ID: 1077044762

View in Genome Browser
Species Human (GRCh38)
Location 11:539860-539882
Sequence CTGTGGAGAAGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 717}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077044748_1077044762 29 Left 1077044748 11:539808-539830 CCTCAGAGGCCTGGGGAGGGGCT 0: 1
1: 0
2: 10
3: 96
4: 575
Right 1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 92
4: 717
1077044747_1077044762 30 Left 1077044747 11:539807-539829 CCCTCAGAGGCCTGGGGAGGGGC 0: 1
1: 0
2: 6
3: 57
4: 516
Right 1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 92
4: 717
1077044750_1077044762 20 Left 1077044750 11:539817-539839 CCTGGGGAGGGGCTCAGGAAGAA 0: 1
1: 0
2: 3
3: 52
4: 474
Right 1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 92
4: 717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077044762 Original CRISPR CTGTGGAGAAGGAGGGAAGT GGG Intronic
900174699 1:1286547-1286569 CTTTCCAGAAGGAGGGAAGGTGG + Intronic
901147084 1:7072611-7072633 CTGTGGAGAAAAAAGAAAGTGGG + Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901813076 1:11778806-11778828 CTCTGGAGAAGGTGAGAGGTAGG + Exonic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902661462 1:17906918-17906940 CTGTGGAGGAGGAGGGAGCTGGG + Intergenic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
903135371 1:21306019-21306041 ATGTGGAGAAGGATGGATGCTGG - Intronic
903189564 1:21649199-21649221 CTTTGGAGGAGGAGGGAACGAGG - Intronic
903298885 1:22363880-22363902 CTGTGGACAAGGAGCCAACTGGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904543517 1:31250176-31250198 CTGTGGAGAAGGGAGGGAGCTGG - Intergenic
904727187 1:32558136-32558158 TGGGGGAAAAGGAGGGAAGTAGG + Intronic
904808788 1:33150102-33150124 CAGAGGAGAAGGAGGAAACTGGG + Intronic
904865357 1:33574666-33574688 CTGTTCAGAGGGAGAGAAGTTGG + Intronic
904879310 1:33682937-33682959 CTGGGGAAAAGGTGGGGAGTGGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905875676 1:41430872-41430894 CTGGGGAAAAGGTGGGCAGTGGG + Intergenic
906124801 1:43421201-43421223 CTGAGGAGAAGGACTGAAGGTGG - Exonic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
908015577 1:59830807-59830829 ATGTGAAGAAGCAGGAAAGTGGG - Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
908187435 1:61665949-61665971 CTGTGAAGAAGAAAAGAAGTTGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909559214 1:76990993-76991015 GGCTGTAGAAGGAGGGAAGTAGG + Intronic
910435529 1:87201879-87201901 CGGTGGATAAGGATGGAAATAGG + Intergenic
911113104 1:94212899-94212921 CTGTGAAGGAGGAGTAAAGTTGG - Intronic
911356853 1:96833278-96833300 AGGAGGAGAAGGAGGGGAGTAGG - Intergenic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
912149411 1:106839220-106839242 CTATGGAGTTGGAGGGAACTGGG - Intergenic
912209458 1:107542697-107542719 CTGCTGAGAAGCAAGGAAGTAGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
913374415 1:118134748-118134770 ATGTGTATAAGGAGGGAAATTGG - Intronic
913483540 1:119313103-119313125 CTGTGTACCAGGAAGGAAGTTGG + Intergenic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
914698472 1:150108009-150108031 CTTTGGAGCAGAAGTGAAGTTGG - Intronic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
915472767 1:156135834-156135856 GTATGGGGAAGGAGGGACGTGGG - Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
916371931 1:164108001-164108023 CTGACAAGAAGGAGAGAAGTAGG - Intergenic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
919640156 1:200038982-200039004 AGGGGGAGAAGGAGGTAAGTAGG - Intronic
919888880 1:201955594-201955616 CAAGGGAGAAGGAGGGCAGTGGG - Intronic
920034909 1:203059450-203059472 CTAGGGAGAAGGAGGCAAGGGGG + Intronic
920410070 1:205752247-205752269 CTATGGGGAAGGGGGAAAGTGGG - Intergenic
920547331 1:206829363-206829385 GTGGGGAGGAGGAGGGGAGTGGG + Intronic
920611407 1:207441512-207441534 AAGTGTAGAAGGAGGGAACTTGG - Intergenic
920681081 1:208073275-208073297 CTGTGTAGAAGGACTGAAGCAGG - Intronic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
922083182 1:222318209-222318231 ATGTGGAGAAGGAGGGCGGGCGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923724590 1:236495276-236495298 ATGGGGAGAAGGAGGGAACTGGG + Intergenic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
1063264743 10:4435385-4435407 CTGTGAAGAAGGCGTGAAGGAGG - Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065918226 10:30369504-30369526 CTTTGTAGAGGGAGGGATGTGGG - Intronic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066404695 10:35107465-35107487 CTGGGGAGAACTAGAGAAGTAGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067559991 10:47298485-47298507 ACATGGAGAAGGAGGGAAATGGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068067872 10:52154791-52154813 CAGGGGAGAAGGGTGGAAGTGGG - Intronic
