ID: 1077049253

View in Genome Browser
Species Human (GRCh38)
Location 11:559399-559421
Sequence CATGGATACCAGCACCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077049240_1077049253 23 Left 1077049240 11:559353-559375 CCCGACCTCCAAGCAGGCCTGGG 0: 1
1: 0
2: 2
3: 49
4: 366
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1077049245_1077049253 18 Left 1077049245 11:559358-559380 CCTCCAAGCAGGCCTGGGAGGGA 0: 1
1: 1
2: 2
3: 48
4: 340
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1077049242_1077049253 22 Left 1077049242 11:559354-559376 CCGACCTCCAAGCAGGCCTGGGA 0: 1
1: 0
2: 3
3: 28
4: 322
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1077049246_1077049253 15 Left 1077049246 11:559361-559383 CCAAGCAGGCCTGGGAGGGAAGG 0: 1
1: 0
2: 6
3: 66
4: 495
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1077049237_1077049253 30 Left 1077049237 11:559346-559368 CCTGAGGCCCGACCTCCAAGCAG 0: 1
1: 0
2: 2
3: 35
4: 532
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1077049249_1077049253 6 Left 1077049249 11:559370-559392 CCTGGGAGGGAAGGGCTGTATAC 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077049253 Original CRISPR CATGGATACCAGCACCCAGA AGG Intronic
900469899 1:2848569-2848591 TGTGGAGGCCAGCACCCAGAGGG + Intergenic
901155380 1:7133983-7134005 TATGGATCCCACCACCCAGGTGG + Intronic
901156855 1:7145996-7146018 CATGCATGCCACCACCTAGACGG - Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902664040 1:17925068-17925090 CATGGAAACAAAGACCCAGAGGG - Intergenic
905396131 1:37667899-37667921 CATTCATTCCAGCACCCACAAGG + Intergenic
906150751 1:43586162-43586184 CATGGAAACCTGCACCTAGTAGG + Intronic
910879027 1:91905850-91905872 GATGGATGCCAGCACACACAAGG - Intronic
912181033 1:107219766-107219788 CATGGATACCAGCACCTACTTGG + Intronic
912227435 1:107750923-107750945 AATAGATACCAGAACCCAGGTGG + Intronic
913025502 1:114833904-114833926 AAGGGATACAAGAACCCAGAAGG - Intergenic
915297097 1:154929128-154929150 CCTGGACACCAGCACCTACAAGG - Exonic
918783332 1:188731563-188731585 AGTGGATACCATCACCCTGAAGG + Intergenic
921316154 1:213893300-213893322 CATGGATAACAGCTCCATGATGG + Intergenic
921952332 1:220943427-220943449 AATGGATACAGGCAACCAGAGGG + Intergenic
922451008 1:225737349-225737371 CCTGGACACCAGGCCCCAGAGGG - Intergenic
924011738 1:239672471-239672493 CAGGGCTAGGAGCACCCAGATGG + Intronic
924029734 1:239874110-239874132 CAAAGGTACCAGCACTCAGATGG + Intronic
924555011 1:245110847-245110869 CATTGACACCAACAGCCAGAAGG + Intronic
924855134 1:247868344-247868366 TATGGCTCCCAGCACCAAGAGGG - Intronic
1063459938 10:6208810-6208832 TATGGAAAGCAGCAGCCAGATGG - Intronic
1064346483 10:14537268-14537290 CATGGACACCAGCTCCAAGATGG - Intronic
1064871377 10:19941288-19941310 CATGGATCCCTGAACCAAGACGG + Intronic
