ID: 1077043813

View in Genome Browser
Species Human (GRCh38)
Location 11:535702-535724
Sequence GCTTCCGGGAGCAACGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077043796_1077043813 25 Left 1077043796 11:535654-535676 CCCCGGTTGGCTGAGCGGCCCGT 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043801_1077043813 7 Left 1077043801 11:535672-535694 CCCGTCTGTCAGGAGCCGCGGTC 0: 1
1: 0
2: 0
3: 0
4: 55
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043795_1077043813 28 Left 1077043795 11:535651-535673 CCACCCCGGTTGGCTGAGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043792_1077043813 30 Left 1077043792 11:535649-535671 CCCCACCCCGGTTGGCTGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043798_1077043813 23 Left 1077043798 11:535656-535678 CCGGTTGGCTGAGCGGCCCGTCT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043808_1077043813 -8 Left 1077043808 11:535687-535709 CCGCGGTCGGGCGGGGCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043802_1077043813 6 Left 1077043802 11:535673-535695 CCGTCTGTCAGGAGCCGCGGTCG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043797_1077043813 24 Left 1077043797 11:535655-535677 CCCGGTTGGCTGAGCGGCCCGTC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1077043794_1077043813 29 Left 1077043794 11:535650-535672 CCCACCCCGGTTGGCTGAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077043813 Original CRISPR GCTTCCGGGAGCAACGCGGG AGG Intronic
902457864 1:16548694-16548716 GCTTCCGGGAGCAACTGGCCCGG - Intergenic
902475310 1:16681035-16681057 GCTTCCGGGAGCAACTGGCCCGG - Intergenic
902494295 1:16859219-16859241 GCTTCCGGGAGCAACTGGCCCGG + Intronic
922240627 1:223753260-223753282 GCTTCCGTGAGCATGGCGGAAGG - Intronic
1069846769 10:71377487-71377509 GCTTCCGGGAGCCGCGGGGCAGG + Intergenic
1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG + Intronic
1081808307 11:45901752-45901774 GCTTCCCTGAGCAAGGCGGAGGG + Intronic
1087034395 11:93741553-93741575 GCTTCCGGGAAGAAGGCGAGCGG + Exonic
1092270238 12:7018173-7018195 TCTTCCCGGAGCCACCCGGGAGG - Intronic
1104951825 12:132444535-132444557 GCAGCCTGGAGCAACGCTGGAGG + Intergenic
1107935322 13:45341247-45341269 GCCTCCGGAAGCGACGCAGGCGG + Exonic
1112506740 13:99980479-99980501 GCTCCCGGGAGCGCCGCGGTCGG + Intergenic
1113592512 13:111511049-111511071 GCATCCCGGAGCAATGCAGGTGG + Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1119539381 14:75428437-75428459 GCTGCCGGGCGCCTCGCGGGAGG - Intronic
1121578049 14:95004472-95004494 GCCTGTGGGAGCTACGCGGGAGG + Intergenic
1132513247 16:354110-354132 GCTGCCTGGAGCATCCCGGGAGG - Intergenic
1132895745 16:2228612-2228634 GGTTCCGGGGGCCACGTGGGCGG + Intronic
1135201560 16:20441977-20441999 GGTTCTGGGAGCAACCCTGGAGG + Intergenic
1135217548 16:20585889-20585911 GGTTCTGGGAGCAACCCTGGAGG - Intergenic
1138633690 16:58319624-58319646 GCTTCCGGGAGCAAGGCACGTGG - Intronic
1138685398 16:58720827-58720849 CTTTCCGGGACCAAGGCGGGTGG - Intronic
1142508444 17:380527-380549 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508470 17:380593-380615 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508495 17:380659-380681 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508556 17:380833-380855 GCTTCCGGGAGGGATGAGGGGGG - Intronic
