ID: 1077043049

View in Genome Browser
Species Human (GRCh38)
Location 11:532988-533010
Sequence CCTGAACTCCAGGTCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077043036_1077043049 8 Left 1077043036 11:532957-532979 CCCCTCAAAGGTCAGGGTGGCCC 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG 0: 1
1: 0
2: 3
3: 42
4: 266
1077043038_1077043049 6 Left 1077043038 11:532959-532981 CCTCAAAGGTCAGGGTGGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG 0: 1
1: 0
2: 3
3: 42
4: 266
1077043030_1077043049 28 Left 1077043030 11:532937-532959 CCCGCATCATGCTACAGCAGCCC 0: 1
1: 0
2: 3
3: 15
4: 321
Right 1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG 0: 1
1: 0
2: 3
3: 42
4: 266
1077043031_1077043049 27 Left 1077043031 11:532938-532960 CCGCATCATGCTACAGCAGCCCC 0: 1
1: 0
2: 1
3: 29
4: 245
Right 1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG 0: 1
1: 0
2: 3
3: 42
4: 266
1077043037_1077043049 7 Left 1077043037 11:532958-532980 CCCTCAAAGGTCAGGGTGGCCCG 0: 1
1: 0
2: 1
3: 7
4: 76
Right 1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG 0: 1
1: 0
2: 3
3: 42
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077043049 Original CRISPR CCTGAACTCCAGGTCTGGCC AGG Intronic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900637663 1:3673927-3673949 GCTCAGCTCCAGGTCAGGCCAGG + Intronic
901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG + Exonic
901447978 1:9319691-9319713 TCTGCACTGCAGATCTGGCCGGG - Intronic
901857645 1:12054506-12054528 CCTGAAGGCCCAGTCTGGCCTGG - Intergenic
902411547 1:16214734-16214756 ATTGAAACCCAGGTCTGGCCGGG + Intergenic
902501848 1:16916138-16916160 ACTGCACTCCAGCTCAGGCCTGG + Intronic
902609057 1:17586628-17586650 GCTGAGCTCCTGGTCTGGGCCGG + Intronic
904744745 1:32703540-32703562 CCTGAAGCCCAGGTCTGGGAAGG - Intronic
905115976 1:35641299-35641321 CCTACACCCCAGGCCTGGCCGGG + Intronic
905263540 1:36735598-36735620 CCAGAACTCCAGATTTGCCCAGG - Intergenic
905372057 1:37487594-37487616 CCTGCCCACCAGCTCTGGCCTGG + Intergenic
905921488 1:41722364-41722386 GCTGATCTCCAGGTCCAGCCAGG - Intronic
906453265 1:45970881-45970903 ACTGACTTCCAGTTCTGGCCTGG - Intronic
906480786 1:46197846-46197868 CCTGAAGTCATGGGCTGGCCAGG - Exonic
906657077 1:47556092-47556114 CCTGAAATCCACGGCTGGTCGGG - Intergenic
908990460 1:70081733-70081755 CCTTCACTCCATGTCTGCCCTGG + Intronic
913234585 1:116768708-116768730 GCTGAACTCGAGGTCTGGGGAGG - Exonic
918255568 1:182743184-182743206 CCTGAACTTCAGTCCTGGCTTGG + Intergenic
919726746 1:200889471-200889493 CTTGAACTCCAGCTCTTCCCTGG + Intergenic
919852813 1:201684979-201685001 CCACAACCCCAGTTCTGGCCGGG + Intronic
919930612 1:202219019-202219041 CATGACCTTCAGGGCTGGCCGGG + Intronic
920251850 1:204627320-204627342 CCTGACCTCCAGGGCTGTCATGG + Intronic
921829566 1:219711815-219711837 CCTGTCCTCCAGGCCTGGGCTGG - Intronic
