ID: 1077043429

View in Genome Browser
Species Human (GRCh38)
Location 11:534447-534469
Sequence CTGTGGGTTTGCCCTTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077043429_1077043438 9 Left 1077043429 11:534447-534469 CCATCTGAAGGGCAAACCCACAG 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1077043438 11:534479-534501 GGCCCCAACGCCAGGCAGCAAGG 0: 1
1: 0
2: 3
3: 30
4: 259
1077043429_1077043435 1 Left 1077043429 11:534447-534469 CCATCTGAAGGGCAAACCCACAG 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1077043435 11:534471-534493 GGTCCCTGGGCCCCAACGCCAGG 0: 1
1: 0
2: 0
3: 36
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077043429 Original CRISPR CTGTGGGTTTGCCCTTCAGA TGG (reversed) Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
901405892 1:9045560-9045582 CTGTGGGTTTTCTCTGCAGTGGG - Intronic
901641542 1:10695289-10695311 CTTTGGTTTTGCCCTTAAAACGG + Intronic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904329764 1:29750920-29750942 CTGTGGTTCTGCCCTCCACAGGG - Intergenic
907950551 1:59179112-59179134 CTGTGATTTTGCCCTTTAGATGG + Intergenic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
909725268 1:78827309-78827331 CTCTGGATTTGCTCTTGAGAAGG + Intergenic
910241974 1:85096683-85096705 CAGTGGGTTTGACCATCAAAAGG + Intronic
911274496 1:95844470-95844492 CTGGGTGTTTGCCACTCAGAGGG - Intergenic
914312301 1:146477613-146477635 CTGTGGGTTTTACCTTGAAAGGG + Intergenic
914412047 1:147438704-147438726 CTTTGGGTCTTCCCTTCACATGG - Intergenic
914502048 1:148255723-148255745 CTGTGGGTTTTACCTTGAAAGGG - Intergenic
914515487 1:148370648-148370670 CTGTGGGTTTTACCTTGAAAGGG + Intergenic
915689168 1:157670334-157670356 ATGTGGGTGTGGCCTTTAGAAGG - Intergenic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
915971288 1:160356912-160356934 CTGTCCCTTTACCCTTCAGATGG - Intronic
919042181 1:192403522-192403544 CTGTTTCTTTTCCCTTCAGAGGG + Intergenic
923318543 1:232805648-232805670 CTGTTGGTTTACCCTCCTGACGG + Exonic
1063108592 10:3015460-3015482 CTGCGGGATTGCCCTTGAGTTGG + Intergenic
1064169570 10:13018295-13018317 CTGTGAGTCTTCCCTTCAGCAGG - Intronic
1065367168 10:24948028-24948050 TGGTGGGTTTGCCCCACAGAAGG + Intronic
1067545159 10:47187682-47187704 CTGTGGGACTGCCCTGCAGCGGG - Intergenic
1068441342 10:57058551-57058573 CCTTGGGTATGTCCTTCAGAAGG - Intergenic
1070711278 10:78685053-78685075 CTGTGAGTGCGCTCTTCAGAAGG + Intergenic
1074503582 10:114046211-114046233 CAGCGGGTTTGCCCTACACAAGG - Exonic
1075830714 10:125408603-125408625 CAGTGACTTTGCCCTACAGAAGG + Intergenic
1075998503 10:126896672-126896694 CTGTGGTTTGAACCTTCAGATGG + Intergenic
1076438903 10:130465796-130465818 CCGTGGGTGTGCCCTTGACATGG + Intergenic
