ID: 1077037507

View in Genome Browser
Species Human (GRCh38)
Location 11:502531-502553
Sequence GCCTCTCATTTGCTTGGGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077037494_1077037507 21 Left 1077037494 11:502487-502509 CCTGCCCCACAGAGGGCGGGACA 0: 1
1: 0
2: 4
3: 23
4: 211
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037500_1077037507 -9 Left 1077037500 11:502517-502539 CCCGGGAAGCCCCTGCCTCTCAT 0: 1
1: 1
2: 2
3: 50
4: 339
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037492_1077037507 24 Left 1077037492 11:502484-502506 CCTCCTGCCCCACAGAGGGCGGG 0: 1
1: 0
2: 3
3: 41
4: 323
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037501_1077037507 -10 Left 1077037501 11:502518-502540 CCGGGAAGCCCCTGCCTCTCATT 0: 1
1: 0
2: 6
3: 55
4: 399
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037490_1077037507 27 Left 1077037490 11:502481-502503 CCTCCTCCTGCCCCACAGAGGGC 0: 1
1: 1
2: 6
3: 72
4: 643
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037496_1077037507 16 Left 1077037496 11:502492-502514 CCCACAGAGGGCGGGACAGCAGC 0: 1
1: 0
2: 3
3: 19
4: 203
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037495_1077037507 17 Left 1077037495 11:502491-502513 CCCCACAGAGGGCGGGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 211
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123
1077037497_1077037507 15 Left 1077037497 11:502493-502515 CCACAGAGGGCGGGACAGCAGCA 0: 1
1: 0
2: 3
3: 19
4: 228
Right 1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077037507 Original CRISPR GCCTCTCATTTGCTTGGGCA AGG Exonic
900791789 1:4685654-4685676 GCCTCTCCTTCGCTGGGGCAGGG - Intronic
903195090 1:21680119-21680141 GTCTCTCATTTGCTTTAGCAAGG + Intronic
903655664 1:24947605-24947627 GCCTCCCATCTGCTGGGGCAGGG - Intronic
903880919 1:26508626-26508648 GCCTCTCCTTCTCTGGGGCATGG + Intergenic
905128704 1:35735234-35735256 GCCTCTAATTTTCTGGGGCTTGG - Intronic
905320067 1:37109710-37109732 GCCTTTCATGTGCTAGTGCAGGG + Intergenic
906999391 1:50834426-50834448 GACTCTGATTTTCTTGGGAAGGG - Intronic
907662292 1:56404568-56404590 GCCTGTGGTTTGCTTTGGCAAGG - Intergenic
907769311 1:57444069-57444091 GGCTCTCATTTACTTCAGCAGGG + Intronic
909129283 1:71714713-71714735 GCTTCTCATTTGCATTAGCATGG - Intronic
910221175 1:84890785-84890807 GCCTCTTATTTCTTTGGGCTGGG - Intronic
915624265 1:157105362-157105384 TCCTCTCTATTGCCTGGGCAGGG - Intergenic
922764386 1:228149768-228149790 GCCTCTGACCTGCTTGGGCTTGG + Intergenic
923552778 1:234977488-234977510 GCCTCTCTTTGGCTTGGAAATGG + Intergenic
1063916575 10:10888945-10888967 GTCTATGATTTGCTTGGGTAGGG - Intergenic
1066332014 10:34434035-34434057 GCCTCACATTGGTTTTGGCAGGG + Intronic
1070053608 10:72913184-72913206 CCCTCTGATTTCCTTGGGGATGG + Intronic