922852216 1:228742672-228742694 CCTCAACTCCATTTCTGGTCTGG + Intronic
922932056 1:229397508-229397530 CCAGATCTTCAGGTGTGGCCTGG - Intergenic
923094091 1:230761072-230761094 CCTGAGTTCTAGGTCTGGCTTGG - Intronic
923673772 1:236063969-236063991 GCTGTGCTCCCGGTCTGGCCTGG - Intronic
1062923593 10:1297925-1297947 GCTGACCTCCAGGTGTGGGCAGG - Intronic
1066554188 10:36593101-36593123 CCTGAAATCAAGGTGTTGCCAGG - Intergenic
1066757308 10:38723636-38723658 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1067352399 10:45488221-45488243 CCTGTGATCCAGTTCTGGCCAGG + Intronic
1073276603 10:102317219-102317241 CCAGAAGTCCAAGTCTAGCCTGG + Intronic
1073285526 10:102385286-102385308 CCTGAAGTCCAGGCCATGCCTGG + Intergenic
1074751215 10:116589158-116589180 TCTGAATTCCAGGCCTGGCTTGG + Intergenic
1074818715 10:117163596-117163618 CCTCACCTCAACGTCTGGCCTGG + Intergenic
1075390323 10:122086769-122086791 CCTTTTCTCCAGGTGTGGCCAGG - Exonic
1075464524 10:122641797-122641819 CCTGTGCTCCAGGTATAGCCAGG - Intronic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1080824634 11:35837533-35837555 CCTGAGCTCCAGGAAGGGCCAGG + Intergenic
1081605198 11:44523018-44523040 CCTGAACTCCAGGCTAGGCTGGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1082083951 11:48033696-48033718 CCTGTACTTGAGATCTGGCCTGG + Intronic
1083222495 11:61262242-61262264 GGTGACCTCCAGGTCTGGCGTGG - Intronic
1084192020 11:67503745-67503767 CCTGACCTCCAGGGATGGCCAGG + Intronic
1084541441 11:69789420-69789442 CCTGAGAACCAGGTCAGGCCAGG + Intergenic
1085347771 11:75779295-75779317 CCTGAAGTCCAGGTGTGGGCTGG + Intronic
1085412899 11:76302067-76302089 CCTCAAATCCAGGACTTGCCAGG + Intergenic
1086645730 11:89217699-89217721 CCTGAACTTTAGTTCTGGCCTGG + Intronic
1088573934 11:111251460-111251482 ACTGAAGTCCACGTCTGGGCTGG + Intergenic
1089043696 11:115480370-115480392 CCTGAGCTGCAAGTCAGGCCTGG + Intronic
1091198542 11:133752692-133752714 CCTGCACTCCGGGTCTTGCCAGG + Intergenic
1091616999 12:2057347-2057369 CATCTACTGCAGGTCTGGCCAGG - Intronic
1092081177 12:5717656-5717678 CTTGTACTCCAGATCTGGCCTGG + Intronic
1092265847 12:6979849-6979871 ACTGATCTCAAGGTCTTGCCAGG + Intronic
1094818279 12:34206548-34206570 CTTGAACCCCTGTTCTGGCCCGG + Intergenic
1095099056 12:38162675-38162697 CCTGACCCCCTGTTCTGGCCTGG - Intergenic
1095476272 12:42589892-42589914 CCTGAAAGCGAGGTCGGGCCCGG + Intronic
1095745782 12:45657010-45657032 CCTGCACTCCAGCTCCAGCCTGG + Intergenic
1097033666 12:56107592-56107614 CCTGATTTCCAGGTTTGACCAGG - Exonic
1100314338 12:93430458-93430480 CCTCAAATCCAGGACTGGCTGGG + Intronic
1100397365 12:94196703-94196725 CCTCGAGTCCAGGCCTGGCCAGG + Intronic
1102060094 12:109925357-109925379 CCAGAACTCCAGTCCAGGCCCGG - Intronic
1102568091 12:113810192-113810214 TCTGAAATCCAGGTGTGGGCAGG - Intergenic
1103454471 12:121053997-121054019 GCTGAACTACAGCTCTGACCTGG - Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1104105099 12:125651721-125651743 GCTGAACTCCAGGTCTCGGCTGG + Intronic
