ID: 1077051415

View in Genome Browser
Species Human (GRCh38)
Location 11:568576-568598
Sequence CACCGCCGCGCGGCCCTTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051400_1077051415 27 Left 1077051400 11:568526-568548 CCTACCGCAACGCAGCCAGTGGG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051408_1077051415 12 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051402_1077051415 23 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data
1077051398_1077051415 28 Left 1077051398 11:568525-568547 CCCTACCGCAACGCAGCCAGTGG No data
Right 1077051415 11:568576-568598 CACCGCCGCGCGGCCCTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051415 Original CRISPR CACCGCCGCGCGGCCCTTCG CGG Intergenic
No off target data available for this crispr