160906773 19:1455363-1455385 TGCTGGCAAAGGCAGGCGGGCGG - Exonic
1162297857 19:9825831-9825853 TAAAGGGAAAAGTGGGCTGGAGG - Intronic
1163312178 19:16521237-16521259 CACTGGGAAGGGTGGGCTGAGGG + Exonic
1163578631 19:18124803-18124825 GGCTGGGAAAGGCCGGATGGAGG + Intronic
1165459544 19:35936540-35936562 GACTGGGACACGCGGGATGGGGG - Intronic
1166346891 19:42172140-42172162 TACTGAGAAAAGCAGACTGGTGG - Intronic
1166378725 19:42343646-42343668 GACAGGGAAAGGGTGGCTGGGGG + Intronic
1167111759 19:47466489-47466511 CACTGGGGAAGGAGGGTTGGGGG + Intronic
1167386828 19:49168436-49168458 GACTTGGAAAAGGGGGCTGGAGG + Intronic
924987126 2:282106-282128 TACTGGGAAAGATGGAGTGGGGG + Intronic
926710137 2:15872702-15872724 TCCTGGTGGAGGCGGGCTGGTGG + Intergenic
927131438 2:20063713-20063735 AACTGGGGAGGGCGGGATGGGGG + Intergenic
927156342 2:20223753-20223775 CATTGGGGAAGGCGGGCTAGCGG + Intronic
927684110 2:25159002-25159024 AAGTGGGAAAGGCGGAGTGGGGG + Exonic
927971168 2:27307071-27307093 TTCTGGGAAGGGCAGGATGGTGG - Exonic
928391841 2:30916493-30916515 CACTGGGATAGGCCAGCTGGGGG + Intronic
928668859 2:33579858-33579880 AAGGGGGAAAGGTGGGCTGGGGG - Intergenic
929714570 2:44297288-44297310 TGCTGGGAGAGGCTGGCTGTGGG + Intronic
930399763 2:50868386-50868408 GACTGGGAAGGGTGGGATGGAGG + Intronic
932393567 2:71420598-71420620 TACTGGGATATTGGGGCTGGAGG + Intronic
934503178 2:94874450-94874472 TACTAGGGAAGGGGGGCTGCGGG + Intronic
935152431 2:100449908-100449930 GACTGGGAACTGAGGGCTGGAGG - Intergenic
937163038 2:119784227-119784249 TTCTGGGGAAGGAGGGGTGGGGG - Intronic
937915937 2:127098748-127098770 TACTGGGCAGTGCTGGCTGGGGG - Intronic
938049855 2:128158992-128159014 AAGTTGGAAAGGTGGGCTGGGGG + Intronic
938088370 2:128416644-128416666 GGCTGGAAAAGGCCGGCTGGGGG + Intergenic
938583839 2:132670381-132670403 TCCTGGGAAAGGGGCGCCGGGGG + Intronic
939500136 2:142974233-142974255 TAAAGGGAAAAGTGGGCTGGAGG + Intronic
939984668 2:148817485-148817507 TCCTGGGAAAGTGGGGGTGGAGG + Intergenic
940791441 2:158033702-158033724 TACTTGGAAAAGTGGGCTTGTGG - Intronic
942728488 2:179036945-179036967 TACTGGTAAAGCTGGACTGGAGG + Intronic
944880396 2:204007304-204007326 GACTTGGAAAGTCAGGCTGGAGG + Intergenic
945419494 2:209617045-209617067 TACACAGAAAGGCGGGATGGGGG + Intronic
946440055 2:219687436-219687458 TTCTGGGAAAGGCGGGGGGTGGG + Intergenic
947286682 2:228524560-228524582 TACTGGGAAGGGTGGGAGGGTGG + Intergenic
947516656 2:230811324-230811346 TACTGGGAGTGGAGGGCAGGGGG - Intronic
948680116 2:239627803-239627825 GACAGGGAAAGGCGTGCTGGAGG + Intergenic