1104428345 12:128696236-128696258 GCTGGACTCAAGATCTGGCCTGG - Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105706573 13:22971148-22971170 CCTGATCTCCAGGACTGGGATGG - Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1106759726 13:32857016-32857038 CCTGAGCTCCAACTCTGGCCGGG - Intergenic
1107014155 13:35695350-35695372 CCTGAACTCGAGGCCTGGCGCGG + Intergenic
1112331545 13:98480796-98480818 CCAGAAGTTCAGGACTGGCCTGG - Intronic
1113397349 13:109960991-109961013 GCTGAACTCCAGGTGTGGCAGGG - Intergenic
1113904797 13:113814217-113814239 GCTGAACTGCAGGTCTGGGCAGG + Exonic
1113935692 13:113994513-113994535 CATGAACTCCCTGACTGGCCAGG - Intronic
1114483216 14:23047962-23047984 CCTGAGCGCCCGGGCTGGCCCGG - Exonic
1114640654 14:24217583-24217605 CAAGAACTCCTGTTCTGGCCGGG - Intronic
1117334918 14:54748962-54748984 CTTGAACTTCAGGTCCTGCCTGG - Intronic
1119147595 14:72331124-72331146 CCTGACCTCCACTTTTGGCCAGG - Intronic
1119780107 14:77271490-77271512 CCTGGCCTGCAGGTCAGGCCTGG + Intergenic
1120712532 14:87807607-87807629 CCTGACCTCCAGCTCTGACCTGG + Intergenic
1121125059 14:91400495-91400517 CCGGGAGTCCAGCTCTGGCCTGG - Intronic
1122114675 14:99521808-99521830 CCCAAGCTCCAGGGCTGGCCGGG + Intronic
1123040060 14:105486806-105486828 CCCGAACCCCAGATCTGCCCGGG - Intergenic
1128216828 15:65940203-65940225 CCGGAACTCCAGGAATGGCTGGG - Intronic
1128322162 15:66701637-66701659 CCTGAGCTCCCTGTTTGGCCCGG + Intergenic
1129260960 15:74367009-74367031 TCCAAACCCCAGGTCTGGCCAGG - Intronic
1129738422 15:77978252-77978274 CCTGGCCTCCAGGTCTGAGCTGG + Intergenic
1129847651 15:78775357-78775379 CCTGGCCTCCAGGTCTGAGCTGG - Intronic
1129890547 15:79068969-79068991 CCTGGACCACAGGCCTGGCCGGG + Intronic
1130600717 15:85271418-85271440 CCTGGCCTCCAGGTCTGAGCTGG - Intergenic
1131933188 15:97469374-97469396 CCTCCACTACAGCTCTGGCCAGG - Intergenic
1132675112 16:1118252-1118274 CCAGACCTCCAGAGCTGGCCAGG + Intergenic
1133330031 16:4967161-4967183 CCTGAATTCAAGGTGTGGGCAGG + Intronic
1133879557 16:9768096-9768118 ACTGAACTCCAGCTCCAGCCTGG - Intronic
1134563405 16:15230366-15230388 CCTGAACTTGAGGCCAGGCCTGG - Intergenic
1134619975 16:15680575-15680597 ACTGAACTCCAGCTCCAGCCTGG - Intronic
1134743638 16:16570506-16570528 CCTGAACTTGAGGCCAGGCCTGG + Intergenic
1134923930 16:18141992-18142014 CCTGAACTTGAGGCCAGGCCTGG - Intergenic
1136089815 16:27910715-27910737 CAAGAACTCCAGGTCTAGGCTGG + Intronic
1136514090 16:30757290-30757312 TCTGAACGCCACGCCTGGCCCGG + Exonic
1136720214 16:32314089-32314111 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1136725266 16:32352482-32352504 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1136838590 16:33520365-33520387 CATGAAAGCCAGGTCTGGCCAGG - Intergenic
1136843595 16:33558539-33558561 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1138095359 16:54207072-54207094 CCTGAAATCCAGGCATGCCCAGG - Intergenic