1068584403 10:58780598-58780620 CTGTGGAATAGGAATGAAGTGGG + Intronic
1068807830 10:61219492-61219514 CTAAGGAGAGGGAGGGAAGGAGG - Intergenic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1072518253 10:96208032-96208054 GGGTGGAGAGGGATGGAAGTGGG + Intronic
1072591915 10:96833754-96833776 CTGTCGGGAAGGAGGGAATGAGG - Intronic
1073362948 10:102915008-102915030 GTGTGGAATAGGAGTGAAGTCGG - Intergenic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1074271618 10:111959234-111959256 CTTTGGAGAATGAAGGAAGAGGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074740102 10:116478293-116478315 CTGGGGAGAAGGAGGAAAGCAGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075715082 10:124551198-124551220 CTGCGCAGAAGGAGGGCAGCTGG + Intronic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076177323 10:128378033-128378055 CTGTGGAGCAGCAGGCACGTTGG + Intergenic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076293767 10:129368012-129368034 CTGTGCAGCTGGAGGCAAGTGGG - Intergenic
1076444504 10:130503250-130503272 AAGGGGAGAAGGAGGGAAGGGGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077964307 11:7111498-7111520 CTGTGAAGAGGGAGGGTCGTAGG - Intergenic
1078412824 11:11141695-11141717 CTGTGGAGCAGGAGGCAATAAGG - Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078522826 11:12077037-12077059 CTTTTGAGGAGGAGGGAACTGGG + Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079041377 11:17063483-17063505 CTGTTCTGAAGGAGGGGAGTTGG - Intergenic
1079146202 11:17854247-17854269 CTGTAGAGAAGTCGGGGAGTTGG - Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1080331319 11:31142903-31142925 CTGTGGGCAAGGAGGGTATTGGG + Intronic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081800983 11:45859177-45859199 CTGTTGAGCAGGATGGAAGTGGG - Intronic
1082852346 11:57776507-57776529 CTTTGGAGAAAGAGGGGTGTGGG + Intronic
1083253050 11:61480950-61480972 CTGTGGAGGAGGCCGGAGGTTGG + Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084085411 11:66852837-66852859 CTGGGGAGAAAGCGGGCAGTGGG + Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084325349 11:68396938-68396960 ATGTGAAGCAGAAGGGAAGTGGG - Intronic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084527965 11:69709090-69709112 CCATGGAGCAGGAGGGAAATGGG + Intergenic
1084692594 11:70735720-70735742 ATGTGCAGAGGGAGGGAAGTGGG + Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084857051 11:71996088-71996110 CTGTGGAGCAGCTGGAAAGTGGG + Intronic
1084892928 11:72245220-72245242 CTGCGGAGAGGGAGGGTCGTGGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1087173417 11:95074178-95074200 CTTTGGAGTAGCAAGGAAGTAGG + Intergenic
1087273954 11:96141653-96141675 GTGTGGAGAAGGAAGGCAATCGG - Intronic
1087612055 11:100446734-100446756 TTGGGCAGCAGGAGGGAAGTAGG - Intergenic
1088262730 11:107959622-107959644 CTGAGGAGAAACAGGGAAGCAGG + Intronic
1088810484 11:113388366-113388388 CTGGAGAGAAGGATGGAAGCAGG - Intronic
1089187075 11:116625389-116625411 TTAGGGAGAAGGAGGGAAGAAGG - Intergenic
1089303506 11:117512816-117512838 CCAGGGAGAGGGAGGGAAGTGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089519592 11:119055061-119055083 CTGAGGGGAAGGAAGGTAGTTGG + Intronic
1090340022 11:126009474-126009496 CTGTCTAGAAGGAGGAATGTGGG + Intronic
1090844867 11:130522224-130522246 CTGGGGAGTGGGAGGGCAGTGGG + Intergenic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091194580 11:133720126-133720148 CTGTGGAGCGGGAGGGTACTGGG + Intergenic
1091290031 11:134434330-134434352 CTCTGCAGGAGGAGGGAAGTAGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091635334 12:2192756-2192778 CTGTGGAGGAGGGGGAGAGTGGG - Intronic
1091682504 12:2537130-2537152 AAGTGGAGGAGGAGGGCAGTGGG - Intronic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1095369535 12:41450511-41450533 ATCTGAAGAAGGAGGGAAGGAGG + Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096103244 12:48981866-48981888 CCGCGGAGAGGGAGGGAGGTAGG - Intergenic
1096790404 12:54040973-54040995 ATGTGGAGAGTGAGGAAAGTCGG - Intronic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096972756 12:55681161-55681183 CTGTGGGGAATGGGGTAAGTTGG - Intergenic
1097070132 12:56348670-56348692 GTGTAGGGAAGGAGGGACGTGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097268281 12:57758435-57758457 CCCTGGAGAAGCAGGGAAGTGGG - Intronic
1097596349 12:61637018-61637040 CTGTGCAGCAGGTGGGAAATTGG + Intergenic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1098230227 12:68365517-68365539 CTGCGGAGGAGGAGGAAAGCTGG - Intergenic
1098575366 12:72035907-72035929 CTGTGGAAAGGGAGTGTAGTGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098968725 12:76825054-76825076 TTTGGGAGTAGGAGGGAAGTTGG + Intronic