1076845630 10:133068228-133068250 CTGTGGGTTTGCTCTGCAATGGG + Intergenic
1077043429 11:534447-534469 CTGTGGGTTTGCCCTTCAGATGG - Intronic
1085213873 11:74810214-74810236 TTGTGGATTTGATCTTCAGAGGG - Exonic
1087894573 11:103573178-103573200 AGGTGGGTTGGCCCATCAGAAGG + Intergenic
1088221038 11:107570272-107570294 CTGTTGGTGTGCCCTTCCGCCGG + Intergenic
1088602906 11:111498604-111498626 CTGAAGGCTTGCCCTTTAGAAGG + Exonic
1088918491 11:114244813-114244835 CTGTGCCTTTCCCCTCCAGAGGG - Intronic
1092882669 12:12900136-12900158 CTCTGGCTTTGTCCTTCAGGTGG + Intronic
1092990732 12:13896400-13896422 CGATGGGTTAGTCCTTCAGAAGG + Intronic
1093876440 12:24354353-24354375 CAGTGGGTCTGCTCTGCAGAAGG + Intergenic
1095259280 12:40080277-40080299 GAGTGGGTTTGCATTTCAGATGG + Intronic
1101767160 12:107712381-107712403 CTTTGTGCTTGCTCTTCAGATGG + Exonic
1102106654 12:110330286-110330308 ATGTGGGTTTGGACTTCACAAGG - Intronic
1105231033 13:18496015-18496037 CTGTGTGTTTGTCCCTCACATGG - Intergenic
1105515837 13:21089998-21090020 ATGTGGAGTTGCCCTTCAAAGGG + Intergenic
1106806197 13:33309896-33309918 CTGTGTGTTTTTCCTTCATATGG + Intronic
1107606044 13:42058091-42058113 CTATGTGTATGCCCCTCAGAAGG + Intronic
1108949538 13:56073288-56073310 CTGTTGGTTTGCCATATAGATGG - Intergenic
1111526398 13:89476528-89476550 GGGTGGTTTTGCCCATCAGATGG - Intergenic
1111556589 13:89888996-89889018 CTGTGGGTCAGCTCTTAAGAAGG + Intergenic
1112819648 13:103316709-103316731 CTCTGGCTTTGGCCTTTAGAAGG + Intergenic
1114023999 14:18507827-18507849 CTGAGTGTTTGCCCCTCACATGG + Intergenic
1114024711 14:18514464-18514486 CTGTTTGTTTGCCCATCACAAGG + Intergenic
1114866395 14:26598964-26598986 GTGTGGGTCTTCCCTTCACAAGG + Intergenic
1115188404 14:30719273-30719295 CTGTGGAATTTCTCTTCAGAAGG - Intronic
1119372746 14:74161659-74161681 CCATGTGTTTTCCCTTCAGAGGG - Intronic
1119620015 14:76125019-76125041 CTGTGGGTGTACCCTTGAGTTGG - Intergenic
1120981125 14:90290059-90290081 GTGTGTGTTTGCCCTTCTGAGGG - Intronic
1121019232 14:90569014-90569036 CACTGGGTTTGCCCCTCTGATGG + Intronic
1121660272 14:95630045-95630067 CTGTGGGTTTGACCAGCTGAAGG + Intergenic
1124613349 15:31224083-31224105 CAGAGGGTTTGCCCGTGAGAAGG - Intergenic
1127450169 15:59108923-59108945 CTTTGGGTTTGGCTTTCAGGAGG - Intronic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1131008104 15:88995061-88995083 CTCTGGGATTCCACTTCAGAAGG - Intergenic
1131885758 15:96911193-96911215 CTATGGGTTGGCCCTTGACAGGG - Intergenic
1139395284 16:66633869-66633891 CTGTGTGTTTGCCCAACAAAAGG - Intronic
1139484810 16:67249403-67249425 CTGAGGATTTGCCTTTCTGAAGG + Intronic
1140648742 16:77064261-77064283 CAGCGGGTGTGCCCTTTAGATGG + Intergenic