1138293535 16:55868062-55868084 CCAAAACTCCATGTATGGCCTGG + Intronic
1138528030 16:57620120-57620142 TCTTACCTCCAGGTCTGGGCAGG - Exonic
1139279617 16:65759228-65759250 GCTGAACTCCAGATCTGGACAGG - Intergenic
1140931591 16:79633083-79633105 CCTCAGCTCAAAGTCTGGCCTGG + Intergenic
1141102083 16:81204988-81205010 CCTGAACTCCAGGCATGGCGAGG + Intergenic
1141170931 16:81691198-81691220 CCTGAAATCAAGGTGTGGGCAGG + Intronic
1141773897 16:86109529-86109551 CCTGGAATCCAGGTGTCGCCAGG - Intergenic
1141919751 16:87127864-87127886 CCAGACCACCAGGTCAGGCCAGG + Intronic
1142338988 16:89508490-89508512 CCTGGACTCCAGGCCGGGCCTGG - Exonic
1203001164 16_KI270728v1_random:165272-165294 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1203006217 16_KI270728v1_random:203680-203702 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1203132767 16_KI270728v1_random:1701676-1701698 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1203148754 16_KI270728v1_random:1820651-1820673 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1203153760 16_KI270728v1_random:1858837-1858859 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1143012218 17:3872326-3872348 CCTGAGATCCAGGGTTGGCCAGG - Intronic
1143658924 17:8312970-8312992 TCTGAGCTCCAGGCCAGGCCGGG - Exonic
1146057486 17:29588728-29588750 CCTGAACGCCAGGCCCGGCAAGG + Intronic
1146501075 17:33364941-33364963 CCTGAAACCCACATCTGGCCAGG + Intronic
1147134550 17:38427697-38427719 CCTGAGCCCCAGGACTGGCTGGG + Intergenic
1147265557 17:39232262-39232284 CCTGAACCCCTGGGCTGCCCCGG - Intergenic
1147904591 17:43814438-43814460 TCCCATCTCCAGGTCTGGCCAGG - Intronic
1148444155 17:47727585-47727607 CCTGGGCTCCAGGCCAGGCCTGG - Intergenic
1149667656 17:58377080-58377102 TCTGAACTCTAGGTCTGTCTTGG - Intronic
1152242479 17:79167751-79167773 CCTGGACCCCAGGTAGGGCCAGG - Intronic
1152292575 17:79448601-79448623 CCTGAAATCAAGGTGTGGGCAGG - Intronic
1152528559 17:80903438-80903460 CCTGCACCCCAGGCCTGCCCAGG + Intronic
1152529512 17:80908992-80909014 CAGGAACTCCAGGTGTGCCCGGG + Intronic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1155449895 18:25952606-25952628 CTGGAACTGCAGCTCTGGCCTGG - Intergenic
1156457039 18:37300587-37300609 CCTGAGCTCCTGCTCTGGGCAGG + Intronic
1159117833 18:64135810-64135832 CCTGACCTCCAGGCCTGCCTCGG + Intergenic
1160478684 18:79218322-79218344 CTTGTGTTCCAGGTCTGGCCAGG + Intronic
1160509359 18:79444578-79444600 CCTTAAAGCCAGGTCTGGGCCGG + Intronic
1160682823 19:419606-419628 TCCGAACTCAAGGTGTGGCCGGG - Intronic
1160895601 19:1400629-1400651 TCTCAAGTCCAGGTCTTGCCTGG - Intronic
1161266659 19:3367403-3367425 CCGGCGCTCCGGGTCTGGCCCGG + Intronic
1162781371 19:13008633-13008655 CCTGAGCTCCAGGCCTGGGCAGG - Intronic
1162947429 19:14052286-14052308 CCTGAACCACACGTCTGGCTGGG + Exonic
1163020112 19:14477203-14477225 CCTTCCCTCCAGGTCTGGCCAGG + Intergenic