1099584221 12:84495504-84495526 TTGAAGAGAAGGAGGGAGGTAGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1102933672 12:116880335-116880357 CACTCGAGAAGGAGCGAAGTTGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1104242727 12:127006264-127006286 CTTTTGAGAAGGAAGGATGTGGG - Intergenic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104782805 12:131432634-131432656 AAGAGGAGGAGGAGGGAAGTAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104934387 12:132356747-132356769 CTGTGCAGAAGAAGGGATGCTGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105208066 13:18239485-18239507 CTGTGGAGAAGGGGGGATTTCGG + Intergenic
1105353049 13:19633409-19633431 CTGGGGAGGAGGAGGGTCGTTGG - Intergenic
1105612859 13:21984415-21984437 TTCTGGAGAGGGAGGGAAGGAGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1110641307 13:77827912-77827934 CTGATGAGAAGAAGGGAAGTGGG + Intergenic
1111756449 13:92402100-92402122 TTGTTGAGTAGGAGTGAAGTTGG + Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112621127 13:101055316-101055338 CTGTGGAGAGCGACGAAAGTGGG - Exonic
1113007701 13:105725922-105725944 CCGTGAAGAAGGAAGGAAGTCGG - Intergenic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1114662174 14:24354074-24354096 CTGGGGAGAAGCAGGGATGGAGG + Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1117080936 14:52151173-52151195 CTCTGGGGAAGGAGCAAAGTTGG - Intergenic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1117830109 14:59741713-59741735 CAGGGGAGGAAGAGGGAAGTGGG - Intronic
1117858506 14:60062625-60062647 GACTGGAGAAGGAGGCAAGTAGG - Intronic
1118148199 14:63163501-63163523 CAGTGGAGGCGTAGGGAAGTGGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1119164871 14:72483945-72483967 ACTTGGAGAAGGTGGGAAGTAGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119681974 14:76599308-76599330 CTTTGGAGAAGGCTGGAAGCTGG + Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121353886 14:93196822-93196844 CTGGGAAGAGGGAGGGGAGTAGG - Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121571480 14:94949782-94949804 TTGGGGAGGAGGAGGGAAGTGGG + Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1122050986 14:99059658-99059680 CTGGGGATAAGGAGGGGAATAGG - Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122815478 14:104310059-104310081 CTGTAGAGAAGGCTGGACGTGGG + Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124480047 15:30070591-30070613 CTCTTGAGAAGGAAGGAGGTTGG + Intergenic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127337727 15:58006172-58006194 CTTTGGGGAAGGATGGGAGTGGG - Intronic
1127677648 15:61258088-61258110 TTGGGGAGAGGGATGGAAGTGGG + Intergenic
1127807375 15:62533759-62533781 CTTTGGCTAAGGAGAGAAGTTGG + Intronic
1128606841 15:69042858-69042880 CTGAGAAGAAGGAGGCAACTTGG - Intronic
1128671639 15:69578271-69578293 CTGGGGAGAAGGCGGGACTTTGG + Intergenic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1128841916 15:70857321-70857343 TTGTGGTGAAGCTGGGAAGTTGG + Intronic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129274713 15:74437347-74437369 CTGATGAGAACGAGGGGAGTGGG + Intergenic
1129682815 15:77667506-77667528 CCCTGGTGCAGGAGGGAAGTGGG + Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129783419 15:78290502-78290524 TCGTGGAGAAGTAAGGAAGTAGG - Intronic
1129949194 15:79571253-79571275 ATGTAGAGAGGGAGGGAAGGGGG - Intergenic
1130226042 15:82058985-82059007 AGGAGGAGAAGGAGGGAGGTAGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131413619 15:92232342-92232364 CTGTGGAAAAGGACAGAAGGAGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137475342 16:48803370-48803392 CTATGGAGGAAGAGGGAAGTGGG + Intergenic
1137801030 16:51262171-51262193 CGGGGGAGAAGGAGGGAAGGAGG - Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138432796 16:56980049-56980071 ATGTGGACAAAGCGGGAAGTGGG - Intronic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139489467 16:67278869-67278891 TTGTGGAGAAGGGGGTAAGGGGG + Exonic
1139516489 16:67455256-67455278 GTTTAGAGAAGAAGGGAAGTGGG + Intronic
1139536212 16:67575866-67575888 CTGTTGAGCAGTAGAGAAGTGGG + Intronic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1140880574 16:79194593-79194615 GGGTGGAGAAGGATGGAAGTGGG - Intronic
1141154557 16:81588108-81588130 CTGTGTGGAAGGAGGCAATTAGG + Intronic
1141246341 16:82311362-82311384 CTATGGAGAAAGATGAAAGTAGG - Intergenic
1141343817 16:83227453-83227475 CTGTGGAGCAGGTTGGAAGCTGG + Intronic
1142014947 16:87740427-87740449 CTCTGGAGCAGGAGGGGAGGCGG - Intronic
1142250012 16:88987037-88987059 CTGGGGAGAGGGAGGGACGGAGG - Intergenic
1142314255 16:89333519-89333541 CTGGGGAGAGGGAGGGACGGAGG - Intronic