1170936252 20:20812419-20812441 TAGAGGAAAAGGCAGGCTGGCGG - Intergenic
1172633254 20:36393032-36393054 GACTGGGAAAGGGAGGCTGGGGG + Intronic
1173019262 20:39253534-39253556 TCCTGGGAGAGATGGGCTGGGGG + Intergenic
1176156015 20:63621086-63621108 TACTCGGAAGGCGGGGCTGGAGG + Intronic
1176622853 21:9070740-9070762 TACTAGGGAAGGGGGGCTGCGGG - Intergenic
1179233674 21:39526998-39527020 AACTGAGAAGGCCGGGCTGGTGG + Intergenic
1179790051 21:43751065-43751087 TGTTGGGAAGGGCAGGCTGGAGG + Intronic
1181729912 22:24837579-24837601 GACTGGGAAAGGGGGGGGGGGGG - Intronic
1182446665 22:30393660-30393682 TCCTGGGTCAGGCAGGCTGGAGG - Intronic
1182599922 22:31453952-31453974 TACTGGAAAAAGCAGGCTTGTGG - Intronic
1183197437 22:36363127-36363149 TACTAGGAGAGGCTGCCTGGGGG - Intronic
1183369669 22:37425389-37425411 TGCTGGGAAAGGCGGCCTCTTGG + Intronic
1183759371 22:39802105-39802127 TACTGAGAAAGGGAGGGTGGAGG - Intronic
1183947683 22:41335988-41336010 TCCTGGGAAAGGAAGGCTAGTGG + Intronic
1185364704 22:50432171-50432193 GACTGGGCAGGGCTGGCTGGCGG - Intronic
951485130 3:23202723-23202745 TAAAGGGAAACGCCGGCTGGGGG - Intergenic
953020006 3:39107303-39107325 TCCTGGGAGAGGCGGCCTCGCGG - Intronic
956255403 3:67278240-67278262 CATTGGGAAAGGCGGGATGCAGG - Intergenic
961096164 3:124158638-124158660 TAATGGGAAAGAAGGGCTGGAGG + Intronic
961190224 3:124954186-124954208 TATTTGGAAAGGAGGGTTGGGGG - Intergenic
961204098 3:125067210-125067232 TATTGGGAGAGGCGGACAGGAGG + Intergenic
962251465 3:133838529-133838551 TACTGGGAAAGGCAGGTATGGGG - Intronic
962349032 3:134643455-134643477 TTGCGGGAAAGGTGGGCTGGCGG + Intronic
962837531 3:139202532-139202554 TACTGAGAAAGGCCAGGTGGTGG - Intronic
965693662 3:171384000-171384022 TTCTGGGAATGGTGAGCTGGAGG - Intronic
965954960 3:174358974-174358996 TACTCAGAAAAGGGGGCTGGGGG - Intergenic
966214331 3:177486425-177486447 GACAGGGAATGGCTGGCTGGTGG + Intergenic
967292575 3:187935795-187935817 TGCTGGGTATGGCTGGCTGGAGG + Intergenic
968044224 3:195614749-195614771 TACTGGGCAAGGAAGGCAGGGGG + Intergenic
969267192 4:6072222-6072244 AAAGGGGAAAAGCGGGCTGGAGG - Intronic
969439911 4:7210886-7210908 TTTTGGGAAAGGCAGGCAGGGGG + Intronic
971202875 4:24529130-24529152 TACTGGGGAAGCTGGGCAGGAGG - Intronic
973634794 4:52852003-52852025 GACTAGGAATGGCAGGCTGGTGG - Intergenic
974188681 4:58474796-58474818 TACTGGGAAGTGGGGGCTGAGGG + Intergenic
978855305 4:113387587-113387609 AACGGGGAAAAGCAGGCTGGAGG + Intergenic
979581075 4:122361323-122361345 TTCGGGGAAGGGCGGGATGGGGG + Intronic
