ID: 1077036660

View in Genome Browser
Species Human (GRCh38)
Location 11:498718-498740
Sequence CGCCGCCCGACCCTCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077036648_1077036660 20 Left 1077036648 11:498675-498697 CCTGAGATGAGCCCAGGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1077036660 11:498718-498740 CGCCGCCCGACCCTCCGGGAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1077036653_1077036660 8 Left 1077036653 11:498687-498709 CCAGGGGCGGGGGAGAGCTCTGA 0: 1
1: 0
2: 5
3: 27
4: 232
Right 1077036660 11:498718-498740 CGCCGCCCGACCCTCCGGGAAGG 0: 1
1: 0
2: 1
3: 3
4: 95
1077036652_1077036660 9 Left 1077036652 11:498686-498708 CCCAGGGGCGGGGGAGAGCTCTG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 1077036660 11:498718-498740 CGCCGCCCGACCCTCCGGGAAGG 0: 1
1: 0
2: 1
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077036660 Original CRISPR CGCCGCCCGACCCTCCGGGA AGG Intronic
900951089 1:5858630-5858652 CGCCGCCCGACAGACCGTGACGG + Intergenic
906367519 1:45223208-45223230 CCCCCCCCCACCCTCCCGGACGG - Intronic
910221707 1:84894597-84894619 CGACCCCCGCCCCTCCGAGACGG - Intergenic
920333398 1:205228168-205228190 CGCAGCCCGGCCGGCCGGGAGGG + Exonic
923034057 1:230271876-230271898 CGCCACCCCATCCTCTGGGAAGG - Intronic
1065727231 10:28677784-28677806 CGGCGCCCGCCGCTCCGGGCAGG + Exonic
1072139038 10:92573790-92573812 CGCCGCCCGTCCCGCCGGCCTGG - Intronic
1072341802 10:94459553-94459575 CGCGGCCCGAGCCTCCCCGACGG - Intronic
1072555800 10:96513161-96513183 CACCGCCAGACGCTCCGGGCCGG - Intronic
1077036660 11:498718-498740 CGCCGCCCGACCCTCCGGGAAGG + Intronic
1077230527 11:1456460-1456482 CGCCTCCCCACCCTCCGTGTAGG - Exonic
1078177195 11:8978883-8978905 CCCCCCCCAACCCTCCCGGACGG - Intergenic
1081593621 11:44444297-44444319 CGCCTCCCGAGCCACTGGGAGGG + Intergenic
1083572919 11:63769449-63769471 CGGGGCCCGACCCTGCGGGCTGG + Intergenic
1089118715 11:116117028-116117050 CTCTGCCCCACCCTCAGGGATGG - Intergenic
1090377807 11:126303853-126303875 TGCCGGCCGGCCCTCAGGGAAGG - Exonic
1103901901 12:124307658-124307680 CGCCGCCCAGCCCTCCGTGAAGG - Intronic
1107493262 13:40900906-40900928 CGCCCCCCCTCCCTCCCGGATGG - Intergenic
1113494130 13:110714323-110714345 CGCGCCCGGACCCGCCGGGAAGG - Intronic
1117315156 14:54566188-54566210 CGCCGCCCGCCCCGACGGCATGG + Intergenic
1122447710 14:101781625-101781647 CGCCTCCGGAGCCTCCGGCATGG + Intronic
1122640130 14:103155149-103155171 CCCAGCCCGGCCCTCAGGGAAGG - Intergenic
1122784013 14:104155665-104155687 CACCGCCCCATCCGCCGGGACGG - Intronic