1142323376 16:89399497-89399519 CTGGGGAGAGGGAGGGACGGAGG + Intronic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142787205 17:2233647-2233669 GGGTGGAGAAGGAGGGGGGTTGG - Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144421008 17:15098454-15098476 ATGCGGAGAATGAGGGAGGTGGG - Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1145869274 17:28260149-28260171 GTGTGGAGAAGGAGGAAACAGGG - Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147419310 17:40314274-40314296 TTGTTGAGCAGGAGGGAAATTGG - Intronic
1147687249 17:42293880-42293902 CTGGGGAGAAGGAACCAAGTGGG + Intronic
1148333517 17:46826204-46826226 CTGTGGAGAAGGTGGTTAGTTGG - Intronic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149575369 17:57708089-57708111 CTGTGGAGGAGGCGGGGAGCAGG - Intergenic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150568998 17:66369372-66369394 CTGGGGAGGAGGAGGGACCTGGG + Intronic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151339510 17:73461396-73461418 CTGTCGAAAAGGAGGGAATGAGG + Intronic
1151463951 17:74272658-74272680 ATATGGAGAAGTTGGGAAGTGGG + Intergenic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152703687 17:81832460-81832482 GTGTAGAGAGGGTGGGAAGTGGG - Intronic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156619537 18:38833032-38833054 CTGTGGTGAAGAAAGGAAATTGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158331176 18:56364495-56364517 CTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1160347888 18:78149855-78149877 CTGAGGAGAGGGAGGGAGATGGG + Intergenic
1160790023 19:918924-918946 CTCTGGAGCAGGAGGGGAGGAGG + Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161579453 19:5072837-5072859 CACTGGAAAAGGCGGGAAGTGGG - Intronic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162601695 19:11674565-11674587 CTGGTGAGAAAGAGGGAACTGGG - Intergenic
1162733644 19:12734051-12734073 CTGTGGAGAATGAGGAAACGTGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1164234910 19:23323413-23323435 ATGGGGAGAAGGAGGAAAGTAGG - Intronic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164250157 19:23468828-23468850 TTGAGGAGAAGGAGGAAAGTAGG - Intergenic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165407732 19:35641375-35641397 GTCTGGAGAAGGAGAGCAGTGGG + Intergenic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1168057756 19:53872960-53872982 CTCTTGAGAAGGAGGAAAATAGG + Intronic
925031617 2:654203-654225 CACTGGAGAAGGTGGGAGGTGGG + Intergenic
925372635 2:3358120-3358142 CTGCCGAGGAGGTGGGAAGTGGG - Intronic
925977606 2:9152009-9152031 AGGTGGAGAAGGAGGTAAATTGG - Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
927439114 2:23097843-23097865 ATTTGGAGAAGGAGAGAAATTGG - Intergenic
928098973 2:28423744-28423766 ATCAGGAGAAGGAGGGAAGGTGG - Intergenic
928355757 2:30613244-30613266 CTGGGGAGAAGGGGTGAAGGGGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928916841 2:36481251-36481273 GAGTGGAGAAGGAAGGCAGTTGG + Intronic
929814865 2:45222648-45222670 CAGGGGAGAAGGAGGGATGGGGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
933648478 2:84830837-84830859 CTGAGGAGAAAGAGGGCAGCTGG + Intronic
933656858 2:84895594-84895616 CTGGGGAGAAAGAGGAGAGTTGG + Intronic
933690135 2:85173297-85173319 GTGTGGAGGAGCAGGGGAGTGGG + Intronic
933803782 2:85983344-85983366 CTGTAAAGAAGGAGTGAAGCTGG - Intergenic
933846688 2:86332543-86332565 CTGGGGAGAATGAGGGAAGGGGG - Intronic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
935267338 2:101406276-101406298 GTGGAGAGAAGGAGGGAGGTAGG + Intronic
935312832 2:101802450-101802472 CTGTGTAGAAGGAGGAGAGGAGG - Intronic
935939419 2:108222578-108222600 CTGTGGAGAAAGATGTAAGGAGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939111030 2:138007743-138007765 TTTTGGAGAAGGAAGGAGGTAGG - Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941827604 2:169917305-169917327 GGGTGAAGAAGGAGGGAAGCAGG - Intronic
943153780 2:184148083-184148105 ATGGGGAGAAGGACGAAAGTGGG - Intergenic
943266368 2:185738262-185738284 TTGAGGAGAAAGAGGGAAATAGG + Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
944931529 2:204525248-204525270 CTGGGGATAAGTGGGGAAGTGGG + Intergenic
945024876 2:205610772-205610794 TTCTGAAGAAGGAAGGAAGTAGG - Intronic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947295819 2:228628839-228628861 ATGTGGAGAAGGAGGCAGATTGG + Intergenic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
948584734 2:239012297-239012319 CTGGGCAGCAGGAGGGGAGTCGG + Intergenic
1168943657 20:1733769-1733791 CTTAGCTGAAGGAGGGAAGTGGG - Intergenic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169763509 20:9123153-9123175 GTGAGGAGAAGGATGGAAATTGG + Intronic
1170056979 20:12216512-12216534 CTCTGGAGAAGGAGGCAGCTGGG - Intergenic
1170471087 20:16669030-16669052 CTGTGGCGAATTAGGGAAGGTGG + Intergenic
1170881964 20:20304737-20304759 GTGTGGAGAAGTGGGGAAATGGG + Intronic
