ID: 1077044940

View in Genome Browser
Species Human (GRCh38)
Location 11:540558-540580
Sequence TGCCAAGGGCTTGCTGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077044921_1077044940 30 Left 1077044921 11:540505-540527 CCATGAGGCCCAGCCAAGCTAGG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG 0: 1
1: 0
2: 2
3: 12
4: 142
1077044923_1077044940 22 Left 1077044923 11:540513-540535 CCCAGCCAAGCTAGGAGCCTTCT 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG 0: 1
1: 0
2: 2
3: 12
4: 142
1077044924_1077044940 21 Left 1077044924 11:540514-540536 CCAGCCAAGCTAGGAGCCTTCTC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG 0: 1
1: 0
2: 2
3: 12
4: 142
1077044925_1077044940 17 Left 1077044925 11:540518-540540 CCAAGCTAGGAGCCTTCTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG 0: 1
1: 0
2: 2
3: 12
4: 142
1077044932_1077044940 5 Left 1077044932 11:540530-540552 CCTTCTCTAGGCTCGGGGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG 0: 1
1: 0
2: 2
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077044940 Original CRISPR TGCCAAGGGCTTGCTGTGAC GGG Intronic
900392771 1:2440954-2440976 TGCCAAGATCTGGCTGTGCCCGG + Intronic
901822343 1:11838160-11838182 GGCCAAGGACTTGGTTTGACTGG + Intronic
903499479 1:23793486-23793508 AGCCCAGCGCTTGGTGTGACGGG - Intronic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
907807926 1:57840113-57840135 TGCCATGGGCTTTCTCTGATAGG + Intronic
916759644 1:167804848-167804870 TGGCAAGGGCGTGGAGTGACGGG - Intergenic
917073718 1:171181243-171181265 TGCCAAGGGCTGGGAGTGAGGGG + Intergenic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
924907728 1:248474060-248474082 GGCCAAGGCCTTCCTGTGGCCGG - Exonic
1062931687 10:1357019-1357041 TACAAAGGGCTTGCTGTGAGTGG - Intronic
1064370660 10:14749608-14749630 TGCGAAGGCCTCGCTGTGGCTGG - Intronic
1064748789 10:18504357-18504379 TGTCCTGGGCTTGCTGTGCCAGG - Intronic
1068996544 10:63212153-63212175 TGCCAAGGGCTGGCAGGGAAGGG + Intronic
1070426993 10:76298453-76298475 TGCAAAGGGCCTTCTGTGTCAGG + Intronic
1070700026 10:78595192-78595214 TGCCAAGGGCTTGCCATACCAGG - Intergenic
1070789964 10:79183124-79183146 GGCCAAGGGTTAGCTCTGACAGG - Intronic
1071463117 10:85917182-85917204 TGCCAAGTGCTTGCTGAGCCTGG + Intronic
1072761074 10:98057354-98057376 TGCCAAGACCTTGCTGTTACTGG + Intergenic
1075062876 10:119268999-119269021 TCCCATGGGCTTCCTGTCACAGG + Intronic
1075580399 10:123613430-123613452 TGACAAGGGCCTGCTATGTCTGG - Intergenic
1076109886 10:127852132-127852154 TGCCAAGGGAATGCTGTGACGGG + Intergenic
1076481869 10:130789950-130789972 AGCCCAGGGCCTGGTGTGACAGG + Intergenic
1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG + Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078567383 11:12428114-12428136 TGCCATGTGCTTTCTGTGAGGGG + Intronic
1078859831 11:15236668-15236690 TGGTGAGGGCTTCCTGTGACTGG + Intronic
1080877882 11:36293062-36293084 TGCCTAGGGCTGGGTGTGATGGG - Intergenic
1084534921 11:69750983-69751005 AGGCAAGGGCTTGCTGTCATGGG + Intergenic