1129428547 15:75481628-75481650 CGCCAGCCGCCCGTCCGGGAGGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131200079 15:90388523-90388545 CGCCCGCCGCCCCACCGGGACGG - Intronic
1131517555 15:93089159-93089181 CGCCGCCCGAGCCGCTGGGCCGG - Intronic
1132163652 15:99565371-99565393 CGCCGCCCCACCGCCCGGGTTGG + Intergenic
1132591185 16:727133-727155 CGCCGCCCGCCTCACCGGCACGG - Intronic
1134656150 16:15949733-15949755 CGCCGCCCGCGCCACCGGCATGG + Exonic
1136110946 16:28063424-28063446 TGCCGCCCGCGCCGCCGGGACGG + Exonic
1141132437 16:81445132-81445154 CACCCCCCCACCCCCCGGGAAGG - Intergenic
1142030934 16:87838157-87838179 CGCCGCTTGACCCCCCGGGCTGG - Intronic
1142271853 16:89093986-89094008 CGCCGCCCGCACCTACGAGACGG - Exonic
1144604565 17:16653492-16653514 CGCCGCCAGGCCCGCAGGGAGGG + Intronic
1144621682 17:16822369-16822391 CGCGGCACGACCCTCCGGCCAGG + Intergenic
1144735495 17:17553227-17553249 CCCCACCCCACCCTCCAGGAGGG + Intronic
1146215851 17:30979243-30979265 CCCCCCCCCACCCTCCCGGACGG + Intronic
1147425840 17:40345521-40345543 CGCCGCCCGCCCTGCCAGGATGG + Intronic
1147907676 17:43833306-43833328 CACCGCCGCACCCTCCGGGCCGG + Intergenic
1148439512 17:47704418-47704440 TCCCGCCCGACCCTCGGGGAGGG - Intronic
1148847474 17:50537885-50537907 AGCCGCCCCTCCATCCGGGATGG + Intronic
1151787430 17:76281881-76281903 CGTCTCCCGACCCTCCAAGAAGG - Exonic
1152357260 17:79813306-79813328 CCCCGCCCGCTCCCCCGGGAGGG + Intergenic
1152718450 17:81911097-81911119 TGCAGCCCGACCCTCCCGGCAGG + Intronic
1153024101 18:657952-657974 CGCCGCGGGCCCCTGCGGGACGG + Exonic
1160861263 19:1238038-1238060 CGCCCCCCGCCCCGCCGGAAGGG - Intergenic
1160873100 19:1285885-1285907 CGCCGCCGCACCCGCCGGGGAGG - Intergenic
1160957096 19:1698815-1698837 CCCCTCCCCACCCTCCAGGAAGG + Intergenic
1161203755 19:3029491-3029513 CTTCTCCCGCCCCTCCGGGAGGG - Intronic
1164214756 19:23134583-23134605 CCCCCCCCCACCCTCCAGGACGG - Intronic
1168320180 19:55504266-55504288 TGCCTCCCTACCCTACGGGAGGG - Intronic
925346597 2:3176199-3176221 CGCCGCCTGACCCTCCCAGCTGG - Intergenic
926497988 2:13616146-13616168 GGCCGCCCCACCATCTGGGAAGG + Intergenic
929460854 2:42101352-42101374 CGCCGCGCGGGCCTCGGGGAGGG - Intergenic
938088639 2:128418214-128418236 CCCCCCCCCACCCTCCCGGACGG + Intergenic
944060844 2:195568299-195568321 CGCCAGCCGCCCGTCCGGGAAGG + Intergenic
944060867 2:195568346-195568368 CGCCAGCCGCCCGTCCGGGAGGG + Intergenic
946457220 2:219837224-219837246 AGCCGGCCGATCCTCAGGGAAGG - Intergenic
946690106 2:222303160-222303182 CGCCGCCCGATTCTCCAGGGCGG + Intronic
947765090 2:232633114-232633136 CCCCGCCCCACGCTCCGGGCGGG + Intronic
1169131442 20:3168118-3168140 CGGCCCCCGTCCATCCGGGAGGG - Intronic
