ID: 1077038170

View in Genome Browser
Species Human (GRCh38)
Location 11:505293-505315
Sequence CCACAGGTTTGGAGATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077038170_1077038176 -1 Left 1077038170 11:505293-505315 CCTCCTAATCTCCAAACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1077038176 11:505315-505337 GTGTTACCTTAAGTGGCAAAAGG 0: 1
1: 3
2: 65
3: 311
4: 872
1077038170_1077038174 -8 Left 1077038170 11:505293-505315 CCTCCTAATCTCCAAACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1077038174 11:505308-505330 ACCTGTGGTGTTACCTTAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1077038170_1077038177 0 Left 1077038170 11:505293-505315 CCTCCTAATCTCCAAACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1077038177 11:505316-505338 TGTTACCTTAAGTGGCAAAAGGG 0: 2
1: 25
2: 194
3: 546
4: 1214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077038170 Original CRISPR CCACAGGTTTGGAGATTAGG AGG (reversed) Intronic
903698738 1:25230449-25230471 ACACATGTCTGGAAATTAGGAGG - Intronic
904008740 1:27377996-27378018 CCAGAGGCTTGGAGCTTTGGCGG + Intergenic
909507358 1:76408531-76408553 CCACAGCTGTGCAGATTATGAGG - Intronic
909827085 1:80139905-80139927 CCACATGCTTGGAGAGGAGGAGG - Intergenic
911768659 1:101711131-101711153 CCACAGTTCTGGAGACTAGGGGG - Intergenic
914720131 1:150282613-150282635 CAACAGGTAAGGAGATTCGGAGG + Intronic
915050243 1:153062565-153062587 CCACTGCCTTGGAGATCAGGAGG - Intergenic
916991223 1:170247990-170248012 TCAAAGGTTTGGAGAATAGAAGG - Intergenic
919480028 1:198076871-198076893 CCACAGGTAAGGATTTTAGGAGG - Intergenic
924909829 1:248498134-248498156 CCCCAGGTATGGAGACTAAGGGG + Intergenic
924914272 1:248549925-248549947 CCCCAGGTATGGAGACTAAGGGG - Intergenic
1064099936 10:12454777-12454799 CCAGAGGTTTGCAGATTATTAGG - Intronic
1066761798 10:38762030-38762052 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1066959791 10:42210426-42210448 TCACAGGTAAAGAGATTAGGAGG + Intergenic
1067054661 10:43043684-43043706 CCACACGTTTGTGGATTAGGAGG - Intergenic
1068556807 10:58467317-58467339 GCTGAGGTTTGGAGATTGGGAGG + Intergenic
1073670598 10:105583420-105583442 CCTCACGTTTGGAGATTGGTTGG + Intergenic
1077038170 11:505293-505315 CCACAGGTTTGGAGATTAGGAGG - Intronic
1079245553 11:18749787-18749809 CCACAGTTCTGGAGCTCAGGCGG - Intronic
1080824123 11:35833532-35833554 TCACATGTTTGGAGATTGGTAGG - Intergenic
1082236684 11:49826256-49826278 GCACAGGTAAAGAGATTAGGGGG - Intergenic
1082240131 11:49860755-49860777 GCACAGGTAAAGAGATTAGGGGG - Intergenic
1082242012 11:49883442-49883464 GCACAGGTAAAGAGATTAGGGGG + Intergenic
1082656512 11:55864379-55864401 GCACAGGTAAAGAGATTAGGGGG + Intergenic
1084674285 11:70625027-70625049 CCTCAGGTTTGGTGATTTGTGGG + Intronic
1086402455 11:86472026-86472048 TCACAGGGCAGGAGATTAGGAGG + Intronic
1086719081 11:90098350-90098372 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1086829783 11:91546252-91546274 CCAGAGGTTGGAGGATTAGGGGG + Intergenic
1087512691 11:99117869-99117891 CCACAGTTCTGGAGACTGGGAGG - Intronic
1087664777 11:101031529-101031551 CCACAGCCTTGGAGCTGAGGAGG - Exonic