1170967701 20:21090519-21090541 CTCTGGAGAAGGTGGGAATTAGG - Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1171849651 20:30299514-30299536 CTGTGGAGGAGCTGGGAGGTGGG - Intergenic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173111440 20:40194235-40194257 CTGGGGAGTAGGAGGGAAAGAGG + Intergenic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1174037450 20:47677023-47677045 CTGGGCAGAGGGAGGGAGGTGGG + Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174683797 20:52434194-52434216 CTGTGTAGAAAGAGAGCAGTTGG + Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1175025584 20:55899006-55899028 CTTAGGAGAGGGAGGGAAATGGG + Intergenic
1175175765 20:57110986-57111008 GTGTGGGGGAGCAGGGAAGTGGG - Intergenic
1175505798 20:59483307-59483329 CTGGGGAGAAAGTGGGAAGGGGG + Intergenic
1175619025 20:60427677-60427699 GTGAGGAGCAGGAGGGAAGGAGG - Intergenic
1178313681 21:31551776-31551798 ATGTGGAGAATGAAGGAAGTAGG + Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1179049930 21:37880459-37880481 CTCAAGTGAAGGAGGGAAGTGGG + Intronic
1180758628 22:18181374-18181396 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180768915 22:18365166-18365188 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180777397 22:18497229-18497251 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180810117 22:18754539-18754561 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180826790 22:18868390-18868412 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181196261 22:21188791-21188813 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1181213266 22:21304333-21304355 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1181477286 22:23176606-23176628 GTGTGGGGAATGAGGGATGTTGG - Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182722528 22:32414937-32414959 TGGGGGAGAAGCAGGGAAGTGGG + Intronic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183279034 22:36922434-36922456 ATGTGCAGGAGGAGGGAAGCGGG - Intronic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184938372 22:47741426-47741448 CTGGGCAGAAGGAGGAAAGCAGG - Intergenic
1185218570 22:49617359-49617381 GGGTAGAGAAGGAGGGAAGGAGG - Intronic
1185248978 22:49789687-49789709 CTGTGGAGAAGGTGGGCTGTAGG - Intronic
1203230537 22_KI270731v1_random:106050-106072 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1203276931 22_KI270734v1_random:94300-94322 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950326443 3:12114778-12114800 CTGTGGAGAAGGTGGGGAAGAGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950674783 3:14548160-14548182 CTGGGCAGAGGGTGGGAAGTGGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951855347 3:27190361-27190383 ATCTGGGGAAGGAAGGAAGTAGG + Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952198814 3:31103697-31103719 CTGTGTAGAATGAGGGAATGGGG + Intergenic
952240951 3:31531597-31531619 TAGCGGACAAGGAGGGAAGTGGG + Intergenic
952497249 3:33926639-33926661 CTATGGAAGAGGAGGGGAGTGGG - Intergenic
952556637 3:34538874-34538896 CTGAGGAGTAGGAGGAAAATGGG - Intergenic
952785150 3:37146462-37146484 CTGTGGAGAGGGAGCACAGTGGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
952902708 3:38120631-38120653 ATGTGGAGGAGGGTGGAAGTGGG + Intronic
952954809 3:38550345-38550367 GTCCGGAGAAGGGGGGAAGTCGG + Exonic
953273967 3:41476368-41476390 CTGTGGAGAAGAATAAAAGTAGG - Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
955967967 3:64408420-64408442 CTTTGTAGAAGGTGGGAAGTTGG + Intronic
956349660 3:68320848-68320870 CAGGGGAGAAGGAGGTAAGCAGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956699872 3:71949464-71949486 CTGGGGAGGAGGAGGTAAGGGGG - Intergenic
956848644 3:73207379-73207401 CTGTGGAGATGAAGGGATTTGGG + Intergenic
957955744 3:87184908-87184930 CTGAGGAGAAGAAGAGAAATAGG + Intergenic
958036044 3:88171596-88171618 ACCTGGAGAATGAGGGAAGTTGG - Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958584091 3:96062822-96062844 AGAAGGAGAAGGAGGGAAGTAGG - Intergenic
958958777 3:100489436-100489458 TGGTGGAGTAGGAGGCAAGTAGG - Intergenic
959027305 3:101254962-101254984 TGGTGGAGCAGGAGGGAGGTAGG - Intronic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959937348 3:112042969-112042991 CTGTGTAGAATGAGGAAAGGTGG + Intronic
960796808 3:121496138-121496160 TTGAGGAGAAGGACGGAAGATGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961382462 3:126504794-126504816 CTAAGGAGAGGAAGGGAAGTCGG - Intronic
961644437 3:128385110-128385132 CTCTGGAGGAGGAGGGAGCTGGG - Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
962477673 3:135770616-135770638 CTGTCCAGAAGGATGAAAGTAGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962928352 3:140015369-140015391 AGTAGGAGAAGGAGGGAAGTAGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963237499 3:142970271-142970293 GTGCGGAGAGGGAGGGAGGTTGG - Intronic