1070491506 10:76981174-76981196 GCGGCTCAATTGCTTGGGGAAGG - Intronic
1071765048 10:88654472-88654494 GTCTCTCATTTGCTTTGCCTTGG + Intergenic
1072625101 10:97106153-97106175 GCCCATCATTTGCCTGGCCATGG + Intronic
1074052079 10:109889053-109889075 GCCCCTCATCTGCAAGGGCAGGG + Intronic
1074160097 10:110829889-110829911 GCCTCTCTTCTGCTGGGGCTGGG - Intronic
1076051250 10:127335371-127335393 GCCCCTCATTTCATTTGGCAAGG + Intronic
1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG + Exonic
1078798275 11:14616016-14616038 GCCTCTGATTTCCATGGGTAAGG - Intronic
1079313873 11:19391053-19391075 GCCCCTCATTTACTTGGCCTGGG - Intronic
1082974720 11:59060224-59060246 GCCTCTCATGTGGTTGGGAGAGG - Intergenic
1083475838 11:62914844-62914866 GCCTCTCATCTGCCTGGGCATGG + Intronic
1083902476 11:65650317-65650339 CCCTCTCATTAGCTGGGGCTGGG + Intronic
1089695265 11:120212500-120212522 GCCTCTCTTTAGCTGGGGGAAGG - Intronic
1091118951 11:133040690-133040712 GCCTCTTGCTTGCTTGGGCGGGG + Intronic
1099918356 12:88924700-88924722 TTCTCTCCTTTGCTTGGGGATGG - Intergenic
1100764196 12:97845714-97845736 GCCTCACATTGTCTTGGTCATGG + Intergenic
1103192860 12:119017361-119017383 GCATCCCATTTGCTTGGACTAGG + Intronic
1104434395 12:128744064-128744086 GCCTCTCATTTGCAATGGCCAGG + Intergenic
1107529175 13:41265664-41265686 ACCTCTTCTTTGTTTGGGCAGGG - Intergenic
1108167282 13:47706784-47706806 TCTGCTCATTTGCTGGGGCAGGG - Intergenic
1108780196 13:53821144-53821166 CCCTCTGTTTTGCTGGGGCAAGG + Intergenic
1113241302 13:108340597-108340619 GTCTCTCATTTGCTGTGGGAGGG + Intergenic
1123803523 15:23847760-23847782 TCCTATCATTTGCTTGCGTAGGG + Intergenic
1126110966 15:45174497-45174519 CCCTCTCCCCTGCTTGGGCAAGG - Intronic
1127117440 15:55742624-55742646 GCCTCTGCGCTGCTTGGGCAGGG - Intronic
1130927074 15:88393561-88393583 GACTCTCATTGGCTTGGCCTGGG - Intergenic
1135936160 16:26781949-26781971 CCCTCTCATTTGCTCTGGCTGGG + Intergenic
1136228660 16:28874642-28874664 GCCACTCACTGGCCTGGGCAAGG + Intergenic
1137584794 16:49657922-49657944 GCCTCTCAGTGACTTGAGCATGG - Intronic
1137875728 16:51994912-51994934 TCCTCTCATTTTTGTGGGCAGGG - Intergenic
1138094347 16:54200350-54200372 GTCTCTAATGTGCTTGGGGAAGG - Intergenic
1143467313 17:7146143-7146165 CCCTCTCTTTTCCTTGGGCTTGG - Intergenic
1144790566 17:17856274-17856296 GCCTCTCATTTGCTTCTTCAGGG - Intronic
1147850717 17:43440472-43440494 GCCCCTCATTTGCTTGTGGGAGG + Intergenic
1148063273 17:44851040-44851062 TCCTCTCTTTTCCTTGGGAATGG + Exonic
1150008163 17:61482531-61482553 GCCTCTACTTTCCTTGGCCAGGG + Intronic
1150352787 17:64458783-64458805 GCTTCTGATCTGATTGGGCAGGG - Intronic
1150520827 17:65865668-65865690 GCATCAGGTTTGCTTGGGCAGGG + Intronic
1157469996 18:47981834-47981856 AGCTCTCATTTCCTTAGGCAGGG - Intergenic