1141921474 16:87138513-87138535 TTGTTGCTGTGCCCTTCAGAGGG + Intronic
1142165124 16:88582528-88582550 CTGTGGGTTTCCACTTCAAGTGG + Intronic
1142206867 16:88787203-88787225 CTGGGAGCTTGCCCTGCAGATGG + Intergenic
1142234186 16:88913939-88913961 CTGTGGGTTGGCTCTTCTGCAGG - Intronic
1142314631 16:89335826-89335848 CTGTGAGTTTCCCCTACAGCTGG + Intronic
1144843804 17:18205400-18205422 CTTTGGGTTGGCCTTGCAGAGGG - Intronic
1144998285 17:19285896-19285918 CTGGGGGTTTGGCCTCCAGCAGG + Intronic
1152672076 17:81614531-81614553 CTGGGAGTTTGCCCTTTAGAAGG - Intronic
1154522403 18:15244076-15244098 CTGTGTGTTTGTCCCTCACATGG + Intergenic
1160066763 18:75582940-75582962 CTCTGCTTTTGCCCTTGAGAAGG - Intergenic
1160418982 18:78731467-78731489 CTGTGGGTTTGCTCATCACATGG + Intergenic
1160418990 18:78731505-78731527 CTGTGGGTTTGCTCATCACCTGG + Intergenic
1164560118 19:29285885-29285907 CTGTTGGTTTGCATTTCAGAGGG + Intergenic
1164796937 19:31041097-31041119 CAGTGGGTTTGGCCTCCACAGGG + Intergenic
1164836654 19:31359324-31359346 CAGTGGGTGTGCCCCGCAGATGG + Intergenic
1164952209 19:32345968-32345990 CTCTGGGCTTGCCCTGCAGCTGG + Intronic
1166050274 19:40255121-40255143 CTGTGTGGCTGCCCTTGAGAGGG - Intronic
925575159 2:5352526-5352548 CTTAGGGCTTGCCCCTCAGAGGG - Intergenic
925616704 2:5750559-5750581 CTGGGGTTTTGCCCTCAAGAAGG + Intergenic
928375376 2:30769283-30769305 TTGTCGGGTTGTCCTTCAGAAGG + Intronic
929041791 2:37751532-37751554 CTGTGGGTATTCCCATCAGGGGG - Intergenic
929910455 2:46085225-46085247 CTGTGGTTTGGCCGTTCTGAGGG + Intronic
935680498 2:105632255-105632277 CTGTGCGTGAGCACTTCAGAAGG + Intergenic
938521656 2:132076645-132076667 CTGTGTGTTTGTCCCTCACATGG + Intergenic
943101986 2:183497932-183497954 CTCTGGATTTGGCCTTTAGAAGG - Intergenic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
1169179801 20:3553717-3553739 CTGTGTGTTTGCCCTTCCCTTGG + Intronic
1171349982 20:24494700-24494722 CTGTCCCTTTGCCCTGCAGAAGG + Intronic
1172989140 20:39019244-39019266 CTGTGTGATTGCACTTCTGAGGG - Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173437234 20:43044205-43044227 CTGTGGATTTGCCCTTCTGCTGG - Intronic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1174710400 20:52698337-52698359 CTGTGAATCTCCCCTTCAGATGG + Intergenic
1175315339 20:58043348-58043370 CTGTGGGAGTGTCCTTCAAAAGG + Intergenic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1176066736 20:63201501-63201523 GAGTGTGTTTGCTCTTCAGAAGG - Intronic
1176089578 20:63312943-63312965 GGGTGGGTTTGTCCTTCCGAGGG + Intronic
1176775023 21:13124368-13124390 CTGTGTGTTTGTCCCTCACATGG - Intergenic
1178839062 21:36124050-36124072 TTGTTGTTTTGCCCTCCAGAGGG - Intergenic
1179726286 21:43343239-43343261 CTGTGTGGGTGGCCTTCAGAGGG + Intergenic