985499901 5:236359-236381 TGTTGGGGAAGGTGGGCTGGTGG + Intronic
985737485 5:1593331-1593353 TATTGGGGAAGGTGGGCTGGTGG - Intergenic
986470357 5:8067681-8067703 GAGTGGGAAAGGAAGGCTGGAGG + Intergenic
987191244 5:15480579-15480601 CAATGGGAAAGGGTGGCTGGTGG + Intergenic
992047497 5:72908816-72908838 TACTGGGAGGGGCGGGAGGGAGG + Exonic
994061057 5:95476766-95476788 TACAGGTAAAGGTGGGGTGGGGG + Intronic
994099761 5:95879975-95879997 TCCTGGGAAATGCTGGGTGGTGG + Intergenic
997310495 5:132876200-132876222 TACTGGGATGGGTGGGGTGGGGG - Exonic
999435704 5:151561766-151561788 TGATGAGAAAGGTGGGCTGGGGG + Intronic
1000335388 5:160238115-160238137 TAGTGGGAGAGGCAGGCGGGGGG - Intronic
1000373250 5:160556943-160556965 TATGGGGAAAGCCGGGGTGGGGG + Intergenic
1000996611 5:167965765-167965787 TACAGGGAAACCAGGGCTGGGGG + Intronic
1002374834 5:178781197-178781219 TACCAGGAAAGGCGGTCTGGGGG - Intergenic
1002931026 6:1635277-1635299 TCCTGTGAAAGGCAGGCTGAGGG + Intronic
1003047884 6:2751534-2751556 TACTGTGAGAGTCGGGCAGGTGG - Intergenic
1004402796 6:15304428-15304450 GACTGGGAGAGGTGGCCTGGAGG - Intronic
1004413145 6:15400289-15400311 TAAGGGGGAGGGCGGGCTGGAGG + Intronic
1006339511 6:33438924-33438946 GACTGGGAACGCTGGGCTGGGGG + Intronic
1006448630 6:34093212-34093234 TCCTGGGACAGGAGGGTTGGGGG + Intronic
1007358103 6:41335424-41335446 TCCAGGGAAAGGCAGGCTGAGGG - Intergenic
1008169100 6:48180569-48180591 TACTGGGAAAGGCAAGTTGCTGG + Intergenic
1013307498 6:108863075-108863097 CCCTGGGCAAGTCGGGCTGGAGG - Intronic
1013978486 6:116102796-116102818 TACTGTGTAAGGCTGCCTGGAGG - Intronic
1014799309 6:125759693-125759715 TACTGACAAGGGCGGGCTGATGG - Exonic
1018376299 6:163217020-163217042 CACTTGCAAAGGCGTGCTGGTGG - Intronic
1018956125 6:168411669-168411691 AACTGGGAAGGACGGTCTGGTGG - Intergenic
1020262120 7:6536471-6536493 GGCTGGGAAAGGCGGGCATGGGG + Intronic
1022283756 7:28935599-28935621 TGCTGTGTAAGGCTGGCTGGGGG + Intergenic
1022516105 7:30975893-30975915 TACTGGGAAAGGGTAACTGGAGG + Intronic
1023852542 7:44158455-44158477 CACTGGGAGGGGCCGGCTGGTGG + Intronic
1023968437 7:44975472-44975494 TACTGGAGAAGGTGGGCAGGTGG - Exonic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024678796 7:51661916-51661938 TACTGAGAAATGGGGGTTGGGGG - Intergenic
1029349762 7:100004806-100004828 TACTGGGAACGCCCCGCTGGTGG - Intergenic
1029482963 7:100824015-100824037 GACTGAGAAAGGGGGGCTGCTGG + Intronic
1029707511 7:102283560-102283582 TGGTGGCAAAGGCAGGCTGGGGG - Intronic
1031405058 7:121375406-121375428 AGCTGAGAAAGGCAGGCTGGGGG + Intronic