1159785445 18:72708486-72708508 GCCTCTCTTCTGCTGGGACATGG - Intergenic
1160487469 18:79307419-79307441 GCCGCACATTTGCATGTGCAAGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161735917 19:5991975-5991997 GCCTCTCACTTCCCTGGGCTGGG - Intergenic
1163089940 19:15012632-15012654 GGATCTCATCTCCTTGGGCAGGG - Intronic
1166265810 19:41683599-41683621 TCCTCTCATATTCTTGGTCAAGG + Intronic
1166856245 19:45783879-45783901 GCCCCTCAGTTGAGTGGGCAGGG - Exonic
1167216704 19:48170208-48170230 GCCTCCCATCTGCTTGCGGACGG + Intronic
932103946 2:68926137-68926159 GGCTCTGTGTTGCTTGGGCAGGG - Intergenic
934855208 2:97725076-97725098 GCCTCTCCTTTTCTAGGGCGAGG + Exonic
934910844 2:98252766-98252788 GCCTCTCTTTTGCCTGGGAAGGG - Intronic
936596948 2:113857156-113857178 GCCTCTCTTTGGCTTGTACATGG - Intergenic
937496640 2:122427214-122427236 GCATGTCATTTGCCTGGGGAGGG + Intergenic
941244314 2:163078372-163078394 GCCTCTCATTAGCTTTACCAAGG - Intergenic
944651907 2:201838695-201838717 GCTTCTTAATTGGTTGGGCACGG - Intronic
946654305 2:221929126-221929148 ACCTCTGATTTTCTTGGGCTTGG + Intergenic
946882002 2:224185676-224185698 GCCTCTCCTTTAATTGGACAAGG - Intergenic
948643699 2:239390873-239390895 GCTTCTGATTTGCATGAGCAGGG - Intronic
948803022 2:240441381-240441403 GCCTCTCACTGGCCCGGGCACGG - Intronic
1173966725 20:47118053-47118075 GACTCTGTTTTCCTTGGGCAGGG - Intronic
1179544157 21:42103381-42103403 GTATCTCCCTTGCTTGGGCATGG + Exonic
1182275357 22:29185097-29185119 GCCACCCATTGGCTTGAGCAGGG - Intergenic
950795122 3:15504371-15504393 CTCTCTCTTTGGCTTGGGCATGG + Intronic
953240148 3:41141349-41141371 GCCTTTCTTTCCCTTGGGCATGG - Intergenic
954392320 3:50274204-50274226 GCCTCTGACTTCCTAGGGCAAGG + Intronic
955483594 3:59413917-59413939 TCTTCTTATTTGCTTGCGCAAGG + Intergenic
955589917 3:60524112-60524134 GCATCTCCTCTGCCTGGGCAGGG - Intronic
961080441 3:124022445-124022467 TCCTGTCCTTTGCTTGGACATGG - Intergenic
964513022 3:157474693-157474715 CCCACTCATTTGCTAAGGCAGGG - Intronic
964710903 3:159670655-159670677 GACTCTCATTGGCTTGGTGATGG - Intronic
965312713 3:167150804-167150826 CCCTTTCCTTTGCTTTGGCAAGG - Intergenic
966587428 3:181643283-181643305 GTCTCTCATTTGCTGGTTCATGG - Intergenic
967588599 3:191245624-191245646 GCCTCTTATTTGATTGAGCAGGG + Intronic
968972858 4:3805031-3805053 GCCTCTCCTTGGCTTGGAGATGG - Intergenic
969592373 4:8129296-8129318 GCCTCTGATTCACTTGTGCAGGG - Intronic
970107474 4:12601294-12601316 TCCTCTCATTTGCAGGGACACGG + Intergenic
972968552 4:44543835-44543857 CCTTATCTTTTGCTTGGGCAGGG - Intergenic
973981864 4:56314477-56314499 GCCTCTCCTCCGCTTGGGCCTGG - Exonic
975118698 4:70705587-70705609 GCCTCCCACGTGCTTGGGCGGGG + Intronic
977573409 4:98653307-98653329 GCCTCTAATTTGCTTCCACAGGG - Intronic
