ID: 1077051420

View in Genome Browser
Species Human (GRCh38)
Location 11:568586-568608
Sequence CGGCCCTTCGCGGGCGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051412_1077051420 -8 Left 1077051412 11:568571-568593 CCGCCCACCGCCGCGCGGCCCTT No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data
1077051411_1077051420 -7 Left 1077051411 11:568570-568592 CCCGCCCACCGCCGCGCGGCCCT No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data
1077051410_1077051420 -6 Left 1077051410 11:568569-568591 CCCCGCCCACCGCCGCGCGGCCC No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data
1077051408_1077051420 22 Left 1077051408 11:568541-568563 CCAGTGGGCGCGAGGGGGGTTCG No data
Right 1077051420 11:568586-568608 CGGCCCTTCGCGGGCGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051420 Original CRISPR CGGCCCTTCGCGGGCGAGGC CGG Intergenic
No off target data available for this crispr