1163676170 19:18656364-18656386 CCTGAACTCCCGGTGTGACTTGG + Intronic
1163688791 19:18727035-18727057 CCAGGAGTCCAGGTCTAGCCTGG + Intronic
1165821632 19:38680187-38680209 CCTGAGCTCCAGCTATGGACAGG - Intronic
1166194698 19:41198040-41198062 CTTGAACTCTAGGGCTGGCCTGG + Intronic
1166213140 19:41320053-41320075 CCTCGCCTCCAGGTCTGGACAGG + Intronic
925139507 2:1540142-1540164 CCTCATCTCCAGGTCGGGGCTGG + Intronic
925971651 2:9110564-9110586 CCTGCTCTCTAGGTCAGGCCAGG + Intergenic
927003786 2:18826601-18826623 CCTGAAATCCAGGTCTTGGTGGG + Intergenic
927153645 2:20209762-20209784 CCTTAGCCCCAGGGCTGGCCAGG - Intronic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
928235257 2:29533761-29533783 AAGGAACTCCAGGTCTGGCAGGG + Intronic
929143136 2:38684007-38684029 CCTTGACTCCAGGTCTGGCTTGG - Intronic
929584472 2:43105190-43105212 CCTGAGCCCCAGGTCAGCCCTGG + Intergenic
930233248 2:48864027-48864049 CATGATCACCAGGTATGGCCTGG - Intergenic
930709698 2:54538969-54538991 TCTGAGCTCCAGCCCTGGCCAGG + Intronic
931905620 2:66839892-66839914 CCTGAACTCCAGCTTTGTCTGGG - Intergenic
932445608 2:71779205-71779227 CCTCAACTCCAGTTCCTGCCTGG + Intergenic
933196557 2:79396731-79396753 CCTAAACTCCGGGTTTTGCCAGG - Intronic
934320612 2:91968077-91968099 CGTGAAAGCCAGGTCTGGCCAGG + Intergenic
935197197 2:100824233-100824255 CCTGCCCTCCAGCCCTGGCCCGG - Intronic
936480024 2:112877456-112877478 GCTGAACTACAGGTCTGGGCAGG - Intergenic
938233188 2:129679285-129679307 CTTGAACCCCAAGTCTGGGCTGG - Intergenic
938382398 2:130843934-130843956 CCTGCTCTCCAGGTATGGGCTGG + Intronic
946239399 2:218344710-218344732 CCTGAACTCCAGGATGGGGCAGG + Intronic
948065478 2:235075573-235075595 CCTGAAGTGAAGGTCAGGCCGGG - Intergenic
948382613 2:237561305-237561327 ACAGAACTGCAGGCCTGGCCTGG - Intergenic
948562705 2:238864872-238864894 GCGGATCTCCAGGCCTGGCCTGG - Intronic
948906922 2:240984015-240984037 CCTGAGCTCCCGGTAGGGCCTGG + Intronic
1170315646 20:15038705-15038727 CCTGGCCTCCAGGTTGGGCCAGG - Intronic
1170460567 20:16573396-16573418 GCGGAACTCCAGGTCCGGCCGGG - Exonic
1171019369 20:21571538-21571560 CCTGTGCTCCAGGCTTGGCCTGG - Intergenic
1172389661 20:34558496-34558518 CCCGAACTCAAGGTAAGGCCCGG - Intronic
1172641038 20:36440663-36440685 GCTGAGGTCCAGGTCTGGGCTGG - Intronic
1172875026 20:38158860-38158882 CCCCAACTCCAGGCCTGGCCTGG - Intronic
1174200568 20:48803815-48803837 CATGACCTCAAGGTCAGGCCAGG + Intronic
1174387325 20:50194858-50194880 CCTGAACTTGAGGTCAGGCAAGG - Intergenic
1174452531 20:50628975-50628997 CCTGAGCTCCAGACCAGGCCAGG - Intronic
1174745616 20:53058806-53058828 GCAGAGATCCAGGTCTGGCCTGG + Intronic
1174862415 20:54103458-54103480 GCTGAAATCCAGGTGTGGGCTGG + Intergenic
1175335472 20:58193210-58193232 CCTGTGCTCCTGGTCTGGCAGGG - Intergenic
1175766569 20:61596631-61596653 CTTGAACACCAGCTCTGGTCTGG + Intronic
1175780365 20:61678649-61678671 TCTGAAATCCAGGTGTGGGCAGG + Intronic
