ID: 1077040399

View in Genome Browser
Species Human (GRCh38)
Location 11:518667-518689
Sequence TCGTGCGTGCCTCCTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077040399_1077040404 -3 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040404 11:518687-518709 CGAGCCGACACCAGCAGGTGGGG No data
1077040399_1077040406 1 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040406 11:518691-518713 CCGACACCAGCAGGTGGGGCAGG No data
1077040399_1077040403 -4 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040403 11:518686-518708 ACGAGCCGACACCAGCAGGTGGG No data
1077040399_1077040401 -8 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040401 11:518682-518704 ACGCACGAGCCGACACCAGCAGG No data
1077040399_1077040409 24 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040409 11:518714-518736 AAACGCAGCCAGCGCGGAACCGG No data
1077040399_1077040408 18 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040408 11:518708-518730 GGCAGGAAACGCAGCCAGCGCGG No data
1077040399_1077040402 -5 Left 1077040399 11:518667-518689 CCCAGGGGAGGAGGCACGCACGA No data
Right 1077040402 11:518685-518707 CACGAGCCGACACCAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077040399 Original CRISPR TCGTGCGTGCCTCCTCCCCT GGG (reversed) Intergenic
No off target data available for this crispr