1087961202 11:104352141-104352163 GTACAGGTTTGTAGTTTAGGAGG + Intergenic
1088305137 11:108399596-108399618 CCAAAGGTATGGAGATGATGTGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091160286 11:133413691-133413713 CCCCAGGCTTGGAGTTAAGGAGG - Intronic
1093203216 12:16214874-16214896 CCACAAGTTTGGAGATTCCTAGG - Intronic
1093702060 12:22232467-22232489 ACACAGGTTTGCAGAAAAGGGGG + Intronic
1094347593 12:29487845-29487867 CCACTGGTTTGTAGAAGAGGTGG - Exonic
1098044165 12:66382894-66382916 AGACAGGTTTGGGGATTAGAAGG + Intronic
1099584224 12:84495512-84495534 CCAGAGGTTTGAAGAGAAGGAGG - Intergenic
1100328900 12:93567625-93567647 CCACAGGATGGGAGGTTTGGTGG + Intergenic
1101953647 12:109195350-109195372 TCACAACTTTGGAGATTTGGGGG + Intronic
1105440608 13:20412789-20412811 CCACAGGCTGGGAGCTGAGGAGG - Intronic
1105593120 13:21812327-21812349 CCCCAGGTTTGGATTTCAGGGGG + Intergenic
1109315085 13:60740567-60740589 TCACAGGTCTGGAGGGTAGGAGG - Intergenic
1109916513 13:68993389-68993411 CTCCAGTTTTGGAGATTAAGGGG + Intergenic
1112143948 13:96676902-96676924 CAGCAGGTTTGGAGCTTAGTTGG + Intronic
1113434934 13:110283890-110283912 CGACAGGATGGGAGATGAGGTGG + Intronic
1113891331 13:113737114-113737136 CCACAATTTTGGAGATTTGCTGG + Exonic
1122196334 14:100089489-100089511 CCAAATGTTTGGAAATTAAGTGG + Intronic
1202845378 14_GL000009v2_random:167795-167817 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1202914779 14_GL000194v1_random:158061-158083 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1202875410 14_GL000225v1_random:203434-203456 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1202877889 14_KI270722v1_random:24654-24676 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1202933149 14_KI270725v1_random:58397-58419 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1124347792 15:28934056-28934078 TCACAGGTTTAGAGACCAGGCGG - Intronic
1124890316 15:33726309-33726331 CCAGAGGTTTGGAGGTGGGGTGG + Intronic
1128570345 15:68729065-68729087 GCTCAGAATTGGAGATTAGGTGG - Intergenic
1129865704 15:78906872-78906894 GCACAGGTTTGGAAATTAATAGG + Intergenic
1130053420 15:80502789-80502811 CCAGGGGGTTGGAGATTAGGAGG + Intronic
1130326201 15:82882278-82882300 CCACAGGCCTGGAGAGAAGGTGG + Intronic
1134813634 16:17188139-17188161 CTGGAGGTTTGGAGAATAGGGGG + Intronic
1135191278 16:20356710-20356732 ACACAGGTTTGGGGATTCAGAGG - Intergenic
1138718491 16:59051495-59051517 GCACAGGTTCAGAGATGAGGAGG - Intergenic
1139427883 16:66894484-66894506 CCACAGGGGTGGGGATGAGGAGG - Intronic
1139626609 16:68194761-68194783 CCACAGGTTGAGAGATTTGGGGG + Intronic
1143895955 17:10136360-10136382 CCAGAGGTTTGGAGAGTTGCTGG + Intronic
1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG + Intronic
1151404135 17:73875954-73875976 CCCGAGGTTTGGGGTTTAGGAGG - Intergenic
1151418086 17:73979806-73979828 CCAAAAGTTTGGAGAAGAGGAGG - Intergenic
1151920877 17:77154548-77154570 CCACAGGTTTTGGGATTGGAGGG + Intronic
1153750691 18:8227194-8227216 TCACAGGTTTCGAGATTAGTAGG + Intronic
1156312361 18:35936203-35936225 GCACAGGTTTGAACATTAGATGG - Intergenic
