ID: 1077051398

View in Genome Browser
Species Human (GRCh38)
Location 11:568525-568547
Sequence CCACTGGCTGCGTTGCGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051398_1077051409 18 Left 1077051398 11:568525-568547 CCCTACCGCAACGCAGCCAGTGG No data
Right 1077051409 11:568566-568588 ACGCCCCGCCCACCGCCGCGCGG No data
1077051398_1077051415 28 Left 1077051398 11:568525-568547 CCCTACCGCAACGCAGCCAGTGG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051398_1077051416 29 Left 1077051398 11:568525-568547 CCCTACCGCAACGCAGCCAGTGG No data
Right 1077051416 11:568577-568599 ACCGCCGCGCGGCCCTTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051398 Original CRISPR CCACTGGCTGCGTTGCGGTA GGG (reversed) Intergenic
No off target data available for this crispr