ID: 1077051410

View in Genome Browser
Species Human (GRCh38)
Location 11:568569-568591
Sequence GGGCCGCGCGGCGGTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051410_1077051426 23 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051426 11:568615-568637 CTTTTCTGCACGTCTGCCCGGGG No data
1077051410_1077051425 22 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051425 11:568614-568636 TCTTTTCTGCACGTCTGCCCGGG No data
1077051410_1077051428 27 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051428 11:568619-568641 TCTGCACGTCTGCCCGGGGAGGG No data
1077051410_1077051429 28 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051429 11:568620-568642 CTGCACGTCTGCCCGGGGAGGGG No data
1077051410_1077051419 -10 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data
1077051410_1077051427 26 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051427 11:568618-568640 TTCTGCACGTCTGCCCGGGGAGG No data
1077051410_1077051420 -6 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data
1077051410_1077051424 21 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051424 11:568613-568635 TTCTTTTCTGCACGTCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051410 Original CRISPR GGGCCGCGCGGCGGTGGGCG GGG (reversed) Intergenic
No off target data available for this crispr