1068617070 10:59130466-59130488 CATGGGTAACAACACCCCGAAGG - Intergenic
1069020770 10:63485984-63486006 GATGGATGGCAGCACACAGAAGG + Intergenic
1069831532 10:71285001-71285023 CATGGATGCCAGCTCAGAGAGGG + Intronic
1071372167 10:84963316-84963338 CATAGATGCCAACACCAAGATGG - Intergenic
1073066363 10:100761728-100761750 CCTGGAGACCAGTAGCCAGAGGG - Intronic
1073599516 10:104832985-104833007 CATGGGTGTCAGCTCCCAGATGG + Intronic
1075263354 10:120981014-120981036 CTGTGAAACCAGCACCCAGATGG + Intergenic
1076575471 10:131463997-131464019 CATGCATCCCATCACCCACACGG + Intergenic
1076901427 10:133340297-133340319 CATGGTGCCCAGCACACAGAAGG + Intronic
1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG + Intronic
1081776886 11:45681750-45681772 CATGGATCCCAGCACCCCCATGG - Intergenic
1086299380 11:85409265-85409287 CATGTAAACCAGGACTCAGAAGG - Intronic
1088687863 11:112299761-112299783 GAGGGAAAGCAGCACCCAGAGGG + Intergenic
1089164366 11:116463450-116463472 CATGGTTATAAGCACTCAGAGGG + Intergenic
1091275242 11:134345265-134345287 CAGGAAAAGCAGCACCCAGAGGG + Intronic
1093985653 12:25529272-25529294 CATGGATAACATCACCTATAAGG - Intronic
1094168824 12:27469575-27469597 CCTGGCTCCCAGCACCCTGAGGG - Intronic
1095374184 12:41506599-41506621 TATGAATGCCAGCACTCAGACGG + Exonic
1101282503 12:103273158-103273180 TATGGATTCTAGCTCCCAGATGG - Intronic
1101739467 12:107489627-107489649 CATGGATATCAACACACACATGG - Intronic
1101809448 12:108095054-108095076 CATGTAGACCAGCATCGAGATGG + Intergenic
1102108445 12:110345638-110345660 CCTGTATGCCAGCACCCACAGGG + Intronic
1102254707 12:111408773-111408795 CATGAACACCAGCCCTCAGAAGG - Intronic
1104164896 12:126218183-126218205 CATGGGTACCAGACCCCACATGG - Intergenic
1105436503 13:20383438-20383460 CATGGATACTAGTTTCCAGAGGG + Intergenic
1108020097 13:46119554-46119576 CATGGATACAAGCAACAAGGTGG + Intergenic
1110410334 13:75197904-75197926 TGTGGATAGCAGAACCCAGAGGG + Intergenic
1110886821 13:80649479-80649501 CATGGATAACAGAAGCCAGTGGG - Intergenic
1111984332 13:95050390-95050412 AAAGAATACAAGCACCCAGAAGG + Intronic
1112623910 13:101080253-101080275 CATGGTAACCAGCAGCCACATGG + Intronic
1113623269 13:111778295-111778317 CATAAACACCAGCCCCCAGAGGG + Intergenic
1114364142 14:22008965-22008987 CATGGCAACCAGAACCCACATGG + Intergenic
1115318705 14:32054716-32054738 CATGGATGGCAGCAGGCAGAGGG - Intergenic
1115534927 14:34363976-34363998 CATGGTTACCAGCAAACAGCTGG - Intronic
1116421022 14:44732378-44732400 CATGGAACCCTGCACTCAGAAGG + Intergenic
1120664179 14:87286315-87286337 CATGGATACAAAAACCCAGGAGG - Intergenic
1121183784 14:91948985-91949007 GATTATTACCAGCACCCAGAAGG - Intergenic
1121578200 14:95006213-95006235 AATGGATTCCAGCAGGCAGAGGG - Intergenic