1084649140 11:70478371-70478393 TGTCAAGGGCCTGCTGGGCCTGG + Intronic
1089027900 11:115290893-115290915 GGCTAAGGGCTTGCATTGACTGG + Intronic
1089995610 11:122904191-122904213 TGAAAACGGCTTGCTGCGACGGG - Exonic
1090057901 11:123439072-123439094 TGCCAAGGGGCTGTTGTGCCTGG + Intergenic
1090482151 11:127078253-127078275 GGCCATGGGCTTGGTGTCACGGG + Intergenic
1091405797 12:208678-208700 TGCCAAGGGCTGGCAGGGAGAGG + Intronic
1095358218 12:41303236-41303258 TGCCGAGGGCATGGTCTGACTGG - Intronic
1096541379 12:52309189-52309211 TGCCAGGGCCTTCCTGTGATAGG + Intergenic
1097155953 12:57012519-57012541 AGCAAAGGGCTGGCTATGACGGG + Intronic
1104773341 12:131378537-131378559 TGGCAAGGGCTTCCTGGGAAGGG - Intergenic
1106210726 13:27641968-27641990 TGGCAAGGCCTTGCAGAGACAGG + Intronic
1107349874 13:39502589-39502611 AGACAAGGTCTTGCTCTGACTGG - Intronic
1107687894 13:42922466-42922488 TGCCAAGGGTTTGCGGGGACAGG + Intronic
1108844193 13:54658831-54658853 TGCCAAGGGCGTGGAGTGGCAGG + Intergenic
1110219874 13:73060541-73060563 TGCCAGGGTCTTGCTGTGAGAGG + Intronic
1115221879 14:31066129-31066151 TGACAAGGGATGGCTGTAACTGG - Exonic
1117987930 14:61406923-61406945 TGTCAGGGGTTTGCTGTGATTGG + Intronic
1119671827 14:76525796-76525818 TGTCAAGGCCTTGCTCTGCCTGG - Intergenic
1120102311 14:80459418-80459440 TGCAAAGAGTTTGCTGTTACAGG + Intergenic
1121307686 14:92917299-92917321 TGTCCAGGGCTTGGTGTGCCTGG + Intergenic
1125399649 15:39287420-39287442 TGCCCAGGGCTACCTGTTACTGG - Intergenic
1125511185 15:40293261-40293283 TGTCAAGGGCTATCTGTGCCAGG - Intronic
1127784014 15:62340276-62340298 TGCCAAGGGCTGGCTATGGATGG - Intergenic
1129269735 15:74413233-74413255 TGCCAAGGGTATGCTGTTACTGG - Intronic
1132061625 15:98697115-98697137 AGGCAGGGGCTTGCTGGGACAGG + Intronic
1132318296 15:100906372-100906394 TGCCAAGGGCTTTCTGGGGCAGG + Intronic
1137798663 16:51242759-51242781 TGCCAAGAGCAGGCTGTGCCAGG - Intergenic
1138596059 16:58029571-58029593 TGGCAAGGGCTGGGTGTGAAGGG - Intronic
1139613772 16:68076750-68076772 AGCCATGGGAGTGCTGTGACTGG - Intronic
1139713094 16:68791346-68791368 TTCCAAGGGCTTTATGTGACAGG - Intronic
1141389942 16:83656093-83656115 TGCCAGGGGCTGGGTGTGAGGGG - Intronic
1141543097 16:84741990-84742012 TGCAAAGGGCTTGCTGCAGCTGG - Intronic
1142245646 16:88968999-88969021 TGCTGAGGGCTTGCTCTGGCTGG - Intronic
1142573835 17:893321-893343 TGCCTAGGGTTTCCTGAGACTGG - Intronic
1142637327 17:1266089-1266111 TGCTAAGGGCTTTCTGTGCATGG + Intergenic
1142766680 17:2068253-2068275 AGCCAAGGGCTTGCTCTGGAGGG + Intronic
1143623661 17:8095824-8095846 TGCCAGGGGATTGCAGTGAGGGG - Intergenic
1144136073 17:12296284-12296306 TGACAAGGGCTTGCAGTGGTGGG - Intergenic
1147460695 17:40566214-40566236 TGCCAGGGGCTTTCGATGACAGG - Intergenic
1147515758 17:41116096-41116118 TGAAAAGAGCTTGCTGTGAAAGG - Intergenic
1151330085 17:73401504-73401526 TGCCAAGAGCCTCCTGTGAGTGG + Intronic
1151993265 17:77592065-77592087 TGGCACGGGGTTTCTGTGACCGG + Intergenic
1152878221 17:82800496-82800518 GGCCACGGGCATGCTGTGGCCGG - Intronic