1176030407 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG + Intergenic
1176077446 20:63254737-63254759 CCTCAGCTGCAGGTCTGTCCTGG - Intronic
1176313153 21:5165338-5165360 CCTGAGCTCCAGGTGCCGCCAGG - Intergenic
1176411143 21:6450241-6450263 CCTGACCTCCAGGTGGGCCCAGG + Intergenic
1177961386 21:27670947-27670969 CCCAAACTCCAGCTCTGGACTGG + Intergenic
1178468592 21:32871417-32871439 GCTGGTCCCCAGGTCTGGCCAGG - Intergenic
1178855935 21:36250466-36250488 CAGGAACCCCAGGTCAGGCCAGG - Intronic
1179243188 21:39609652-39609674 CCTGAAGTCCCGTTCTGGCAGGG + Exonic
1179486089 21:41711770-41711792 CCTGAAATCAAGGTGTGTCCCGG + Intergenic
1179629775 21:42669206-42669228 GCTGAAATCCAGGTGTGGGCAGG + Intronic
1179686636 21:43058563-43058585 CCTGACCTCCAGGTGGGCCCAGG + Intronic
1179712324 21:43270419-43270441 CCTGGACTCCACGCCCGGCCTGG - Intergenic
1179843895 21:44096692-44096714 CCTGAGCTCCAGGTGCCGCCAGG + Intronic
1180308862 22:11152136-11152158 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1180547339 22:16513947-16513969 CATGAAAGCCAGGTCTGGCCAGG + Intergenic
1180901200 22:19374600-19374622 CCAGAACTGCATGTCTGGACAGG - Intronic
1181270116 22:21653664-21653686 CTGGAACTCCAGGCCTGGTCAGG + Intronic
1181849812 22:25742035-25742057 TGTGAGCTCCAGGTCTGGCCAGG - Intergenic
1181852158 22:25757303-25757325 CTTGAAGTCCTGGTCAGGCCAGG + Intronic
1182211826 22:28683387-28683409 CATGAAAGCCAGGTCTGACCAGG - Intergenic
1182237628 22:28888820-28888842 ATTGAAACCCAGGTCTGGCCGGG + Intronic
1182740351 22:32562920-32562942 CCTGAACTCCAGTTCCAGCTGGG + Intronic
1183364717 22:37400710-37400732 CTTGAACTCCTGTTCTGGGCCGG - Intronic
1183407561 22:37637992-37638014 CCTGAGCCCCAGCTCCGGCCTGG - Intronic
1184198883 22:42951457-42951479 CCTGAGCTCCAGATCCGGCATGG + Intronic
1184274429 22:43402010-43402032 CAGGAACTCCAGGCCTGGCCTGG + Intergenic
1184561264 22:45264222-45264244 CCTCAGCTCCAGCTCTGTCCTGG - Intergenic
949875107 3:8621436-8621458 CCAGATCTCCAGGGATGGCCAGG - Intronic
950526626 3:13528299-13528321 TCTGAACCCCAGGTCTGGGCGGG + Intergenic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
953813624 3:46135055-46135077 CCTGGACCAGAGGTCTGGCCAGG + Intergenic
961484725 3:127208747-127208769 CCTGACCTCCAGCCCGGGCCTGG - Intergenic
962214026 3:133504203-133504225 CAAGAACTCAAGCTCTGGCCTGG - Intergenic
966729124 3:183135933-183135955 GCTGAGCTCCAGCTGTGGCCGGG + Intronic
968565944 4:1312911-1312933 CCTGCCCTCCGGTTCTGGCCTGG - Intronic
968649498 4:1754868-1754890 CTTGAACTCCAAATCTGCCCTGG + Intergenic
969677229 4:8620827-8620849 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
969678181 4:8626465-8626487 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
969679137 4:8632103-8632125 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
969704789 4:8785841-8785863 CCTGAGATCCAGGTGTGGGCAGG - Intergenic