1122113051 14:99514958-99514980 CATGGAGCCCAGGGCCCAGAGGG + Exonic
1122827472 14:104377231-104377253 CATGTTGACCAGCACCCACAGGG + Intergenic
1125602616 15:40923785-40923807 CCTGCTGACCAGCACCCAGAAGG + Intergenic
1125917903 15:43505817-43505839 AATGCATACCAGCAGCCATAGGG - Intronic
1130891891 15:88140400-88140422 CGTGGCTACATGCACCCAGATGG + Intronic
1132879037 16:2153163-2153185 CATGGAGACCAGCGCCAAGACGG + Exonic
1133496242 16:6320673-6320695 TATGGTTACCAGCAGCCAGACGG + Intronic
1134103814 16:11471140-11471162 CATCTTTACCAGCAGCCAGATGG - Intronic
1134803918 16:17108766-17108788 CATGCAGACCTGCAGCCAGACGG - Exonic
1134887312 16:17805068-17805090 AATGAAAACCAGCCCCCAGAGGG + Intergenic
1136295065 16:29296932-29296954 CCTGGATGCCAGCCCCGAGACGG - Intergenic
1139550973 16:67672935-67672957 CATGGAGACCAGAACCCTGTGGG + Intergenic
1140131745 16:72167832-72167854 CATGGAGACCAGCACACTGAGGG + Intronic
1141054305 16:80802907-80802929 CATTGAGATAAGCACCCAGAAGG - Intronic
1141723186 16:85768197-85768219 TATGGAGACCACCACCCTGACGG + Intergenic
1142100965 16:88270941-88270963 CCTGGATGCCAGCCCCGAGAGGG - Intergenic
1146423518 17:32712979-32713001 CATGGATACCAGGAGGTAGAGGG + Intronic
1147429438 17:40362671-40362693 CCTGGATGCCACCACCCAGGTGG - Intronic
1148288834 17:46422533-46422555 CATGGATCCTAGCATCCTGAAGG + Intergenic
1148311003 17:46640110-46640132 CATGGATCCTAGCATCCTGAAGG + Exonic
1149981179 17:61312656-61312678 CATGGAAACCAGCATCCCGAGGG - Intronic
1151681706 17:75625959-75625981 CATGGACCCCAGCTCCCAGGTGG + Intergenic
1152677058 17:81647035-81647057 CCTGGATACATGCACCAAGAAGG - Intronic
1156369943 18:36464456-36464478 CTTGGACTCCAGCACCCAGGAGG + Intronic
930402231 2:50904891-50904913 CCTGGATATAAGTACCCAGAAGG - Intronic
932262996 2:70342670-70342692 CATGGGGTCCAGCATCCAGATGG + Intergenic
935652004 2:105390365-105390387 CAGTGATACCAGCTCCCAGCAGG + Intronic
935662477 2:105479103-105479125 CAGGGATTCCAGCAGCCACAAGG + Intergenic
935950179 2:108321799-108321821 CATGGATAACCAAACCCAGAAGG + Intergenic
937448903 2:121984110-121984132 CATGGATGCCAGCAGACAAAGGG - Intergenic
939967485 2:148624609-148624631 CATGGAGGCTACCACCCAGAAGG - Intergenic
941573759 2:167204053-167204075 CATAGATACCAGCTTCAAGAAGG - Intronic
943235154 2:185308346-185308368 CATGGATACAAGTATTCAGAAGG + Intergenic
946173605 2:217909522-217909544 CATGCATAGCACCACCTAGAGGG + Intronic
946208478 2:218128390-218128412 CATGCATCCCAGGGCCCAGAGGG - Intronic
948600916 2:239107065-239107087 CAAGGTCACCAGCTCCCAGACGG + Intronic
949007965 2:241660971-241660993 CAGTGCTACCTGCACCCAGAGGG - Intronic
1171984627 20:31651068-31651090 CATGGAGTCCACCACCCAGTAGG + Intergenic
1172812418 20:37658341-37658363 CTAGGATCCCAGCAGCCAGAAGG + Intergenic
1175074936 20:56364263-56364285 CATGGATTCGAGCCCCTAGAAGG - Intronic
1175701697 20:61142809-61142831 CATGAAAACCAGCCACCAGAGGG - Intergenic
1176067359 20:63205210-63205232 GAAGGATAACAGCACCCAGTCGG + Intronic
1179578330 21:42321502-42321524 CATGGAGACCAGCAATCGGATGG - Intergenic
1182829557 22:33294068-33294090 AATGGTTACCAGCATCCAGTGGG - Intronic
1183289982 22:36995198-36995220 CCTGGATACCTGGACACAGAGGG + Intronic
1183380971 22:37490330-37490352 CAGGGATACAAGCAAGCAGAAGG + Intergenic
1185148177 22:49150408-49150430 TGTGGACAGCAGCACCCAGAGGG - Intergenic
949395641 3:3612138-3612160 CAGGGTCACCAGCACCCACAGGG + Intergenic
949497553 3:4647029-4647051 GAATGATAGCAGCACCCAGAAGG + Intronic
949622128 3:5825222-5825244 CATGTATACCACCACCAAAAGGG - Intergenic
949987449 3:9552371-9552393 CATGGAGAGCAGCACGAAGAAGG + Exonic
950494015 3:13323080-13323102 AATGGAGCCCAGCTCCCAGAAGG - Intronic
954127961 3:48543322-48543344 CAAGAATACAAGCATCCAGAGGG + Intronic
954422691 3:50426945-50426967 CAGGGAGACCAGCTCCCAGCTGG + Intronic
959120634 3:102228144-102228166 CATTGATGCCAGCTCCCCGAAGG + Intronic
960537173 3:118827059-118827081 CATGGTGACCTGCACTCAGAAGG + Intergenic
962840373 3:139227222-139227244 CAGGGCTACCAGGATCCAGATGG + Intronic
967279294 3:187806549-187806571 CATGGAGACCAACACAGAGAAGG - Intergenic
967606479 3:191452568-191452590 CATGCAGACCAACACCCAGGTGG - Intergenic
968123622 3:196143086-196143108 CATGCATTCCAGCACCCTGATGG - Intergenic
968131076 3:196193183-196193205 CAGGGAAACCCGCACCCAGCCGG + Intergenic
968767820 4:2483243-2483265 TATGGTTCCTAGCACCCAGAAGG - Intronic
973535734 4:51880285-51880307 CCTAGATACCAGCACGAAGAGGG + Intronic
978124974 4:105124711-105124733 AATGGTTACCAGAACCCAGGAGG - Intergenic
978620176 4:110629533-110629555 CATGGAGCCCACCTCCCAGAGGG + Intronic
982369922 4:154623747-154623769 CATGGAGGCCACCACCCAGAAGG - Intergenic
985957672 5:3276951-3276973 CCCGGATCCCAGCACCCAGGAGG - Intergenic
988611037 5:32725168-32725190 TATGGATCCCATCACCCAGGTGG - Intronic
996222531 5:120950788-120950810 CATGGATAGCAGCAGGCAAAGGG - Intergenic
997850855 5:137331575-137331597 CATGAATAAAAGCCCCCAGAGGG - Intronic
998231159 5:140362200-140362222 CAGGGATCCCAGAACCTAGAAGG + Intronic
999230827 5:150060865-150060887 CATGGGTACAGGCTCCCAGAAGG + Exonic
999422170 5:151454368-151454390 CATGGATGCCAGCACTCATGGGG + Intronic
1000524041 5:162332992-162333014 CATGAAAACCTGCACTCAGATGG + Intergenic
1001982630 5:176047182-176047204 GATGGATACCAGGCCCCAGGCGG - Intergenic
1002234833 5:177796875-177796897 GATGGATACCAGGCCCCAGGCGG + Intergenic
1003643295 6:7893666-7893688 CATCCATACCAGCGCCCTGACGG - Intronic
1003989719 6:11473587-11473609 CAGGGTCACCACCACCCAGAGGG + Intergenic
1006833430 6:36982802-36982824 CAAGGAGACCAGCACCTAGGTGG + Intronic
1009412764 6:63385272-63385294 CATGGAAACCAGTTCTCAGATGG - Intergenic
1016534432 6:145094668-145094690 AGTGGATACCAGTACACAGAGGG + Intergenic
1019427079 7:982961-982983 CATGGATGCCTGACCCCAGAGGG + Intergenic
1022282782 7:28927666-28927688 CATAGATACTAGCACCTAGTGGG + Intergenic
1023075949 7:36482999-36483021 CCTGGCTACCAGCAGCCAGGGGG + Intergenic
1026193628 7:68152388-68152410 AATGAATACCAGCAGCCACAGGG + Intergenic
1026513841 7:71049734-71049756 CATGGATACCAGCTCCAGGCTGG + Intergenic
1027252718 7:76409221-76409243 CATAGAAAACAGCAGCCAGAAGG + Intronic
1027541471 7:79472092-79472114 GATGGATATCAGTACACAGAGGG - Intergenic
1028326195 7:89528047-89528069 CATGGATGGCAGCAGGCAGAAGG + Intergenic
1028430426 7:90740501-90740523 CAGGGATCCCATCAACCAGAGGG + Intronic
1031939277 7:127770103-127770125 AGTGGATACCAGGGCCCAGAAGG + Intronic
1032326840 7:130936705-130936727 CTTGGAGGCCAGAACCCAGAGGG - Intergenic
1032672389 7:134097390-134097412 CATGGGTAGCAGTTCCCAGAAGG + Intergenic
1033598780 7:142874623-142874645 CATGGTCACCAGCACCATGAAGG + Exonic
1034442182 7:151091382-151091404 CCTGGCTACTAGCACCCACATGG - Intronic
1038131048 8:24732077-24732099 GATTGATACCAGCGCCCAGTGGG + Intergenic
1038615053 8:29085997-29086019 AAGGGATACCAGCACCAAGGAGG - Intronic
1039759829 8:40562555-40562577 CATTGATGACAGCACCCAGGAGG - Intronic
1039926110 8:41933620-41933642 CATGGAGACCAGCCCCATGATGG - Exonic
1041094791 8:54339188-54339210 CATCCAGACCAGGACCCAGAGGG - Intergenic
1041118538 8:54564084-54564106 CATGAATACCAGGACAGAGATGG - Intergenic
1044524698 8:93239458-93239480 CATGAAAACCATCACCCATACGG - Intergenic
1051338844 9:16092781-16092803 CATGGAGACCAGATCCCACATGG - Intergenic
1051536410 9:18163465-18163487 AATAGATCCCAGCACCTAGATGG - Intergenic
1051847014 9:21463509-21463531 CATGGATGGCAGCAGGCAGAGGG + Intergenic
1052094707 9:24369936-24369958 CATGGATCAGAGCTCCCAGAGGG - Intergenic
1052846549 9:33341251-33341273 CATGGATGGCAGCAGGCAGAGGG + Intronic
1055706714 9:79013371-79013393 CATGGATACCAGTTCCCACTGGG + Intergenic
1056919051 9:90770025-90770047 CATGCCTACCAGCACCATGATGG - Intergenic
1061251251 9:129427787-129427809 CATGGGTACCAGCTGCCTGAAGG + Intergenic
1061617882 9:131792154-131792176 CCTGGCTACCAGCACCCACCAGG + Intergenic
1062073247 9:134570461-134570483 GATGGAAGCCAGCACACAGAGGG + Intergenic
1185851128 X:3489666-3489688 CATGGATGCCAACGTCCAGACGG - Intergenic
1186336838 X:8598681-8598703 CATGGAAACCATCTCCCATAAGG - Intronic
1186662935 X:11687516-11687538 CAGGGACTCCAGCTCCCAGATGG + Intergenic
1188814165 X:34690747-34690769 CAAGGAAACCAGGACTCAGAGGG - Intergenic
1193678559 X:84487549-84487571 CATTGAAACCACCACCCAAATGG - Intronic
1199404821 X:147444493-147444515 CAGGGATCCCAGCAGCCTGAGGG - Intergenic
1199444889 X:147910955-147910977 GTTGGATACCAGCATCCCGAAGG + Intergenic