963286585 3:143439695-143439717 CTCTGGAGAATGAGGGGAGTTGG - Intronic
963286678 3:143440388-143440410 CTCTGGAGAATGAGGAGAGTCGG + Intronic
963353923 3:144186459-144186481 CTGAGAAGAAGGTGGGAAGTGGG - Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963843476 3:150131296-150131318 ATGAGGAGAAACAGGGAAGTAGG + Intergenic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
965762135 3:172090518-172090540 CTCTGGAGAAGCAGGAAACTTGG - Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966925883 3:184644341-184644363 TTCTGGAGAAGGAGGGGACTGGG - Intronic
967825934 3:193877353-193877375 CTGGGGAGAAGGTGGGCAGGAGG + Intergenic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969354855 4:6619455-6619477 CTGTGGAGCAGGAGGGCTGGGGG - Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
970210578 4:13705934-13705956 CTCTGGAGAAAGAGCGAAGCAGG - Intergenic
970599910 4:17633625-17633647 CTGTAGATAAGAGGGGAAGTAGG - Exonic
970689830 4:18610319-18610341 ATGCAGAGAAGGAGGGAAGTGGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
973207068 4:47572602-47572624 GAGAGGAGAAGGAAGGAAGTGGG + Intronic
974106888 4:57479935-57479957 CAGTGGAGAAGGTGGGAACGGGG - Intergenic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975495084 4:75028328-75028350 ATGTGCTGGAGGAGGGAAGTGGG - Intronic
975955346 4:79830606-79830628 GGGTGGAGAAGGAAGGAAGTAGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977226194 4:94394644-94394666 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978421288 4:108535869-108535891 GGGTGGAGAAGGAAGGAAGTTGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980062475 4:128146626-128146648 CTGGAGAGAAGGAGGGGAATGGG + Intronic
980114450 4:128665782-128665804 CTTGGGAGAATGAGGGAGGTTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981449218 4:144876570-144876592 CTAGGGAGAAGGAGGGATGGAGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
983429672 4:167632664-167632686 CTGTGGAGAAATAGGAATGTTGG + Intergenic
983562842 4:169118173-169118195 ATGTGGAGCTGGAGGCAAGTAGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
984422090 4:179536585-179536607 CTGTGGAGAAATAAGGAATTTGG + Intergenic
985277396 4:188251216-188251238 CTATGGAGAGGAAGGGAAATGGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
987029598 5:13963723-13963745 CTGTGGAGGAGGGGGGTAGTGGG - Intergenic
987032299 5:13987155-13987177 GTGTGGAGAAGCAGGGGAGGAGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989622411 5:43397473-43397495 CTGTGGACCAGGAGGGTACTTGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991003345 5:61804729-61804751 ATGAGAAGAAGGAGGGAAATGGG - Intergenic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991936238 5:71803628-71803650 CCAAGGAGAAGGAGAGAAGTAGG + Intergenic
992108200 5:73467969-73467991 CTGTGGAGGAGGACTGAACTGGG + Intergenic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994941577 5:106330268-106330290 CTGTGGAGCAGAGGGGAAGGAGG - Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995797541 5:115957742-115957764 CTGTGAAGTAGGAGGCAAGGGGG + Intergenic
996078290 5:119224080-119224102 TTGTGGAGAAGGTGGGGAGTTGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996345965 5:122488917-122488939 CTGTGGAGTATAGGGGAAGTGGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997260893 5:132464863-132464885 ATGCGGGGAAGGAGGGCAGTCGG + Exonic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998350059 5:141494708-141494730 CGGGAGAGAAGGAGGGGAGTGGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998523899 5:142825301-142825323 TTGTGGAGGAAGAGGGTAGTTGG + Intronic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999357286 5:150947162-150947184 GAGGGGAGAAAGAGGGAAGTGGG + Intergenic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000404011 5:160866732-160866754 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001155848 5:169271960-169271982 CTGGGGAAAAGCAGGCAAGTGGG + Intronic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002213612 5:177612501-177612523 CTGTGCAGAAGTGGGGAGGTGGG + Intergenic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1003173189 6:3736226-3736248 CAGGGGAGAAGGAGGGATGGAGG - Intronic
1003484870 6:6566970-6566992 CTGTGGCAAAGGAAAGAAGTCGG - Intergenic
1003627279 6:7753513-7753535 CTGTGCAGAAGGAGGGCTGTGGG - Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004243847 6:13953422-13953444 CTATAGAGCAGGAGGTAAGTAGG + Intronic
1004744834 6:18499441-18499463 CTGAGAAGGAGGAGGGAAGGTGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005650285 6:27879312-27879334 CTTGGGACAAGGAGGGAAGGTGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006420585 6:33931402-33931424 GTGGGGAGAAGCAGGGAAGGAGG + Intergenic