971330488 4:25677417-25677439 CCTGAACTCTAGTTCAGGCGTGG - Exonic
971812254 4:31441458-31441480 TTTGAACTCCACGTATGGCCAGG - Intergenic
974057866 4:57002323-57002345 CGAAAACTCCAGGTCGGGCCTGG - Intronic
978739815 4:112123869-112123891 TCTGAACCCCAGGTCTGGGGAGG - Intergenic
979276062 4:118815468-118815490 CCAGCACCCAAGGTCTGGCCTGG + Exonic
980435340 4:132764713-132764735 CAAGAACTCCTGGACTGGCCTGG + Intergenic
982252819 4:153424466-153424488 CCAGAAGTTCAGGACTGGCCTGG - Intergenic
982368355 4:154605618-154605640 CATGAACTACAGCTCTGGCATGG + Intronic
983539182 4:168890252-168890274 CCTGAACTTCTGGTGAGGCCAGG - Intronic
983648825 4:170018855-170018877 ACAGAACTGCAGGCCTGGCCGGG + Intronic
985655132 5:1127490-1127512 TCTGAAGTCCAGGTGTGGGCAGG - Intergenic
985899869 5:2780106-2780128 CCTGAGATCCAGGTGTGGGCAGG + Intergenic
991301547 5:65133574-65133596 CCAGCAGTCCAAGTCTGGCCTGG - Intergenic
993613610 5:90084210-90084232 CCTGAACTCGAGCTGTGGACTGG - Intergenic
995433759 5:112112348-112112370 GCTGAAGTCCAGGCATGGCCAGG + Intergenic
995444213 5:112224593-112224615 CCTGAATTCCTGGTCTGCCTTGG - Intronic
997609836 5:135208114-135208136 CCTGACCCCCAGCTGTGGCCAGG + Intronic
998164903 5:139837320-139837342 CCTGAGCCCCAGGTCCTGCCTGG - Intronic
998456091 5:142274616-142274638 CCTGAAATGCAGGCCTGGCTTGG + Intergenic
1000195374 5:158952090-158952112 CCTGAGCTCCAGGCAGGGCCAGG + Intronic
1003162873 6:3651031-3651053 CCTGAACTCCTTGTCTCTCCTGG + Intergenic
1005809141 6:29502965-29502987 TCTGAAATCCAGGTCTGGGCAGG + Intergenic
1006030294 6:31172640-31172662 CCAGAAGGCCAGGTCTGGACTGG + Intronic
1007493827 6:42245190-42245212 CCTCCCCTCCAGGACTGGCCTGG - Intronic
1011399064 6:86940046-86940068 CCTGAACTAGAGGTGTGTCCTGG - Intronic
1013059227 6:106615680-106615702 CCTGAAATTCATGTCTTGCCGGG - Intronic
1015896338 6:138020563-138020585 GCTGAAATCAAGGTCTGGGCAGG + Intergenic
1017676474 6:156819768-156819790 CCTGAACTCCAGGCCCGGGCAGG - Intronic
1018150581 6:160933574-160933596 CATGTCCTCCAGGTGTGGCCAGG + Intergenic
1018525679 6:164707976-164707998 CCTGAGCTGCAGGTCTGTCGGGG + Intergenic
1018566657 6:165161910-165161932 CCTTACTTCCAGGTCTGTCCAGG - Intergenic
1018672708 6:166192892-166192914 CCTGAATTCCAGATTTGGTCTGG - Intergenic
1018865812 6:167746286-167746308 CGTGAAGCCCAGCTCTGGCCGGG - Intergenic
1019307385 7:342286-342308 CCTGCCATCCCGGTCTGGCCAGG - Intergenic
1019327922 7:447319-447341 ACTGAAATCAAGGTCAGGCCAGG - Intergenic
1019592774 7:1844092-1844114 CCACAACTCCAGGTGTGTCCTGG + Intronic
1019876030 7:3811663-3811685 CCTGAACTGCGGGGCTGGCCTGG - Intronic
1020027469 7:4909374-4909396 CTTGAATTCCTGGTCTGGCGAGG - Intronic
1020090108 7:5333961-5333983 CCTGGACACCAGCTCTGACCTGG - Intronic
1023302809 7:38792027-38792049 TGTGAATTCCAGCTCTGGCCAGG - Intronic
1023779800 7:43645164-43645186 CCTTAACTCCAGGACTTTCCAGG + Intronic
1024237214 7:47407844-47407866 CCTGAGATCCAGGTGTGGGCAGG - Intronic