1035094073 7:156339272-156339294 TTCTGGTAAAGGCTGGCTGTTGG + Intergenic
1035305562 7:157929234-157929256 TACTGGGGAAGAGGGGCTGTGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1038158289 8:25011963-25011985 TACTAGGAAGGGGAGGCTGGAGG - Intergenic
1038774313 8:30514624-30514646 TACTGGGAAAGCTGAGATGGAGG - Intronic
1039516527 8:38138301-38138323 AAAGGGGAAATGCGGGCTGGAGG + Intronic
1040392158 8:46959549-46959571 GTCTGGGAATGGCGTGCTGGGGG + Intergenic
1041706810 8:60855168-60855190 TACTGGGAAAGACGAGCCTGGGG - Intronic
1044786883 8:95803641-95803663 TACTGAGAAAGGTGGGGAGGAGG + Intergenic
1047831012 8:128629895-128629917 TACTAGTAAAGGACGGCTGGTGG - Intergenic
1051725286 9:20082634-20082656 AAGTGGTAAAGGAGGGCTGGAGG - Intergenic
1053071830 9:35106483-35106505 TCCTGGGAGAGGTGGGATGGTGG - Intronic
1054923598 9:70566070-70566092 TACTGGGAAAGGGATGGTGGTGG + Intronic
1056787448 9:89603442-89603464 TACGTGAAAAGGCGCGCTGGGGG - Intergenic
1057314579 9:93960317-93960339 GGCTGGGAGCGGCGGGCTGGCGG - Intergenic
1059360170 9:113735992-113736014 AACTTGGAAAGGCCTGCTGGGGG + Intergenic
1059630745 9:116119166-116119188 GTCTGGGAAAGGGGGGCTAGGGG - Intergenic
1060254551 9:122015636-122015658 ACCAGGGAAAGGCTGGCTGGTGG + Intronic
1061416080 9:130447586-130447608 TTCCGGGGAAGGAGGGCTGGAGG + Intronic
1203746042 Un_GL000218v1:41168-41190 TACTAGGGAAGGGGGGCTGCGGG - Intergenic
1203485639 Un_GL000224v1:51498-51520 TACTGGGGAGGGAGGCCTGGAGG + Intergenic
1203564069 Un_KI270744v1:78314-78336 TACTAGGGAAGGGGGGCTGCGGG + Intergenic
1186436770 X:9549799-9549821 TTCGGGGATAGGAGGGCTGGGGG + Intronic
1186884583 X:13900400-13900422 TACTGGGAAGGGCTGGAGGGAGG + Intronic
1187180944 X:16943330-16943352 ACCTGGGAAAGGTGGGCTGGGGG - Intergenic
1190273420 X:48884682-48884704 AAATGGGAAAAGCGGGCTGGCGG + Intergenic
1194150346 X:90317747-90317769 TATAGGGAAAAGCGGGCTGGAGG + Intergenic
1194888205 X:99345935-99345957 TTCTTGTAAAGGCAGGCTGGAGG + Intergenic
1195157965 X:102142117-102142139 TGCTGGAAATGGGGGGCTGGGGG - Intronic
1198509573 X:137336595-137336617 TAGTGGGAAAGGGGGGATGGTGG + Intergenic
1198921488 X:141733591-141733613 TACAGGGAAGGGAGGGCTAGAGG - Intergenic
1199557080 X:149121229-149121251 TTCTGGGAAAGACGGGTTGCAGG - Intergenic
1200496709 Y:3894504-3894526 TATAGGGAAAAGCGGGCTGGAGG + Intergenic
1200946140 Y:8840524-8840546 TACAGGGAAGGGAGGGCTAGAGG - Intergenic
1201073368 Y:10169765-10169787 TCCTGGGAAAGAGGGGCTGACGG - Intergenic
1201739484 Y:17308174-17308196 TACAGGGAAAGGCTGGCTCTGGG - Intergenic