1155498714 18:26466270-26466292 GGCCCTGGGCTTGCTGAGACTGG + Intronic
1158274888 18:55756596-55756618 TGCCACGGGCTTGCTCTGTGAGG + Intergenic
1158885580 18:61823887-61823909 AGCCAAGGGCATCCTGTGCCAGG + Intronic
1159689857 18:71473014-71473036 TGAGAATTGCTTGCTGTGACTGG + Intergenic
1161289559 19:3485810-3485832 AGCCAAGGTCATGCTGTGACGGG - Intergenic
1161350652 19:3789553-3789575 TGTCAAGGGCTGGCTGGGGCAGG + Intronic
1161819775 19:6522660-6522682 GGCCAAGGTCTCACTGTGACTGG - Intergenic
1163513341 19:17748598-17748620 TGCCAGAGGCTGGCTGTGAGTGG + Intronic
1164044323 19:21522610-21522632 TGCAAAGTGCATGCTGTCACTGG + Intronic
1165130351 19:33628199-33628221 TGCAAAGGGCTTCCTGTGGAGGG + Intronic
1167242871 19:48355559-48355581 TGCTGAGCGCTTGCTGTGTCTGG - Intronic
928905282 2:36361158-36361180 TGCCAAGTGTTTTATGTGACAGG - Intronic
931903717 2:66820516-66820538 TGCCAATGGCCTGCTCTTACTGG + Intergenic
932814934 2:74853911-74853933 GGCAATGGGATTGCTGTGACTGG + Intronic
934949297 2:98565542-98565564 AGCCCAGGCCTGGCTGTGACAGG - Intronic
937316058 2:120932823-120932845 TCCCAAGGACATGCTGTGGCCGG - Intronic
937966346 2:127514528-127514550 TGCCAAGGGCTTGGTGAGCAGGG - Intronic
944057232 2:195535584-195535606 TGCCTAGAGCTTTCTGTGATAGG - Intergenic
944430757 2:199630782-199630804 TGCCAAGGGTTGCCTGTGAGTGG + Intergenic
946308700 2:218871209-218871231 TCCAAAGGCCTTGCTGTGGCTGG - Exonic
946368732 2:219267118-219267140 TGTCAAGAGCTGGCTGTGCCTGG + Intronic
947262133 2:228235061-228235083 TGCCCATGCCTAGCTGTGACAGG - Intergenic
948046017 2:234945987-234946009 AGCAAAGGGCTTTCTGTGTCTGG - Intergenic
948123018 2:235544708-235544730 GGCGAAGGGCTTCCTGTGAGAGG - Intronic
948525493 2:238568445-238568467 TGCCTAGGGGGTGCTGTGCCTGG + Intergenic
948931924 2:241137482-241137504 TGCCCTGGGGTTGCTGTGCCTGG - Intronic
1171092719 20:22301131-22301153 TGCCCAGCGCTTACTGTGCCAGG - Intergenic
1173135505 20:40435328-40435350 TCCCTAGGGCTTGCTGTGTGGGG - Intergenic
1174174828 20:48637857-48637879 TGCCAGGGCTTTGCTGTGAAGGG - Intronic
1180137870 21:45872727-45872749 TGGCAAGGGCTGTCTGTGCCTGG + Intronic
1181391863 22:22588780-22588802 TGCCAGGGGCTTCCTGCAACAGG + Intergenic
1182860234 22:33553575-33553597 TGTCAAGAGCTTACTGTGTCAGG + Intronic
1183694722 22:39415281-39415303 TGCCAAGGGCCTGCTCTGATGGG + Intronic
953932551 3:47012927-47012949 TGACAAGGGCTGGCGGGGACTGG + Intergenic
955326963 3:58015998-58016020 TACCAAGGGCTTTCTGAAACTGG + Intronic
955392538 3:58531835-58531857 TGCACAGGTCTTCCTGTGACGGG - Intronic
956728935 3:72178744-72178766 TGCAAAGAGCTGGCTGTGAAAGG - Intergenic
961095950 3:124156849-124156871 TGGCAAAGGCTTGTAGTGACTGG - Intronic
968457274 4:706092-706114 TGCCAAGGGCTTCCCGGGCCAGG - Intronic
969582774 4:8075275-8075297 TGCCGAGGGCTTGCGGGTACGGG + Intronic
969675072 4:8610108-8610130 TCCCAAGGGCTTCCTGGGGCAGG + Intronic
971267885 4:25110937-25110959 TGCCCAGGGCCTGCTGTGGCAGG + Intergenic
974138549 4:57851515-57851537 TACCAAGGGCTTGATGGGAATGG + Intergenic
974824076 4:67104348-67104370 TGCCACAGGCTTGCTGTGCAGGG + Intergenic
976486963 4:85618148-85618170 TGCCAGGGGCTGGGTGAGACAGG - Intronic
980310189 4:131117956-131117978 TGCCAATGGATTGCTTTGAATGG - Intergenic
988002237 5:25363224-25363246 TGGGCAGGGCTTGCTGTGGCTGG - Intergenic
996299069 5:121960283-121960305 TGCCAAGGCCTTGTTGTCTCAGG + Intergenic
997059818 5:130487957-130487979 TGCCAGGTCTTTGCTGTGACAGG - Intergenic
1000138153 5:158374056-158374078 TGCCAAGGAGTTGCAGTGAATGG + Intergenic
1001758446 5:174188319-174188341 TGCCAAGGACTTGCTGAGTTTGG - Intronic
1001991322 5:176117926-176117948 GGCCAGGGGCTTTCTGTGTCAGG + Intronic
1002225553 5:177720210-177720232 GGCCAGGGGCTTTCTGTGTCAGG - Intronic
1002268296 5:178050995-178051017 GGCCAGGGGCTTTCTGTGTCAGG + Intronic
1003877357 6:10450613-10450635 TGCCATGGGGTTGCTGACACTGG - Intergenic
1005430476 6:25751500-25751522 AGCCAAGTGCTTGCTCTTACAGG - Intergenic
1005809709 6:29506449-29506471 TGCCATGGGCTGTTTGTGACGGG + Intergenic
1005988439 6:30888998-30889020 TGCCAAGTACCTGCTGTGGCGGG - Exonic
1007754280 6:44088851-44088873 CTCCAGGGCCTTGCTGTGACTGG - Intergenic
1019687377 7:2389143-2389165 TGGCATGGGCTTTCTGTGAAAGG - Intergenic
1020005202 7:4780117-4780139 CGCAAAGGGGTTGCTGTGCCAGG - Intronic
1023172085 7:37399419-37399441 TGCCCAGGGCTTCCTGAGAGTGG - Intronic
1024100047 7:46022580-46022602 GGCCATGGGCTGGTTGTGACTGG + Intergenic
1026568021 7:71505755-71505777 TGCCAAGGGCTTGTGTTGAAGGG - Intronic
1026638427 7:72104303-72104325 TGCCTAGGGCTTGCAGGGACAGG + Intronic
1026882247 7:73914812-73914834 TTCCATGGGCTTGCTCTGCCAGG + Intergenic
1032319014 7:130867928-130867950 TGCCAGAGGCTTGGTGTGGCAGG - Intergenic
1039462710 8:37759473-37759495 TGCCAAGGGCTTGCTGTCATGGG + Intergenic
1043575899 8:81655972-81655994 TTCCAAGTGCTTCCTGTGAAAGG - Intergenic
1044931756 8:97258662-97258684 TGCAAAGTGCTTGCTATGAGTGG + Intergenic
1049412637 8:142480110-142480132 TGCCCGGGGCTTGCGGGGACAGG + Intronic
1051215929 9:14797365-14797387 TGGCAGGGGCAAGCTGTGACAGG + Intronic
1054721402 9:68607709-68607731 TGCCAAGAGCTTGGGGTGAAAGG + Intergenic
1057252715 9:93516600-93516622 CGGCAGGGGGTTGCTGTGACGGG - Intronic
1058651856 9:107182170-107182192 TGCCCAGGGCCTGCTGCTACTGG + Intergenic
1060815369 9:126632423-126632445 TGCCGAGGGGCTGCTGGGACTGG + Intronic
1061812816 9:133172285-133172307 TGGCAGTGGCTTGCTGTGTCTGG - Intergenic
1062373290 9:136251295-136251317 TGCTCAGGACTTGCTGTGCCTGG - Intergenic
1062541574 9:137043967-137043989 CTCCACTGGCTTGCTGTGACTGG - Intronic
1186472585 X:9832957-9832979 TGCAAAGGTTTTCCTGTGACTGG + Intronic
1187067655 X:15855632-15855654 TGCCGACGACTTGCTGTGCCTGG + Intergenic
1190380558 X:49836678-49836700 TGCCAAGGGGCTGCTGGCACTGG - Intergenic
1190385181 X:49878237-49878259 TGCCAAGGGGCTGCTGGCACTGG - Intergenic
1192181235 X:68917059-68917081 TGCCAGAGGATTGCTGTCACAGG - Intergenic
1192193018 X:69005756-69005778 TGCCAAGGGCTTGCAGGAAGAGG - Intergenic
1199187478 X:144932764-144932786 TGTCCTGGGCTTGCTGTTACTGG + Intergenic