1175931677 20:62496546-62496568 CGACGCCCGACCCTCCTGGATGG + Intergenic
1176168709 20:63687621-63687643 CGCCCCCCGCCCCACAGGGAAGG + Exonic
1179804031 21:43825998-43826020 GACCGCCCTGCCCTCCGGGATGG + Intergenic
1180875075 22:19171385-19171407 CGCCGCCAGAGGCTCGGGGAGGG + Intergenic
1183589356 22:38770749-38770771 CCCCAGCCCACCCTCCGGGAGGG + Intronic
1184069391 22:42138584-42138606 CGAGGCCCGAGCCTCCCGGATGG + Intergenic
1184480174 22:44742013-44742035 GGTCGCCAGACCCTGCGGGAGGG + Intronic
1185321038 22:50200438-50200460 GCCCGCCCAGCCCTCCGGGAGGG + Intergenic
950043147 3:9933129-9933151 CGGCGCCAGACCCTGCAGGAGGG + Exonic
956678315 3:71754823-71754845 CGCGGCCCGGCCCTGCGGGCCGG - Exonic
965744169 3:171907113-171907135 CGCTGCCTGAGCCTCCCGGATGG - Intronic
968382316 4:107536-107558 CTCCGCCCGCCCCTCCGCGCTGG + Intergenic
969720743 4:8892112-8892134 AGCCGCCCGCAGCTCCGGGAGGG - Intergenic
972913355 4:43846480-43846502 CGCGGCCCAAGCCTCCCGGATGG + Intergenic
992978413 5:82140569-82140591 GGCCAGCCGCCCCTCCGGGAGGG + Intronic
997512951 5:134465872-134465894 CCCCGCCCCCCGCTCCGGGAAGG - Intergenic
997892459 5:137687525-137687547 CCCCCCCCCACCCTCCCGGACGG - Intronic
1002790237 6:432155-432177 CACCGCACCACCCTGCGGGAAGG - Intergenic
1003107863 6:3229145-3229167 CGCCGCCCCACACTTCGGAAGGG + Intronic
1003983929 6:11417054-11417076 CGCGGCCCGAGCCTCCGCAACGG - Intergenic
1009622615 6:66096731-66096753 CGCCCCCCCAACCTCCCGGACGG + Intergenic
1014088336 6:117373348-117373370 CGCAGCCCGAGCCTCCCTGATGG - Intronic
1018331019 6:162727606-162727628 CGCCGCCCCACGCCCCGGTATGG - Intronic
1018400259 6:163414424-163414446 CGTCGCCCGCCCCGCCGGGGAGG + Intronic
1022923366 7:35037523-35037545 CGCCTCCCGGCCCGCGGGGAGGG - Intronic
1029547430 7:101217612-101217634 TCCCGCCCGACCCTCCGCCAGGG - Exonic
1034494320 7:151410657-151410679 AGCCGCCGGGCGCTCCGGGAGGG - Intronic
1040559978 8:48515075-48515097 CTCCTCCCGAGCCTCCGGGAGGG - Intergenic
1044618853 8:94169453-94169475 CGCCCACCAAGCCTCCGGGAAGG + Intronic
1044660956 8:94591573-94591595 CGCCAGCCGCCCGTCCGGGAGGG + Intergenic
1046636887 8:116680185-116680207 CCCCCCCCCACCCTCCCGGAAGG - Intronic
1048484095 8:134831799-134831821 GGACGCCCGACCCTGAGGGACGG + Intergenic
1049580179 8:143407519-143407541 CCCCGCCCCACCCTCCAGGTCGG + Intergenic
1049755486 8:144309640-144309662 CCCCGCCCGCCCCTCCCTGAGGG + Intronic
1050343259 9:4662270-4662292 CTCTCCCCGCCCCTCCGGGATGG + Intronic
1060508307 9:124214727-124214749 CGCCGCCCCTCCCTGGGGGAGGG + Intergenic
1062294700 9:135818202-135818224 CGCAGCCCGGCTCCCCGGGATGG - Intronic
1200081409 X:153578591-153578613 AGCCCCCTGACCCTCCGGCAGGG - Intronic