1156416795 18:36902791-36902813 CCACAGCCTTGTAGAATAGGTGG - Intronic
1158074133 18:53508975-53508997 CAACAGGTGTACAGATTAGGTGG + Intronic
1160519731 18:79497773-79497795 ACACAGGTTTTGTGATTAGAGGG + Intronic
1162866625 19:13552763-13552785 GCACAGGTTAGTAGATTAAGTGG + Intronic
1163250805 19:16125288-16125310 CCACAGGGATGGAGAGGAGGGGG + Intronic
1163713145 19:18858945-18858967 TCACAGGTTTGGAGTTCATGAGG - Intronic
1164392021 19:27832224-27832246 ACATAGGATTGGAGATTTGGAGG + Intergenic
1202672788 1_KI270710v1_random:8275-8297 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
926458347 2:13097161-13097183 AGACAGGTTTGGAGAGGAGGAGG + Intergenic
927436814 2:23073677-23073699 CCACAGGCTAGGAGAGCAGGGGG - Intergenic
928254803 2:29712892-29712914 CCAATGTTTTGGACATTAGGGGG + Intronic
928570413 2:32601595-32601617 CAACAGATTTGGATAATAGGTGG - Intronic
929181349 2:39043595-39043617 CCACAGCTTTGGAGGCTAGAAGG + Intronic
930003991 2:46881699-46881721 ACACAGGGTTGCAGATGAGGAGG + Intergenic
932738457 2:74272863-74272885 CCACAGGATGGGAGAAGAGGAGG + Intronic
933089684 2:78105250-78105272 CCATGGGATTGGAGATTGGGGGG + Intergenic
934463495 2:94237462-94237484 GCACAGGTAAAGAGATTAGGAGG - Intergenic
935944149 2:108270663-108270685 CCATCAGTTTGGAGCTTAGGCGG - Intergenic
938955161 2:136290648-136290670 CCACAGGTCTGAAGATCAAGAGG - Intergenic
940174506 2:150863674-150863696 CTACAGGTTGGGAGTCTAGGGGG + Intergenic
940248352 2:151644947-151644969 CTACAGGTTTGTAGCCTAGGAGG - Intronic
940836925 2:158532523-158532545 CTACAGTTTTGGAAAATAGGGGG - Intronic
940967090 2:159851041-159851063 ACACAGATTTTGAAATTAGGTGG - Intronic
944829170 2:203515016-203515038 ACACAGGGTTGGGGATTGGGAGG - Intronic
1169947325 20:11003158-11003180 TCAAGGGTTTGGAGATTAGAAGG + Intergenic
1176021175 20:62963193-62963215 CCAAAGGATTGGGGATTTGGGGG - Intronic
1176594538 21:8680473-8680495 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1176634131 21:9172706-9172728 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1176639178 21:9282115-9282137 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1179215337 21:39362425-39362447 CTACAGGCCTGGAGCTTAGGAGG + Intergenic
1179961875 21:44772249-44772271 CCAGGGGATTGGAGATTGGGAGG - Intronic
1180277390 22:10657602-10657624 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1180372485 22:12054946-12054968 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1180389988 22:12220717-12220739 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1180415948 22:12713763-12713785 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1180584616 22:16876441-16876463 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1180854502 22:19037684-19037706 TCTGAGGTTTGGAGATTAAGCGG - Exonic
1184967959 22:47995373-47995395 CCACAGGGTTGGAGAGAGGGAGG + Intergenic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
953120036 3:40031106-40031128 TCACAGTTTTGGAGACTGGGAGG + Intronic
957101023 3:75828726-75828748 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
959115255 3:102169977-102169999 CCACAGGAATGGAGAGTAGTGGG - Intronic