1179918020 21:44490548-44490570 CTGTGGGTGTGCTCTTCCGCCGG - Intergenic
1180220545 21:46355605-46355627 CCTTGGCTGTGCCCTTCAGAGGG - Exonic
1180448169 22:15435358-15435380 CTGAGTGTTTGCCCCTCACATGG + Intergenic
1180448871 22:15441945-15441967 CTGTTTGTTTGCCCATCACAAGG + Intergenic
1180449194 22:15445201-15445223 CTGAGTGTTTGCCCCTCACATGG + Intergenic
1180523359 22:16230975-16230997 CTGAGGGTTTCCCCATCACATGG - Intergenic
1180621632 22:17166472-17166494 CTGTGGTTCTTGCCTTCAGAAGG - Intergenic
1180717455 22:17881482-17881504 CTGTGGCTGTGCCTATCAGAAGG - Intronic
1181306746 22:21921400-21921422 CTGTGGCTTGGCCCTGCAGATGG + Exonic
1184960223 22:47923173-47923195 CTGTGTGGTTTCCCTTGAGAGGG - Intergenic
1184978841 22:48081793-48081815 GTGTGGGTGTGCCCTTCTGTAGG - Intergenic
951151491 3:19295701-19295723 CTGTGGGTTTGTACTTCAGTGGG + Intronic
952191376 3:31026626-31026648 TTGCTGGTTTGCCCATCAGAAGG + Intergenic
954598806 3:51851866-51851888 GGGTGGTTTTGCCTTTCAGATGG + Intergenic
954641467 3:52101183-52101205 CTGTGGGCATGCCCCTCAGAGGG - Intronic
954842857 3:53527291-53527313 GTGTGGATTTGCCTTTCTGATGG + Intronic
958109621 3:89123538-89123560 CTGTTGATTTGACTTTCAGATGG - Intronic
958161359 3:89819331-89819353 CTGTGGGTTTGTCATTATGATGG - Intergenic
959239961 3:103777847-103777869 CTTGTGTTTTGCCCTTCAGAGGG - Intergenic
964242858 3:154616544-154616566 CTGCGGGTTTGCCCACCAGAGGG - Intergenic
966767393 3:183475573-183475595 CTGAGGGTTAGGCCATCAGATGG + Intergenic
968756707 4:2419836-2419858 GAGGGGTTTTGCCCTTCAGAGGG - Intronic
968876167 4:3269066-3269088 CTGTGGGTTGGCCCTCAAGGAGG + Intronic
970720962 4:18987907-18987929 CTGTGTGCTTCCCCTTCACAAGG + Intergenic
970808684 4:20065521-20065543 TTGTGGGTTTTGCATTCAGAAGG - Intergenic
975595967 4:76048473-76048495 GGGTGGTTTTGCCTTTCAGATGG - Intronic
976678165 4:87725907-87725929 CTGTGGGTTTTCCCGGCACACGG - Intergenic
978229401 4:106380502-106380524 CTGTGGGTTGTCTCTTCAGCTGG + Intergenic
983330623 4:166323072-166323094 CTCTGGGTTTACCCTTTATAGGG + Intergenic
983792508 4:171814393-171814415 CTGTGCGTTTGTTCTGCAGATGG + Exonic
986697674 5:10373235-10373257 TTGTTGGTTTGTCATTCAGAAGG + Intronic
993331531 5:86606198-86606220 TTGTGTGTTTGTCCTTCACATGG - Intergenic
993869928 5:93240551-93240573 CTGTGGGTTTCCCCTTGGGAGGG - Intergenic
994301936 5:98157601-98157623 CTGTCGGTATGCTCTTCTGATGG + Intergenic
994674700 5:102805598-102805620 CTGTGGGTGTGTACTTCACAAGG + Intronic
995263925 5:110136923-110136945 GTGTGTGTTTGCACTTGAGACGG + Intergenic
996526706 5:124488131-124488153 CTGTGTGTTTGCACATGAGATGG + Intergenic
997437359 5:133885142-133885164 CTGTGACTGTGACCTTCAGAGGG - Intergenic
998361202 5:141589273-141589295 CGTTGGGAGTGCCCTTCAGATGG + Intronic