1006779622 6:36623491-36623513 CTCTGCAGGAGGAGGGGAGTTGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006881273 6:37342049-37342071 GTGGGGAGAAGTAGGGAGGTGGG - Intergenic
1007013588 6:38441006-38441028 CTGTGGAGAAGTGGAGAAGCTGG + Intronic
1007272597 6:40649818-40649840 CTGTGGAGTTAGAGGAAAGTAGG - Intergenic
1007336571 6:41159013-41159035 AGGAGGAGAAGGATGGAAGTGGG + Exonic
1007496120 6:42261146-42261168 CTGAGGAGAATGGGGGAAGGAGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008527259 6:52419578-52419600 CTCTACGGAAGGAGGGAAGTAGG + Intergenic
1009345864 6:62612341-62612363 CTCTGGAGAAACAGGGAATTTGG + Intergenic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012269581 6:97192137-97192159 ATGTGGAGGAGGGGGTAAGTAGG + Intronic
1012449386 6:99339065-99339087 CTGTAGAGAAGAGGGGAAGGGGG - Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013356609 6:109350900-109350922 CAGTGGAGAAGCAGGTAAGCTGG - Intergenic
1013365265 6:109432864-109432886 CTGAGGAGAATGAAGCAAGTTGG - Intronic
1013480688 6:110550421-110550443 CTGAGGAGAAGGTGGCATGTGGG - Intergenic
1013504413 6:110785582-110785604 CTGAGAAGAAAGAGGGGAGTTGG + Intronic
1013797910 6:113906489-113906511 CTGTCTAGAAGGAGGCAGGTGGG + Intergenic
1014384598 6:120785617-120785639 CTGTGGAGCAGGCGGGACCTGGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015201141 6:130582745-130582767 CTGAGGAGCAGGAGGGAGCTAGG + Intergenic
1015225525 6:130852893-130852915 CTGTGAAGAAGGAGTAAAGGGGG - Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015968097 6:138715287-138715309 TTGTGAAGAAAGAGGGAAGGGGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016414208 6:143816017-143816039 CTGTTGAGAGGGAGGGAATGGGG - Intronic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1017722146 6:157251154-157251176 CAGTGCAGAAGGAAGTAAGTTGG - Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018672829 6:166193797-166193819 CCATGGAGACGGAGGAAAGTGGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018826577 6:167412283-167412305 CAGGGAAGAAGGATGGAAGTAGG - Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1019612613 7:1944656-1944678 CTGTGGAGGAGGAGGGTCTTGGG - Intronic
1021376569 7:19915143-19915165 CTGAGGAGCAGGAGAGAAATGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021907296 7:25347695-25347717 CTGTGAGGTAGGAGGGAATTGGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024153817 7:46600072-46600094 CTGTGAACCAGGAAGGAAGTAGG + Intergenic
1024660441 7:51487859-51487881 CTATGAATAATGAGGGAAGTTGG + Intergenic
1024983873 7:55179533-55179555 CTGGGGAGAAGGTGGGCAGGAGG + Intronic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1027230884 7:76271713-76271735 CTGTGGAGAGGGTGGAAAATGGG + Intronic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030204575 7:106940412-106940434 CTGTGGTGCAGAAAGGAAGTTGG - Intergenic
1030248158 7:107408854-107408876 CTGTGGAGAATTGGGCAAGTTGG - Intronic
1030681503 7:112439185-112439207 CTGTGGAGGCGGAATGAAGTGGG + Intronic
1031127042 7:117786579-117786601 CTGTGGAACAGGAGGGAATGGGG + Intronic
1031965459 7:128025008-128025030 CTAAGGGGAAGGAGTGAAGTAGG - Intronic
1032441703 7:131947268-131947290 CTCTGGAGAAGGAAAGAAGGAGG + Intergenic
1033078766 7:138274424-138274446 TTGGGGAGAAGGATGGGAGTGGG + Intergenic
1033432786 7:141304423-141304445 CTGGGCAGAAGGTGGGAAGAGGG - Intronic
1033824464 7:145172451-145172473 CTTTGGAAAAGCAGGTAAGTAGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034238538 7:149591854-149591876 CTCTAGAGAAGGAGTGAAGCTGG + Intergenic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035482144 7:159195777-159195799 CTGGGGAGAGGGAGGGATGGGGG + Intergenic
1036175281 8:6531839-6531861 TTATGGAGAAGGAGACAAGTGGG - Intronic
1036478188 8:9113395-9113417 CTGAGGAGAGGGAGGGAGATTGG + Intronic
1036510478 8:9395287-9395309 GTGTGAAGAAGGAGGTAAGGGGG - Intergenic
1036544816 8:9757482-9757504 GTCAGGGGAAGGAGGGAAGTGGG - Intronic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038385937 8:27145244-27145266 CTGTTGTGAAAGAAGGAAGTAGG - Intergenic
1038693940 8:29788399-29788421 CTGTGGAGAAGGAGGCGCCTAGG - Intergenic
1039435688 8:37557733-37557755 GTGTAGAGAAGGCGGGAAGTGGG - Intergenic
1039603851 8:38864970-38864992 CTGTTGAGAAATGGGGAAGTTGG + Intergenic
1039893070 8:41697458-41697480 CTGTGGAGGAGGTGAGATGTGGG - Intronic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1041442895 8:57917435-57917457 CTGTTGAGAAGGAGGTAAAGTGG - Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1042205603 8:66327073-66327095 GTGTGGAGAAGGAGGAAATAGGG - Intergenic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1044430157 8:92098978-92099000 CTGTGGAAAAAAAGTGAAGTTGG + Intronic
1044451387 8:92339460-92339482 ATGTGGGGAAGGATGGGAGTGGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044861332 8:96526593-96526615 CTGTTGAGGAGGAAGGAATTGGG + Intronic
