ID: 1077039313

View in Genome Browser
Species Human (GRCh38)
Location 11:511679-511701
Sequence TCTGGAGATCCGTGCTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077039310_1077039313 1 Left 1077039310 11:511655-511677 CCAGTCGGCAGGACAGTATATGC No data
Right 1077039313 11:511679-511701 TCTGGAGATCCGTGCTGATGTGG No data
1077039306_1077039313 30 Left 1077039306 11:511626-511648 CCTCCAATTTCAATCAGACAGAA No data
Right 1077039313 11:511679-511701 TCTGGAGATCCGTGCTGATGTGG No data
1077039307_1077039313 27 Left 1077039307 11:511629-511651 CCAATTTCAATCAGACAGAAAGC No data
Right 1077039313 11:511679-511701 TCTGGAGATCCGTGCTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077039313 Original CRISPR TCTGGAGATCCGTGCTGATG TGG Intergenic
No off target data available for this crispr