ID: 1077051402

View in Genome Browser
Species Human (GRCh38)
Location 11:568530-568552
Sequence CGCGCCCACTGGCTGCGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051402_1077051415 23 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051402_1077051416 24 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051416 11:568577-568599 ACCGCCGCGCGGCCCTTCGCGGG No data
1077051402_1077051419 29 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data
1077051402_1077051409 13 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051409 11:568566-568588 ACGCCCCGCCCACCGCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051402 Original CRISPR CGCGCCCACTGGCTGCGTTG CGG (reversed) Intergenic