1024359594 7:48454681-48454703 TCTTAACTCCAGGTCTCTCCTGG - Intronic
1024993582 7:55254762-55254784 CGTGAGCTGCAGGGCTGGCCTGG - Intronic
1026036265 7:66832623-66832645 CCTGACCTCCAGTTCCGGTCTGG - Intergenic
1027214332 7:76174120-76174142 CCTGACCTCCAGTTCTGGTCTGG + Intergenic
1027358713 7:77385668-77385690 CCTCAATTCCAGATATGGCCTGG - Intronic
1029733450 7:102452473-102452495 ACTGCACTCCAGCTCTGGCCTGG - Exonic
1029899751 7:104026401-104026423 CCTGAACTCTATGTCTGGATTGG - Intergenic
1032127400 7:129205068-129205090 CCTGAATCCCAGGGCTGGCTTGG - Intronic
1032756017 7:134891555-134891577 CCTGACCGCCCGGCCTGGCCAGG + Intronic
1033492274 7:141855126-141855148 CATGAACTCCTGGCCAGGCCAGG + Intergenic
1035108263 7:156459826-156459848 CCATAACTCCAGGTCTCTCCAGG - Intergenic
1035173441 7:157033647-157033669 GCTGTGCTCCAGGCCTGGCCAGG + Intergenic
1035401338 7:158567871-158567893 TCCCAACTCCAAGTCTGGCCTGG + Intronic
1035674884 8:1449578-1449600 CCTGAGCTCCAGGGTGGGCCTGG + Intergenic
1037496170 8:19443088-19443110 CCAGACCTCTAGCTCTGGCCTGG + Intronic
1037899853 8:22681566-22681588 CCTGCAGCCCAGGGCTGGCCTGG + Intergenic
1039212967 8:35236430-35236452 CCCGAGCTCCAGGGCTGGCTGGG - Intronic
1041348225 8:56923397-56923419 CCTGAAATCAAGGTGTGGGCAGG - Intergenic
1044811099 8:96063016-96063038 AATGAACTCCACATCTGGCCTGG + Intergenic
1046129912 8:109954408-109954430 ACTGACCTCCAGGTCTTTCCTGG + Intergenic
1048073180 8:131041645-131041667 CCTGCCATCCAGATCTGGCCAGG + Exonic
1049379015 8:142302795-142302817 CCTGCACCCCAGGTCTAGCCTGG - Intronic
1049658253 8:143808384-143808406 CTTGGACTCCAGGCCTGCCCTGG - Intronic
1052795892 9:32923128-32923150 CAAGAACTGCAGGACTGGCCAGG + Intergenic
1052989787 9:34512441-34512463 TCTCACCTCCAGGCCTGGCCAGG + Intronic
1053067264 9:35077468-35077490 CTTGAGCTCAAGGTCTAGCCAGG - Intronic
1056436188 9:86577864-86577886 CCTGCCCTCCTGGCCTGGCCGGG + Intergenic
1061230692 9:129314119-129314141 TCAGAACTCCAGGGCAGGCCTGG - Intergenic
1061487724 9:130928777-130928799 GCTGGATTCCAGGTCTGACCTGG + Intronic
1062173956 9:135150687-135150709 GCTGAAGTCAAGGTCTGGACAGG + Intergenic
1062411350 9:136426585-136426607 ACTGTACTCCAGGGCTAGCCTGG - Intergenic
1062656743 9:137607504-137607526 CCTGAACCCCAGCCCTGGACTGG - Intronic
1185872335 X:3674397-3674419 CCTGACCTCCATGGCTGACCAGG - Intronic
1186302553 X:8216343-8216365 CCTGACCTCCCCGTCTGGCAGGG + Intergenic
1186523190 X:10223614-10223636 CCTGAGCTCCACCGCTGGCCTGG + Intronic
1191082674 X:56530200-56530222 CCTGAACTCAAGTCCTGGCTTGG - Intergenic
1197728763 X:129793470-129793492 CCTGGACTGCAGAGCTGGCCTGG + Intronic
1199169343 X:144717864-144717886 CATGAACCCCAGTCCTGGCCAGG - Intergenic
1199982296 X:152927775-152927797 CCTGAGCCCCAGGCCTGCCCTGG - Intronic
1200791571 Y:7304284-7304306 CCTGACCTCCATGGCTGACCAGG + Intergenic
1201188112 Y:11423182-11423204 CATGAAAGCCAGGTCTGGCCAGG + Intergenic