960892754 3:122467835-122467857 CACCATCTTTGGAGATTAGGAGG - Intronic
961154837 3:124670883-124670905 GCTCAGGTTTGGAGACTCGGAGG - Intronic
961366555 3:126403183-126403205 CCAGAGGTCAGGAGAGTAGGCGG + Intronic
961871586 3:129992550-129992572 CCACTGGTTTGGAGAGTAAAAGG + Intergenic
963163909 3:142181384-142181406 CCACAGGATTGCAGATTAGTAGG - Intronic
963381637 3:144537812-144537834 ACACAGGTCTGGAGCTAAGGAGG - Intergenic
963431414 3:145209770-145209792 CCATATGTTTGGAGATCAGCTGG + Intergenic
966395946 3:179503083-179503105 CCAAAGGTTCTGAGATTATGGGG + Intergenic
967100680 3:186212907-186212929 CCTCAGGTTTGCAGATGAAGGGG + Intronic
1202747717 3_GL000221v1_random:122912-122934 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
969398244 4:6937281-6937303 CCACAGTTCTGGAGGTTGGGAGG + Intronic
972960316 4:44446808-44446830 TCTTAGGGTTGGAGATTAGGAGG - Intronic
974488831 4:62537786-62537808 ACCCAGTTTTGGGGATTAGGGGG + Intergenic
975453307 4:74556169-74556191 CCACTGTTTTGCACATTAGGAGG + Intergenic
978495880 4:109358667-109358689 CCAAAGGATTGGAAACTAGGGGG - Intergenic
979805511 4:124965639-124965661 ACATAGATTTGGAGCTTAGGTGG + Intergenic
980380170 4:132003563-132003585 CCACAGTGCTGGAGACTAGGAGG + Intergenic
980981964 4:139662336-139662358 TCACAGTTCTGGAGGTTAGGAGG + Intergenic
1202754076 4_GL000008v2_random:40506-40528 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
993345920 5:86782580-86782602 TCACAGGTTTGAAGAGTAAGGGG - Intergenic
993550412 5:89266776-89266798 TCACAGTTCTGGAGGTTAGGCGG - Intergenic
994193537 5:96896432-96896454 CCGCTGGTTTGGAGATAGGGCGG - Exonic
995845802 5:116492554-116492576 CAAAAGGTTTAGAGAATAGGAGG + Intronic
997392928 5:133531726-133531748 CCACAGGTTTGGTGATAGGGCGG + Intronic
998699378 5:144680332-144680354 CTAGAGGTTTGGAGGGTAGGGGG + Intergenic
998963352 5:147511102-147511124 CAACAGGTTTTGGGTTTAGGTGG - Intergenic
999925526 5:156371798-156371820 CCAAAGGCATGGAGATTAGACGG - Intronic
1001124231 5:169004896-169004918 TCACAGTTCTGGAGACTAGGAGG - Intronic
1001939414 5:175729933-175729955 CCCCTGGTTTGGAGACTAGCTGG - Intergenic
1002017485 5:176336570-176336592 CCACAGGTTTTGTGATTCTGTGG + Intronic
1002092635 5:176813962-176813984 CCCCAGGCTGGGAGAATAGGAGG - Intronic
1003721964 6:8713521-8713543 GCACAGGGTTGGAAATTAGAAGG - Intergenic
1013078529 6:106792070-106792092 ACACAGGTTTAGAGATTAGGAGG - Intergenic
1013230885 6:108161410-108161432 CCCAAGGTTTGGAGATTCAGAGG + Intronic
1013844141 6:114428742-114428764 CAAGAGGTTGGGAGATTAGGTGG - Intergenic
1014538458 6:122645758-122645780 CCTCAGGTTTGGGGGTTATGTGG + Intronic
1014886562 6:126788994-126789016 CAAAAGGTTTGTAGATTTGGAGG - Intergenic
1016277636 6:142373493-142373515 CCAGAGGTTGGCAAATTAGGAGG + Intronic
1019079815 6:169422662-169422684 CCATGCGTTTGGAGATGAGGAGG + Intergenic
1022973584 7:35537749-35537771 CCCCAGGACTGGTGATTAGGAGG - Intergenic
1026651078 7:72216453-72216475 TCATAGGTCTGGGGATTAGGAGG + Intronic
1027411896 7:77928643-77928665 CCACAGTTTTGGAGAAATGGAGG - Intronic
1029172399 7:98640365-98640387 CCACAGGTTTGCAGGTTAACTGG - Intergenic
