ID: 1077038475

View in Genome Browser
Species Human (GRCh38)
Location 11:506920-506942
Sequence AGGCGGGGCCGAGGTTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077038475_1077038492 23 Left 1077038475 11:506920-506942 CCAGCGCAACCTCGGCCCCGCCT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1077038492 11:506966-506988 GCCCGACCCCGCCCCGCCACGGG 0: 1
1: 0
2: 3
3: 65
4: 446
1077038475_1077038491 22 Left 1077038475 11:506920-506942 CCAGCGCAACCTCGGCCCCGCCT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1077038491 11:506965-506987 CGCCCGACCCCGCCCCGCCACGG 0: 1
1: 0
2: 5
3: 80
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077038475 Original CRISPR AGGCGGGGCCGAGGTTGCGC TGG (reversed) Intronic