1044892935 8:96856308-96856330 CTGTGGAGACAGTGGGCAGTGGG + Intronic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046428363 8:114086237-114086259 TTATGGAGTAGGAGAGAAGTGGG - Intergenic
1046646266 8:116789033-116789055 AGGTGGAGAAGGAGGAAATTGGG + Intronic
1046797358 8:118387457-118387479 ATGAGGAGGAGGAGGGGAGTAGG - Intronic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1046997789 8:120543591-120543613 CTCAGGACAAGGAGGGATGTGGG + Intronic
1047259198 8:123241076-123241098 CCGTGGAGGAGGAGGGACGGCGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048252454 8:132878034-132878056 CTGTGTAGAATGAGTGATGTGGG - Intronic
1048294969 8:133207285-133207307 CAGGGGAGAAGCAGGGCAGTGGG + Intronic
1048359680 8:133687206-133687228 AGGAGGAGAAGGAGGGAAGATGG - Intergenic
1048774616 8:137932088-137932110 ATGTGGAGAAGGCGGGGGGTTGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049496397 8:142936183-142936205 TTTTGGAGAAGGAGGGTTGTGGG + Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1050874574 9:10617956-10617978 AGGTGGAGAACCAGGGAAGTTGG - Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051123319 9:13775559-13775581 CCGTGTAGAATGAGGGATGTGGG + Intergenic
1051243725 9:15087086-15087108 CTGTGGAGACTTAGGGAACTTGG - Intergenic
1051345704 9:16148982-16149004 TTGGGGAATAGGAGGGAAGTGGG - Intergenic
1051437690 9:17050579-17050601 CTCTGGAGAAGGAGGAAAATAGG - Intergenic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052001518 9:23288013-23288035 TTGTGGAGCAGGAAAGAAGTTGG - Intergenic
1055584898 9:77748536-77748558 CTGTGGAGGATGACAGAAGTAGG + Intronic
1055677784 9:78682837-78682859 AGGGGGAGAAGGAGGGAAGGGGG - Intergenic
1055734620 9:79313566-79313588 CTGAGGAGAGAGGGGGAAGTTGG - Intergenic
1056232305 9:84559147-84559169 CAGTGAAGAAGGAAGGAATTAGG + Intergenic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1056723233 9:89089412-89089434 GGGTGGAGCAGGAGGGAACTGGG + Intronic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057491216 9:95521353-95521375 CTGAGGAGTAGGAAGGCAGTTGG + Intergenic
1057537476 9:95926902-95926924 GTGTGGAGGAGGTTGGAAGTAGG + Intronic
1057786460 9:98091853-98091875 CGGTGGAGATGGTGGGATGTTGG - Intronic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060304934 9:122402843-122402865 GTGTGGAGGAGGAGGAAATTAGG - Intergenic
1060656166 9:125374188-125374210 CTCTGGAGAGGGAGGGATGGGGG - Intergenic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061873144 9:133531264-133531286 CTGGGGAGAAGAGGGGAAGCAGG + Intergenic
1061990846 9:134157735-134157757 CTGTGTCGAAGGTGGGCAGTGGG + Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062243304 9:135551103-135551125 ATGTGGAGAAGCTGGGAAGTCGG + Intergenic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062441283 9:136570871-136570893 CTGTGGAGAGGCTGGGGAGTGGG - Intergenic
1062719027 9:138025228-138025250 CTGTGGAGCAGGAGGGAATGGGG - Intronic
1185934009 X:4235286-4235308 TTGGGGAGAAGGATGGAAGCGGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188278422 X:28231742-28231764 CTATGGTGAAGAAGGGAAATTGG - Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188816999 X:34727898-34727920 CTGAGGAGAAGGCAGGCAGTGGG + Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1189732546 X:44036666-44036688 CTGTGGACAAGGTTAGAAGTAGG - Intergenic
1190260018 X:48791721-48791743 CTGTGGAAAAGCTGGGAACTTGG + Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192090120 X:68145643-68145665 CTCTGGAGAGGGAAGGATGTGGG - Intronic
1192961461 X:76135735-76135757 GGGTGGAGAAGGTGGGAACTGGG - Intergenic
1193037895 X:76973290-76973312 CTGTTGAGATGGATGGAGGTTGG - Intergenic
1193704801 X:84808527-84808549 CTGTGAAGAGGAAGGGAACTAGG + Intergenic
1194146246 X:90268628-90268650 CTGTGGAGAAGAGGGGCAGGAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195129569 X:101839759-101839781 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195176670 X:102320070-102320092 AGGTGGAGAAGGAGGGAAGGTGG - Intronic
1195182194 X:102367023-102367045 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195254915 X:103081540-103081562 AGGTGGAGAAGGAGGGAAGGAGG + Intronic
1195283167 X:103356933-103356955 CTGTGGAGAGGGGGTGAACTAGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1197209828 X:123819479-123819501 TTGTAGAGAAAGAGGGAAGGGGG + Intergenic
1197329895 X:125140939-125140961 CTCTAGAGAAGAAGGGAAGGAGG - Intergenic
1197724796 X:129769050-129769072 CTGTGGAGTAAGAGGGAATGCGG + Exonic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1200077248 X:153557259-153557281 CTGTGGAGAGGAAGGGGAATGGG + Intronic
1200491988 Y:3837899-3837921 CTGTGGAGAAGAGGGGCAGGAGG - Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic