ID: 1077049144

View in Genome Browser
Species Human (GRCh38)
Location 11:558940-558962
Sequence GGTCACCTGGGACCTCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077049144_1077049150 2 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049150 11:558965-558987 TGACCGACTCTTGCTCTGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1077049144_1077049148 0 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049148 11:558963-558985 ACTGACCGACTCTTGCTCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1077049144_1077049154 24 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049154 11:558987-559009 GGACAGGAGAGCCTCTTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 203
1077049144_1077049149 1 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049149 11:558964-558986 CTGACCGACTCTTGCTCTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 328
1077049144_1077049151 3 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049151 11:558966-558988 GACCGACTCTTGCTCTGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 145
1077049144_1077049153 8 Left 1077049144 11:558940-558962 CCTGCTGGAGGTCCCAGGTGACC 0: 1
1: 0
2: 5
3: 18
4: 228
Right 1077049153 11:558971-558993 ACTCTTGCTCTGTGGGGGACAGG 0: 1
1: 1
2: 1
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077049144 Original CRISPR GGTCACCTGGGACCTCCAGC AGG (reversed) Exonic
900327429 1:2115600-2115622 TGTCACCTGGCACTTGCAGCTGG - Intronic
900486699 1:2926085-2926107 CCTCGCCTGGGAACTCCAGCAGG - Intergenic
901274857 1:7983391-7983413 AGTCACCTGGGACAGGCAGCTGG + Intronic
901652798 1:10752629-10752651 GGGCAGCTGGGACCTCCTTCTGG - Intronic
901913571 1:12480257-12480279 GGTAACCTGGGAACTCCAGCTGG + Intronic
904784134 1:32973031-32973053 GGTCACATGGCACCGCCACCGGG - Intergenic
906231833 1:44171051-44171073 GGTAACCTGGGACTTTCAACTGG + Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907708136 1:56850494-56850516 TGCCACCTGGGATCTACAGCTGG + Intergenic
911116969 1:94256153-94256175 GGTCACCTGTCTCCTCAAGCAGG + Intronic
912364827 1:109124820-109124842 GGTCACTTGGGAGCTCCAGTAGG - Intronic
912775714 1:112505188-112505210 GATTACCTGGGGCCTCCAGCAGG - Intronic
915320333 1:155052652-155052674 GGTGTCCTGGGACCTGCAGGTGG + Exonic
916584898 1:166142008-166142030 GGACACCTGGGACCTCTCACAGG - Intronic
920051810 1:203168900-203168922 TCTCACCTTTGACCTCCAGCCGG + Exonic
920838929 1:209537579-209537601 GGTGAAGTGGAACCTCCAGCTGG - Intergenic
922785257 1:228279428-228279450 GCTCACCTGAGACCACCAGGCGG - Exonic
922785477 1:228280429-228280451 ACTCACCTCGGACCTCCAGGCGG - Exonic
923855036 1:237837446-237837468 GTTCAGCAGGGACCTCCAGTCGG + Intergenic
1064007165 10:11707915-11707937 GGTCCCCCTGGCCCTCCAGCAGG - Intergenic
1065424429 10:25585016-25585038 TGTAACCTGGGACCTCCCACTGG - Intronic
1067728907 10:48794801-48794823 GGCCACCAGGGACTTCCAGGTGG - Intronic
1069958877 10:72068124-72068146 GGCCACCTGGCACCTCCTTCAGG - Intronic
1070247138 10:74743489-74743511 GGTCACCTGGGAGGCCCAGGTGG - Intergenic
1074529657 10:114288574-114288596 GGTGACCTTGGACCTCAAGGTGG - Intronic
1076238330 10:128883130-128883152 GGTCACCTGAGACCACCGGGAGG - Intergenic
1076838266 10:133032122-133032144 GCTCACTTGGGTCCCCCAGCAGG + Intergenic
1076868693 10:133182195-133182217 GGTCACCTTGGACCTCACGACGG + Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077214112 11:1388242-1388264 TGTAGACTGGGACCTCCAGCTGG - Intergenic
1079781344 11:24609846-24609868 GGTTTGCTGTGACCTCCAGCAGG - Intronic
1081603164 11:44509436-44509458 TCTCACTTGAGACCTCCAGCAGG + Intergenic
1082787230 11:57323967-57323989 GGTCACCTGGGGCCCCTGGCTGG - Intronic
1083049312 11:59762761-59762783 GGACACCTGAGATCTCCAGGAGG + Intronic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083654533 11:64223168-64223190 TGTCAACTGGGACATCCGGCAGG + Exonic
1083673876 11:64314908-64314930 GGTCACCTGGGCCCTTTACCTGG - Exonic
1083983402 11:66192749-66192771 GGCCACCCTGGACTTCCAGCAGG - Intronic
1084095775 11:66910229-66910251 CTCCACCTGGAACCTCCAGCTGG - Intronic
1084483536 11:69435265-69435287 CCTCACCTGGGACCTCAAGGGGG + Intergenic
1086432080 11:86745622-86745644 TCTCACCTGGGAGGTCCAGCTGG - Intergenic
1086575742 11:88337543-88337565 GGGCACCTGGGTCTTCCAGGTGG - Exonic
1088585083 11:111354521-111354543 GGTGCTCTGGGCCCTCCAGCGGG + Exonic
1088684962 11:112276958-112276980 GATCACGTGGGAGCTCCAGAGGG - Intergenic
1088946423 11:114517837-114517859 GTGCAGCTGGGACCTCCATCAGG - Intergenic
1089176445 11:116552199-116552221 GGGCACCTGGGACACACAGCAGG - Intergenic
1089200785 11:116723675-116723697 GGTCACCTGGGCCCCCGACCTGG - Intergenic
1089414043 11:118272156-118272178 GGTCTGCTGGGACCTACTGCAGG - Intergenic
1090598167 11:128341927-128341949 AGGCTCCTGGGTCCTCCAGCAGG + Intergenic
1091849136 12:3681083-3681105 GGACACCAGGGGCCTCCAGCAGG - Intronic
1094690250 12:32761518-32761540 GGTTCTCTGAGACCTCCAGCTGG - Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096531997 12:52248299-52248321 AGTCTCCTGGCCCCTCCAGCAGG - Intronic
1100391717 12:94149997-94150019 GGTCAGCTGGGACTTCAAGACGG + Exonic
1102953792 12:117046691-117046713 GGTGACCTTGGGCCTCCATCAGG + Intronic
1103206395 12:119132459-119132481 GGTCAATTGGGACCTCCAGATGG - Intronic
1105605272 13:21921424-21921446 GGTTACCTTGGTTCTCCAGCTGG + Intergenic
1106448963 13:29862612-29862634 GCTGACTTGGGAGCTCCAGCAGG - Intergenic
1108282466 13:48873726-48873748 GGTCACCTGAGACCACCAACAGG + Intergenic
1111231901 13:85354602-85354624 GATCAGCTGAGAGCTCCAGCAGG + Intergenic
1113009737 13:105750285-105750307 GGACACCTGGGACCACCAGAAGG + Intergenic
1113582158 13:111437488-111437510 GGTGCCCTGGGAGCTCCATCTGG - Intergenic
1113594056 13:111519137-111519159 GGACCCCGGGGACTTCCAGCAGG - Intergenic
1113857978 13:113459360-113459382 GGACACCTGGAACCTCCTGCTGG - Exonic
1113941127 13:114019090-114019112 GGTCACCGGGGATCCCCAGGAGG + Intronic
1114069076 14:19094098-19094120 AGTCAACAGGGAACTCCAGCTGG - Intergenic
1114093184 14:19305905-19305927 AGTCAACAGGGAACTCCAGCTGG + Intergenic
1114531010 14:23396484-23396506 GGTCACCTGGGAGCTCATCCAGG - Intronic
1118059345 14:62117710-62117732 GGTCATTTGGGACCAGCAGCTGG - Intergenic
1121038865 14:90728737-90728759 GTACCCCTGGGACCTCCAGGGGG + Intronic
1121720122 14:96103491-96103513 GGTCACCTGGCTAGTCCAGCAGG + Intergenic
1121929996 14:97963704-97963726 GGTCACCTGAGGCCTCCACAGGG + Intronic
1122393680 14:101407781-101407803 GGCCTCCTGGGACCTCTTGCTGG - Intergenic
1122575303 14:102738177-102738199 GGTCTCCTGGGTGCTCCATCAGG - Intergenic
1122645339 14:103189796-103189818 GGGCTCCTGTGGCCTCCAGCAGG + Intergenic
1122834400 14:104423901-104423923 GGTCACCTGTCACCTCCCCCAGG + Intergenic
1123106344 14:105843509-105843531 GGTCAGTTGGGTCCTCCAGGTGG + Intergenic
1123139571 14:106062077-106062099 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1123149856 14:106170473-106170495 GTTTGCCTGGGACCACCAGCAGG - Intergenic
1123187895 14:106537738-106537760 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1124881850 15:33650057-33650079 TGTCACGAGGGACCTGCAGCTGG + Intronic
1125538326 15:40455551-40455573 GGCCACCCCTGACCTCCAGCTGG - Intronic
1128798730 15:70483272-70483294 AGTCACATGGCACCACCAGCTGG - Intergenic
1129872195 15:78947699-78947721 GGTCACCAGGGACCTAGCGCAGG - Intronic
1130726336 15:86443191-86443213 GGGCACCAGGGATCTCCAGATGG + Intronic
1132178534 15:99733831-99733853 GGTCCCCTGAGCCCTCCTGCGGG + Intergenic
1132576911 16:668448-668470 GCTCACCAGGGACCCCCGGCTGG - Intronic
1132655939 16:1041674-1041696 GGCAGCCTGGGAGCTCCAGCAGG + Intergenic
1132677754 16:1127658-1127680 GGGCACCTGGGCCCTGCAGTAGG - Intergenic
1133232211 16:4372125-4372147 GGTCACCTGGGCCGCCCGGCGGG + Intronic
1133277673 16:4648392-4648414 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277698 16:4648464-4648486 GGTCACCTGGCTCCTCCTCCCGG + Intronic
1133277727 16:4648535-4648557 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277742 16:4648571-4648593 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277756 16:4648606-4648628 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277782 16:4648677-4648699 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277821 16:4648784-4648806 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277835 16:4648819-4648841 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1134677413 16:16100259-16100281 GGTCAGCTGGGAGCTTCTGCAGG - Intronic
1135327555 16:21536724-21536746 GGTCACCTGGATCATCCAGAAGG - Intergenic
1136337905 16:29622744-29622766 GGTCACCTGGATCATCCAGAAGG - Intergenic
1136499772 16:30664464-30664486 GGTGCCCTGGCACCTGCAGCAGG - Exonic
1136848240 16:33593642-33593664 GGTCACCTGGTGCCTCCAGGCGG - Intergenic
1137750539 16:50858264-50858286 GGGGACCTGGGAGCTACAGCAGG + Intergenic
1142040668 16:87891825-87891847 GGTCACCTGGATCATCCAGAAGG - Exonic
1142129392 16:88425833-88425855 GGGCACCCGGGCCCCCCAGCTGG + Intergenic
1203109947 16_KI270728v1_random:1442291-1442313 GGTCACCTGGTGCCTCCAGGCGG - Intergenic
1142485765 17:246923-246945 GAGCAGCGGGGACCTCCAGCAGG - Intronic
1143116592 17:4584865-4584887 GGGCACCGGGGACATCCCGCTGG - Exonic
1143344867 17:6242122-6242144 GGGCACCTGGGCACTCCAACGGG + Intergenic
1144092412 17:11869911-11869933 GGTCACTTGGTACATTCAGCTGG + Intronic
1148236808 17:45974510-45974532 GGTCAGCTGGGGCACCCAGCAGG - Intronic
1148698718 17:49575978-49576000 GCACATCTGGGACCTCGAGCGGG + Exonic
1150696654 17:67411386-67411408 GGTCACCAGGGATGGCCAGCAGG + Intronic
1151185345 17:72360138-72360160 GCTCATCTGAGACCTCCAACAGG - Intergenic
1151757320 17:76082233-76082255 GGTCACCTGGGACTTCAGGGAGG - Intronic
1152462460 17:80448720-80448742 GGACACCTGGGACCACCATTCGG - Intergenic
1153143350 18:2000461-2000483 GGTCTCCTGGATCCTCCAGAAGG + Intergenic
1157563511 18:48664450-48664472 TGCCACCTGGGACCTGCAGCCGG + Exonic
1158478653 18:57802584-57802606 GGTCACCGGGGTCTTCCAGAGGG + Intronic
1159901525 18:74052054-74052076 GATCACCTGGGATGTCCCGCAGG + Intergenic
1160542310 18:79630835-79630857 GGCAAGCTGGGAACTCCAGCCGG + Intergenic
1161257455 19:3317262-3317284 GGTCACCTGCGCCCTCCCACAGG + Intergenic
1161282252 19:3452436-3452458 GGTTACTTGGGGGCTCCAGCCGG - Intronic
1161389317 19:4013009-4013031 CGTCACCAGGGCCCTCCAGCTGG + Exonic
1161551764 19:4916869-4916891 GATCAGGAGGGACCTCCAGCCGG - Intronic
1161565257 19:4998256-4998278 GGTCACCTGGCACTTCCTTCTGG - Intronic
1162015996 19:7846731-7846753 GGGCACCTGGGAACTCCTGTGGG - Intronic
1162662454 19:12181154-12181176 GGTCTCCTGGGTCCTCCCTCCGG - Intronic
1163218466 19:15897597-15897619 GCTCAGCTGGGACATCCTGCAGG + Exonic
1163602000 19:18254960-18254982 GGCCATCTGTGGCCTCCAGCAGG + Intronic
1165257830 19:34590252-34590274 GGACACCTGGGACCTCCTCCAGG - Intergenic
1165860285 19:38905730-38905752 AGTGACCTGGGGCCTCCAGGTGG - Intronic
1165914009 19:39247159-39247181 GCTCACGTGGGAGCTCCGGCTGG - Intergenic
1165916852 19:39265769-39265791 GCTCACGTGGGAGCTCCGGCTGG + Intergenic
1166928988 19:46289767-46289789 GCTCACCTGGCACCTGCGGCTGG + Intergenic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
927212691 2:20648380-20648402 GGTCATCTGCGACCTCCATGTGG + Intronic
927352781 2:22137385-22137407 GGTCACCAATGACCTCCACCTGG - Intergenic
927406975 2:22781662-22781684 CGTCACCTGGTTTCTCCAGCTGG + Intergenic
928172526 2:29012595-29012617 GGTCACCAGGGACCTGTGGCAGG + Intronic
929123684 2:38503770-38503792 GGTCTCCTGGGGTCTCCAGTAGG + Intergenic
932596134 2:73094670-73094692 GGCCACCTGGGCTCTCCACCTGG + Intronic
932630902 2:73342500-73342522 GGTCACCAGTGACCTCCATGTGG - Intergenic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
934054230 2:88238658-88238680 GGACACCTGGGTCCTGCACCTGG - Intergenic
935597183 2:104888381-104888403 GGGCAGCTGGGACCTCAGGCTGG + Intergenic
936400318 2:112159902-112159924 GGTGACGAGGGGCCTCCAGCTGG - Intronic
937261799 2:120591361-120591383 GCCCACCTGGGTCCCCCAGCAGG - Intergenic
938379362 2:130827947-130827969 GGTCACTGGGGCCCTGCAGCAGG - Intergenic
938582652 2:132661156-132661178 GGGCATCTGGGACCACCAACAGG + Intronic
946515998 2:220412256-220412278 GCTAACCTGGCAACTCCAGCAGG + Intergenic
947418668 2:229922314-229922336 GGTCACCCGGGACCTGGAGCTGG + Intronic
947818484 2:233054249-233054271 GGGCTCCTGGGGGCTCCAGCGGG - Intergenic
1172114858 20:32567583-32567605 GGCCACCTGCCACTTCCAGCAGG - Intronic
1172781312 20:37438438-37438460 GGCCACTGGGGACCCCCAGCAGG - Intergenic
1179423360 21:41253549-41253571 GCACACCTGGGTCCTCAAGCTGG - Intronic
1179885859 21:44314037-44314059 GGACACCTGCGGCCCCCAGCAGG - Intronic
1180085852 21:45507521-45507543 GGTCACCCAGGACCTGCGGCTGG - Intronic
1180098993 21:45575584-45575606 GCTCACCTGTGCCCTCCAGTGGG + Intergenic
1180487549 22:15816660-15816682 AGTCAACAGGGAACTCCAGCTGG - Intergenic
1181389311 22:22568177-22568199 TCTCCCCTGGGACCTCCAGAAGG + Intergenic
1183698236 22:39435358-39435380 GATCACCTGGGCCCGGCAGCCGG - Intronic
1184274011 22:43400035-43400057 GGTCACCTGGGAGCTGGGGCTGG + Intergenic
1184699616 22:46161936-46161958 TGTCACCTGGGCCCTCCCGGAGG + Intronic
1185349416 22:50326826-50326848 GGTCACCTTCGACCTGGAGCTGG - Exonic
950652564 3:14416457-14416479 AGTGACCTTGGACCTCCAGGTGG + Intronic
951190508 3:19764418-19764440 GGCCACCTGTGACCCCGAGCTGG - Intergenic
951835123 3:26974694-26974716 TGTCACCTGGGACATTCTGCCGG + Intergenic
952845186 3:37682300-37682322 GGTCACCAGTGACCTCCAGAAGG + Intronic
952870257 3:37893109-37893131 GGTCAGCTGTGTCCTGCAGCAGG - Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953434439 3:42867446-42867468 GGTCAGCTGGGACCTAGTGCAGG + Intronic
954689548 3:52388423-52388445 GGTCATCCTGGGCCTCCAGCAGG - Exonic
954854823 3:53635214-53635236 TGTCACATGTGTCCTCCAGCAGG - Intronic
955971954 3:64445281-64445303 GATCGCCGGGCACCTCCAGCCGG - Intronic
960545514 3:118910236-118910258 GGTCTCCTGGGACCTCTATATGG - Intronic
960971978 3:123146295-123146317 GGTCTCCAGGGGCCGCCAGCTGG - Intronic
961654230 3:128432777-128432799 GATCACCTGGGTCCTCCTCCAGG - Intergenic
961993487 3:131216931-131216953 GCTTCTCTGGGACCTCCAGCAGG + Intronic
964949471 3:162271234-162271256 GGTCACCTGGAACCTCCAGAGGG + Intergenic
969342708 4:6552355-6552377 CCTCCCCTGGGGCCTCCAGCAGG - Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
969875006 4:10129704-10129726 GTTCTCCTAGGACATCCAGCTGG + Intergenic
972141646 4:35968024-35968046 GGTCACCTGGAAGGTGCAGCAGG + Intronic
973781751 4:54294610-54294632 CGTCACCTGGGCCCTCAAGTTGG + Intronic
975394898 4:73863582-73863604 GGACACCTAGGTCCTCCAGCTGG - Intergenic
979188165 4:117824605-117824627 GGTCACCAGGCACCCCCACCCGG + Intergenic
983484631 4:168318707-168318729 GGTAACCTGGAACTTCCACCTGG - Exonic
986429231 5:7665281-7665303 GGACAACTGGGACATCCAGGCGG - Intronic
987542375 5:19271801-19271823 GGTCACCTGGAACAGCCATCAGG + Intergenic
988428939 5:31096467-31096489 GGACACATGGAACCCCCAGCTGG - Intergenic
992249510 5:74863923-74863945 GGTCACCTGCAATCTCTAGCAGG + Intronic
993049416 5:82909389-82909411 TCTCTCCTGGGACCTCCAGAAGG + Intergenic
995399856 5:111728711-111728733 GGTCACATGAGACCTCTAGAAGG + Intronic
997618957 5:135272509-135272531 GGTCATCTGGCCTCTCCAGCAGG + Intronic
999096562 5:148983489-148983511 GGTTTCTTGGGACCTCCACCTGG - Intronic
1001242540 5:170081417-170081439 GGTCATCTGGCCCCTCCACCAGG + Intronic
1002094095 5:176820829-176820851 GCTCACCTGGGCCCTGCTGCTGG - Intronic
1002714682 5:181219572-181219594 GGTCACCACGGGCCTCCAGGTGG + Intergenic
1002867281 6:1132546-1132568 GGTCTCCTGACACCCCCAGCAGG + Intergenic
1003110757 6:3250403-3250425 GGACAGCTGGGACCCACAGCTGG + Intronic
1003528360 6:6917134-6917156 GGTCCACTGTGATCTCCAGCAGG + Intergenic
1003984270 6:11419621-11419643 GCTAACCTGGAACCTCAAGCTGG - Intergenic
1006285657 6:33092158-33092180 GGACACCTGTGACCTCCAGGGGG - Intergenic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006855280 6:37128663-37128685 GTTCTCGTGGCACCTCCAGCTGG - Intergenic
1011545739 6:88479919-88479941 GGTCACCCGTGACCTCCACAGGG + Intergenic
1013300867 6:108803854-108803876 GGTCACCAGGGACCTCCATCTGG - Intergenic
1016569597 6:145497462-145497484 GGTCTCCAGCGACCTCCTGCAGG - Intergenic
1019775776 7:2911358-2911380 GGTCTCCTTGGGCCTCCTGCGGG + Intronic
1019927993 7:4205928-4205950 GGTCCCACGTGACCTCCAGCTGG - Exonic
1020000813 7:4754525-4754547 CGTGACCTCGGACCTGCAGCTGG + Exonic
1024974713 7:55102323-55102345 AGCCACCTTCGACCTCCAGCAGG + Intronic
1029407297 7:100383199-100383221 GGTACCCTGGGACCAGCAGCAGG + Intronic
1029539289 7:101173337-101173359 GCTCACCCGGGACGACCAGCTGG - Exonic
1031147636 7:118014575-118014597 CCTCACCTGGGAACTCCATCAGG + Intergenic
1032110903 7:129074401-129074423 GGTTACCTGGGCCAGCCAGCTGG - Intergenic
1032538791 7:132686278-132686300 TGTAAGCTGGGACCTCTAGCCGG - Intronic
1034873121 7:154701124-154701146 CTTCACCTGGGAACTCCAGGAGG - Intronic
1035472010 7:159116351-159116373 AGTCACATGGGCCCTCCAGAGGG + Intronic
1035641052 8:1185382-1185404 GGTCACCTTGTACCTGCAGATGG - Intergenic
1037863084 8:22420131-22420153 GGGCACCTTGGACCTCCAGCTGG + Exonic
1039262173 8:35783539-35783561 GGGCACCTTGCACTTCCAGCTGG - Intronic
1043991209 8:86757351-86757373 GGTCAGCTGGGACTGGCAGCTGG + Intergenic
1045253662 8:100501911-100501933 GGTCTACTGGGGCCTCCTGCAGG + Intergenic
1046239689 8:111475012-111475034 AGTCATCAGGGACCCCCAGCCGG + Intergenic
1046337326 8:112807170-112807192 AGTCACAAGGGTCCTCCAGCTGG - Intronic
1046444437 8:114298503-114298525 GGTCACTGGGGACTTCCAGAAGG + Intergenic
1047778375 8:128092085-128092107 GGTCAGCTGGGCCCGCCAGGTGG - Intergenic
1048149095 8:131876020-131876042 TGTCATCTGGGACCTCCACTGGG - Intergenic
1048569310 8:135638306-135638328 GGGCTCCTGGGTCCTCCAGAGGG - Intronic
1048941494 8:139404274-139404296 GGTCAGCTGGGACCTCAGGGAGG + Intergenic
1049653379 8:143787061-143787083 GGGCACCAGGGAGCTCCAGAGGG + Intergenic
1049680239 8:143914916-143914938 GGCCCCCTGGGACCTGCTGCTGG - Intergenic
1049693158 8:143971550-143971572 GGCCACCTCTGACCTCCTGCAGG + Intronic
1049709364 8:144056743-144056765 GCTGATCTGGGACCTGCAGCAGG + Exonic
1049939523 9:531930-531952 GCTCACCTGAGACATCCACCTGG + Intronic
1056546981 9:87621247-87621269 GATCACCTGGAAGGTCCAGCAGG + Intronic
1057266183 9:93619588-93619610 GGCCACCAGGAACCACCAGCAGG - Intronic
1057274390 9:93668584-93668606 GGGCACCTGGGACTTGCAGGGGG + Intronic
1059101780 9:111479073-111479095 GGTCCCCTGGGTCCTGCAGCTGG - Intronic
1059352770 9:113677253-113677275 GGGCACCCGGGCCCTCCAGGAGG - Intergenic
1060204900 9:121676758-121676780 GGTCACCCAGGACCTCCTCCAGG + Intronic
1061654656 9:132079637-132079659 GGTCAACCGGGACCTCAAGTAGG - Exonic
1062083454 9:134636626-134636648 GGTGTTCTGGGCCCTCCAGCTGG + Intergenic
1062097174 9:134709511-134709533 GGTCACCAGCCACCTGCAGCAGG - Intronic
1062359419 9:136180607-136180629 GGGTACCTGGGCCCTCCAGAGGG + Intergenic
1062403787 9:136383886-136383908 GGTCAACTGGGGGGTCCAGCAGG - Intronic
1186010614 X:5128097-5128119 AGTGACCCAGGACCTCCAGCAGG - Intergenic
1186074765 X:5866134-5866156 AGACACCTGAGACCTGCAGCTGG + Intronic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic