ID: 1077051419

View in Genome Browser
Species Human (GRCh38)
Location 11:568582-568604
Sequence CGCGCGGCCCTTCGCGGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051410_1077051419 -10 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data
1077051402_1077051419 29 Left 1077051402 11:568530-568552 CCGCAACGCAGCCAGTGGGCGCG No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data
1077051408_1077051419 18 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051419 11:568582-568604 CGCGCGGCCCTTCGCGGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051419 Original CRISPR CGCGCGGCCCTTCGCGGGCG AGG Intergenic
No off target data available for this crispr