ID: 1077051408

View in Genome Browser
Species Human (GRCh38)
Location 11:568541-568563
Sequence CGAACCCCCCTCGCGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051408_1077051409 2 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051409 11:568566-568588 ACGCCCCGCCCACCGCCGCGCGG No data
1077051408_1077051416 13 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051416 11:568577-568599 ACCGCCGCGCGGCCCTTCGCGGG No data
1077051408_1077051415 12 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051408_1077051419 18 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data
1077051408_1077051420 22 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051408 Original CRISPR CGAACCCCCCTCGCGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr