ID: 1077051396

View in Genome Browser
Species Human (GRCh38)
Location 11:568521-568543
Sequence TGGCTGCGTTGCGGTAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051396_1077051404 -10 Left 1077051396 11:568521-568543 CCCGCCCTACCGCAACGCAGCCA No data
Right 1077051404 11:568534-568556 AACGCAGCCAGTGGGCGCGAGGG No data
1077051396_1077051407 -7 Left 1077051396 11:568521-568543 CCCGCCCTACCGCAACGCAGCCA No data
Right 1077051407 11:568537-568559 GCAGCCAGTGGGCGCGAGGGGGG No data
1077051396_1077051405 -9 Left 1077051396 11:568521-568543 CCCGCCCTACCGCAACGCAGCCA No data
Right 1077051405 11:568535-568557 ACGCAGCCAGTGGGCGCGAGGGG No data
1077051396_1077051409 22 Left 1077051396 11:568521-568543 CCCGCCCTACCGCAACGCAGCCA No data
Right 1077051409 11:568566-568588 ACGCCCCGCCCACCGCCGCGCGG No data
1077051396_1077051406 -8 Left 1077051396 11:568521-568543 CCCGCCCTACCGCAACGCAGCCA No data
Right 1077051406 11:568536-568558 CGCAGCCAGTGGGCGCGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051396 Original CRISPR TGGCTGCGTTGCGGTAGGGC GGG (reversed) Intergenic
No off target data available for this crispr