977994122 4:103482152-103482174 GGTGCTCATTTGCTTGGGCAGGG + Intergenic
980133221 4:128835716-128835738 GCCTCTCCTTCACTTGGACATGG - Intronic
981105228 4:140873530-140873552 GTCTCTCTTTTCCTTGGGTATGG - Intronic
985690984 5:1312203-1312225 GCCTCTCCTTGGCTTGTACATGG - Intergenic
986583007 5:9284903-9284925 TCATCACATTTTCTTGGGCAGGG - Intronic
987175609 5:15305059-15305081 GCCTCTAATTGGCATAGGCATGG - Intergenic
990493220 5:56321783-56321805 GCCTTTCTTGTGCTTGGGTATGG + Intergenic
991917621 5:71620718-71620740 GCATCTCATTTGCTTTTGCTTGG + Intronic
997572080 5:134937946-134937968 GCCTTTCATTTCATTGGGCTTGG + Intronic
998524136 5:142827041-142827063 GCCTCTCATTTCCTTTGGGTTGG + Intronic
999114544 5:149151172-149151194 GCCTCTCCTTTGCTTGGAGATGG + Intronic
1000699609 5:164432320-164432342 TCCTCCCATTTCCTTGGGGAAGG - Intergenic
1001922615 5:175612162-175612184 GCCTCTCATTAGCTTTAGGAAGG + Intergenic
1001942909 5:175753353-175753375 GCCTCTCAGAGGCTTCGGCAAGG + Intergenic
1003864523 6:10350971-10350993 GCCCTTCTTTTGCTTGTGCAAGG - Intergenic
1005718390 6:28575846-28575868 GCTTCTCATTTCCTTGTACAAGG + Exonic
1015811358 6:137164732-137164754 GCATCTGCATTGCTTGGGCACGG - Intronic
1019000039 6:168742375-168742397 GACTTTCTTTTGTTTGGGCATGG - Intergenic
1021537112 7:21718004-21718026 TCTTCTCACTTTCTTGGGCAAGG - Intronic
1023121813 7:36916827-36916849 GCCTCACATTTTCCTAGGCAAGG + Intronic
1023986985 7:45102479-45102501 GCTTCTCATGTACCTGGGCAAGG + Exonic
1032657290 7:133945167-133945189 GCCTCTGATTTGATTGGTCTGGG - Intronic
1039911113 8:41827994-41828016 TCCTCTTTATTGCTTGGGCAAGG - Intronic
1040341354 8:46442735-46442757 GCCTCACATTTCCTTGGGCAGGG - Intergenic
1042689552 8:71483050-71483072 GCCACTCATGGGCTTGAGCAGGG - Intronic
1042874856 8:73432297-73432319 ACCTCTCATTTCCTTGTGAAAGG - Intronic
1045936328 8:107683819-107683841 ACCTCTCATTGGCTTTGTCAGGG - Intergenic
1046864485 8:119130836-119130858 GCCTCTCTTTTTTATGGGCAGGG + Intergenic
1047494121 8:125397576-125397598 GCCATTAATTGGCTTGGGCAGGG - Intergenic
1049185704 8:141251500-141251522 GCCTATCATATCCTAGGGCACGG - Intronic
1055193888 9:73563043-73563065 CCCTCTTATTTCCTTGAGCAGGG - Intergenic
1056388804 9:86121444-86121466 GCCTCTCCTTGGCTTGGAGATGG + Intergenic
1057227292 9:93299110-93299132 GCCCCACACTGGCTTGGGCAGGG - Exonic
1188900105 X:35721766-35721788 GCCTTTCATTTGATTTGGCAAGG - Intergenic
1194042003 X:88952551-88952573 GCCTCTCATGAGGTTGGGGAGGG + Intergenic
1194714288 X:97272788-97272810 GCCTTTTATTTGCTTGAGTAGGG - Intronic
1197099937 X:122640697-122640719 GCCTCTTATTTGAATAGGCAAGG - Intergenic
1200022219 X:153221705-153221727 TCCTCTCTTTTGCTTGGCTAAGG - Intergenic
1201537910 Y:15071057-15071079 GCCTCTCAGCTGGTGGGGCAAGG - Intergenic