999776919 5:154819298-154819320 CTGTGGTTTTGCCTTTGATAAGG + Exonic
1004166995 6:13265635-13265657 CCCTGGGTTTGACCTTCAGCAGG + Intronic
1006368504 6:33630336-33630358 CTGAGGGTCTGCCCTGCTGAGGG + Intronic
1015678782 6:135781165-135781187 GTGTTGTCTTGCCCTTCAGATGG + Intergenic
1017230821 6:152071491-152071513 CTGTGTGCTTGCCCATGAGATGG + Intronic
1018741070 6:166729040-166729062 CTGTGGGGTGGCCCTTCCGCAGG - Intronic
1019056147 6:169224933-169224955 CTGTGTGTGTGCCCTTCAACAGG - Intronic
1019152796 6:170019971-170019993 GAGTGGGTTTGCCTTACAGAAGG - Intergenic
1019365435 7:630295-630317 CTGGGGGTTTGCCTCTCCGATGG - Intronic
1020086031 7:5311289-5311311 CAGTGGGTTAGCTGTTCAGAAGG - Intronic
1022131619 7:27409902-27409924 TTGTTGGTTTGTCTTTCAGATGG + Intergenic
1024481245 7:49865709-49865731 GTTTGGGTCTGCCCTTCTGAAGG - Intronic
1025663677 7:63571095-63571117 CAGTGGGTTAGCTGTTCAGAAGG - Intergenic
1026216977 7:68358325-68358347 CTGTGTGGTTGCCCTTTGGAAGG + Intergenic
1028444008 7:90898020-90898042 CTTTGCCTTTGCCCTTCAGTTGG + Intronic
1028667378 7:93362494-93362516 CTTTGGATTTCACCTTCAGATGG + Intergenic
1030303749 7:108000421-108000443 CTGTACAATTGCCCTTCAGAAGG - Intronic
1032414332 7:131724884-131724906 TTGTGGGCTTGCACTTTAGAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035256666 7:157633606-157633628 CTGAGAGTTTACCCTTCAGAGGG - Intronic
1038822615 8:30966563-30966585 TTGTGGGTTAGGCCTTCAAAAGG + Intergenic
1042585557 8:70334297-70334319 CTGTTGGCTTGACCTTCTGATGG + Intronic
1044640829 8:94379641-94379663 CTGTAGGTTTGCACCTCAGTTGG - Intronic
1045163978 8:99582122-99582144 CAATTGGTTTACCCTTCAGAAGG + Intronic
1046166257 8:110440239-110440261 CTGTGGGTTTGTACCACAGATGG - Intergenic
1053700369 9:40683914-40683936 CTGTGTGTTTGTCCCTCACATGG + Intergenic
1054311661 9:63483312-63483334 CTGTGTGTTTGTCCCTCACATGG + Intergenic
1054410443 9:64807465-64807487 CTGTGTGTTTGTCCCTCACATGG + Intergenic
1055594169 9:77848677-77848699 CTGAGCCTTTGCCCTTCTGAGGG + Intronic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1061672191 9:132194897-132194919 CTGTGGCTCAGCCCCTCAGAAGG + Intronic
1186883231 X:13887267-13887289 CTTTGGGTTTCTCCTTCAGGAGG + Intronic
1189326288 X:40113519-40113541 CTGTGTGGTTGGCCTTCAGAGGG - Intronic
1189768364 X:44395329-44395351 CTGAAAGTGTGCCCTTCAGAGGG + Intergenic
1190263229 X:48812440-48812462 CAGTGAGTTGGCTCTTCAGAAGG + Intronic
1191133077 X:57035923-57035945 GTGTGTGTTTGCACTTGAGATGG + Intergenic
1193960049 X:87914398-87914420 CAGTGGTCTTGCCCATCAGATGG + Intergenic
1195823888 X:108976314-108976336 CTGTGGGTTGTCTCTTCAGTTGG - Intergenic
1196565655 X:117201623-117201645 CTGTTGTTTTGCTCTGCAGAAGG + Intergenic