1142508574 17:380877-380899 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508600 17:380946-380968 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508695 17:381211-381233 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508720 17:381277-381299 GCTTCCGGGAGGCATGAGGGGGG - Intronic
1142508729 17:381299-381321 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1142508768 17:381392-381414 GCTTCCGGGAGGGATGTGGGGGG - Intronic
1144889914 17:18488761-18488783 GCTTCGGTGAGCAGCGCAGGGGG - Intronic
1145142300 17:20455556-20455578 GCTTCGGTGAGCAGCGCAGGGGG + Intronic
1146958105 17:36948946-36948968 ACTTCCGGGAGGCGCGCGGGAGG - Exonic
1151477394 17:74351883-74351905 GCTGCCGGGAGCTGCGCGCGCGG + Exonic
1161730803 19:5959446-5959468 GCTTCGGGGAGCATGGTGGGGGG - Intronic
1162020189 19:7864721-7864743 GGCTCCGGGAGCACCGAGGGGGG - Intronic
1163404200 19:17112425-17112447 GCTTCAGGGAGCAGGGCGGACGG + Intronic
1163829881 19:19542495-19542517 GGTTCCGTGAGCATCGCTGGTGG - Exonic
1166856715 19:45785976-45785998 GCTGGCGGGGGCAAGGCGGGCGG - Exonic
925927532 2:8681277-8681299 GCAACCCGGAGCAGCGCGGGAGG - Intronic
934524749 2:95044770-95044792 GCTTCCGGCAGCTGCGCGGAGGG - Intronic
937412033 2:121685101-121685123 GCTGCCGGGAGCAAGGTGGTGGG + Intergenic
939342573 2:140917669-140917691 GCTTCCAGGAGCTAAGGGGGAGG + Intronic
947872324 2:233446283-233446305 GCTTCTGGGAGCAACTAGGAAGG - Intronic
948618524 2:239217209-239217231 GCTTCCGGGAGCGATGCTGCCGG - Intronic
1171249491 20:23637545-23637567 GGGTCCGGGAGCAGCGCGGGGGG + Intronic
1176050433 20:63116495-63116517 GCTGCAGGGAGCTGCGCGGGGGG + Intergenic
1179926767 21:44539145-44539167 GCTCCTGGGAGCAAGGAGGGGGG + Exonic
1182424178 22:30263542-30263564 GCCTCGGGGAGCAAGGCAGGGGG + Exonic
1184187047 22:42871856-42871878 GCTGCTGGGAGCAAGGCGGCCGG - Intronic
954127355 3:48539370-48539392 GCTCCGAGGAGCAAGGCGGGAGG - Intronic
954256540 3:49411614-49411636 GCTTCCGGGGACTGCGCGGGCGG + Intronic
966886414 3:184380090-184380112 GCGGCCGGGAGGAGCGCGGGCGG - Exonic
968924104 4:3538483-3538505 GCGTCCGGGAGGGAGGCGGGGGG - Intergenic
974034257 4:56803618-56803640 GCTTCAGGCAGCAAAGCAGGTGG - Intergenic
977043392 4:92041184-92041206 GATACCGGGAGCAAGGCGGCAGG + Intergenic
986737976 5:10681837-10681859 GCTTCCTGTAGGAACGCTGGTGG - Intronic
993667529 5:90719084-90719106 TCTTCCGGGGGCTAGGCGGGCGG + Intronic
995142450 5:108749028-108749050 GTTGCCCGGGGCAACGCGGGGGG + Intronic
999368215 5:151036762-151036784 GCTTCCGGGAGGAAATCAGGTGG - Intronic
1003206909 6:4021210-4021232 GCTTCCGGGAGCATGGTGGGCGG - Intergenic
1003500244 6:6697119-6697141 GCTTCTGGAAGCAGCGCGAGGGG + Intergenic
1008582907 6:52922459-52922481 GCTGCCGGGAGCAAGGTGGCGGG - Intergenic
1019524575 7:1474971-1474993 GCTTCCATGAGCACCTCGGGAGG + Intronic
1020311554 7:6872430-6872452 GATACCGGGAGCAACGTGGCGGG + Intergenic
1035287394 7:157815063-157815085 TATTCTGGGAGCAGCGCGGGAGG + Intronic
1036391494 8:8328084-8328106 GCTTCCGGCAGCAGGGCTGGCGG - Exonic
1036773419 8:11593967-11593989 GGTTCCGGGAGACAGGCGGGAGG - Intergenic
1037739082 8:21590929-21590951 GCTGCCAGGAGCAAAGCTGGGGG + Intergenic
1040481473 8:47831490-47831512 GCTTCAGGGACCAATGCGGCGGG - Intronic