1029302826 7:99598432-99598454 CCACAGGTTGGGAGAGGATGTGG + Intronic
1031204651 7:118741204-118741226 CCAGAGGTTAGGGGTTTAGGGGG + Intergenic
1034525938 7:151662474-151662496 CCACAGGAGTGGAGATTCAGAGG - Intronic
1036201869 8:6776791-6776813 CCACAGTTCTGGAGAGTAGAAGG - Intergenic
1036536008 8:9653423-9653445 CCACAGTTCTGGAGACCAGGAGG + Intronic
1037455235 8:19056897-19056919 CCACAGCTTGGGAGATTAGAGGG - Intronic
1039794255 8:40898487-40898509 CCTCAGGTTGGGGGATGAGGGGG - Intergenic
1039833309 8:41235390-41235412 CCTCAGGATTGGAAATGAGGAGG + Intergenic
1039959541 8:42235682-42235704 CCAGAGGCTTGGAGGTTAGGAGG - Intergenic
1042691878 8:71508734-71508756 TCACAGTTCTGGAGGTTAGGAGG - Intronic
1043769313 8:84178244-84178266 CCTTAGGTTTAGAGATTATGTGG - Intergenic
1044149024 8:88751152-88751174 CTACAAGTTTTGAGATTTGGAGG - Intergenic
1045313217 8:101021541-101021563 ACACAGGTTTGGAAAGTAGGAGG + Intergenic
1046226538 8:111287201-111287223 TCACAGTTTTGGAGAGTAGGAGG - Intergenic
1046894118 8:119454528-119454550 CCACAGGTTGGTAGTTTAAGGGG + Intergenic
1047007244 8:120633224-120633246 CCACAGGTTTGAGGATTAAGTGG - Intronic
1051921358 9:22269707-22269729 TCACAGTTCTGGAGACTAGGGGG - Intergenic
1053693561 9:40614086-40614108 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1054271268 9:63026038-63026060 GCACAGGTAAAGAGATTAGGAGG + Intergenic
1054304804 9:63413290-63413312 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1054403552 9:64737292-64737314 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1054437174 9:65222797-65222819 GCACAGGTAAAGAGATTAGGAGG - Intergenic
1054493224 9:65799167-65799189 GCACAGGTAAAGAGATTAGGAGG + Intergenic
1055451250 9:76433278-76433300 CCACAGGTTTGGGGATGACCTGG - Intronic
1057528697 9:95825222-95825244 CCACCGGCTTGGAGATCTGGTGG - Intergenic
1057914582 9:99046063-99046085 CCACAGTATTGGAGGTTAGTAGG - Intronic
1203756969 Un_GL000218v1:140342-140364 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1203534864 Un_KI270743v1:25232-25254 GCACAGGTTTGTAGCCTAGGAGG + Intergenic
1203650582 Un_KI270751v1:116572-116594 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1188660391 X:32751732-32751754 TCACATGTCTGGAGTTTAGGAGG + Intronic
1190521774 X:51286447-51286469 CCAGGGGTTTGGAGATGAGAGGG - Intergenic
1190851463 X:54247612-54247634 CTACAGGTTTGGGGATGGGGTGG + Intronic
1190856069 X:54296261-54296283 GCACAGGTTTGGGGATTAAGAGG - Intronic
1191054117 X:56224813-56224835 CCACAGTTCTGGAGATTGGAAGG + Intergenic
1191807387 X:65149223-65149245 TCACAGGACTGGAGATTATGTGG - Intergenic
1191842274 X:65521803-65521825 CCACTGATTTGGTAATTAGGAGG + Intronic
1193371029 X:80697469-80697491 CCAAAGGAAGGGAGATTAGGAGG - Intronic
1196807747 X:119604028-119604050 CAACAACTTTGGGGATTAGGTGG - Intronic
1197848455 X:130830486-130830508 AGACAGGTTTGCAGATTTGGTGG - Intronic
1199822671 X:151464808-151464830 CCACAGTTATGAAGATTATGGGG - Intergenic
1200424901 Y:3009700-3009722 CCACAGGAGTGGAGCTGAGGGGG - Intergenic
1201170544 Y:11257958-11257980 GCACAGGTTTGTAGCCTAGGAGG - Intergenic
1201685808 Y:16701269-16701291 TCACAAGTTAGGAGATGAGGTGG + Intergenic